Biomod/2013/Todai/Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(17 intermediate revisions by the same user not shown)
Line 8: Line 8:
.rightbar-des {
.rightbar-des {
   font-size: 90%;
   font-size: 90%;
   width: 170px;
   width: 155px;
   background-color: #ffffff;
   background-color: #ffffff;
   padding: 5px;
   padding: 5px;
  padding-right:0px;
   position: fixed;
   position: fixed;
   top: 220px;
   top: 220px;
Line 48: Line 49:
   }
   }


.Contents-list li a {
  color:black;
  text-decoration:none;
  }
  .Contents-list li {
  list-style:none;
  list-style-type: decimal;
  }
.Contents-list {
  width:650px;
  font-size: 100%;
  position: relative;
  }
</style>
</style>


Line 58: Line 73:
<div class="rightbar-des">
<div class="rightbar-des">
   <ul>
   <ul>
     <li><a href="#1.Oligomeric Cell Killer">1. Oligomeric Cell Killer</a>
     <li><a href="#Oligomeric_Cell_Killer"> Oligomeric Cell Killer</a>
         <ul>
         <ul>
           <li><a href="#1-1.General design">1-1.<br>General design</a>
           <li><a href="#1._Structure">1. Structure</a>
          </li>
          <li><a href="#2._Function">2. Function</a>
<ul>
          <li><a href="#2.1_Sites for_penetration">2.1 Sites for penetration</a>
</li>
          <li><a href="#2.2_Recognition_system">2.2 Recognition system</a>
          </li>
          <li><a href="#2.3_Sites_for_oligomerization">2.3 Sites for oligomerization</a>
 
          </li>
<li><a href="#2.4_Pore_formation">2.4 Pore formation</a>
 
          </li>
 
</ul>
</li>
<li><a href="#References">References</a>
           </li>
           </li>
         </ul>
         </ul>
     </li>
     </li>
     <li><a href="#2.Cylinder in barrel by DNA origami">2. Cylinder in barrel</a>
      
        <ul>
          <li><a href="#2-0.Purpose">2-0. <br>Purpose</a>
          </li>
          <li><a href="#2-1.Geometrical features">2-1. <br>Geometrical features</a>
          </li>
          <li><a href="#2-2.Functional features">2-2. <br>Functional features</a>
          </li>
        </ul>
    </li>
   </ul>
   </ul>
</div>
</div>
Line 85: Line 108:
<!--1. Oligomeric Cell Killer-->
<!--1. Oligomeric Cell Killer-->


   <h1 class="heading"><a name="1.Oligomeric Cell Killer">&nbsp;1. Oligomeric Cell Killer</a></h1>
   <h1 class="heading"><a name="Oligomeric_Cell_Killer">&nbsp;Oligomeric Cell Killer</a></h1>


<!--1-1. Design as an approach to our goal-->
<!--1-1. Design as an approach to our goal-->


   <article>
   <article>
    <h1 class="title"><a name="1-1.General design">&nbsp;1-1. General design</a></h1>
    <br>


     <figure>
 
      <center>
     <p class="paragraph" id="par1">
      <img src="http://openwetware.org/images/a/ac/Des1-Todai.png" width="300" height="300">
Inspired by immune system, our goal is to fabricate pore forming DNA nanostructure killing the cancer cell (termed Oligomeric Cell killer: OCK). The designed
      <figcaption style="font-size:110%;position:relative;left:-20px;">
 
      General Design
structure is shown below. Our design is characterized with four features: a broad plane-like domain to anchor on the cell surface, stick-domain to invade into
      </figcaption>
 
      </center>
the cell membrane, safety lock system for cell recognition, and connectable sites for oligomerization and pore formation.
     </figure>
     </p>
     <br>
     <br>


    <p class="paragraph">
    It is our goal for DNA nanostructure to kill a cell by forming a pore  like MAC in immune system. Therefore, we intended to design a DNA nanostructure which imitates its pore formation system by oligomerizaton. The designed structure is shown below, and this design is characterized with three features: a broad plane, bend of side edges and connectable sites.
    </p>


    <p class="paragraph">
<center>
    It requires enough free energy to penetrate membranes. By anchoring to the lipid bilayer by cholesterol modified staples, the DNA nanostructure is expected to get over the potential barrier. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature is suited to penetrate membranes.
      <table cellpadding="0">
    </p>
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/7/73/OCK_all-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
 


    <p class="paragraph">
        <td>
    From previous(Danilo D. Lasic, et al.) research <span class="ref-sup"><sup><a href="desref-1">[1]</a></sup></span>, it is suspected that DNA nonspecifically interacts with liposomes. Hence it seems the designed structure should not have any broad plane contactable to membrane undesirably, but that we thought we take advantage of this enforced interaction and can prevent undesirable connection to the membrane. So this broad plane do good rather than do harm.
        <figure>
    </p>
          <img src="http://openwetware.org/images/e/e1/Todai_OCK_flow.png" width="300px" height="300px" style="border:solid 1.5px black;">
        </figure>


    <p class="paragraph">
        </td>
    To oligomerize, the DNA nanostructure must have some binding site to each other. Though hybridization is used as the method of oligomerization in the figure, but we examine other method as well.
        </tr>
    </p>
      </table>
    <br>
    </center>


    <p class="paragraph">
      <article>
    This general design with these features  are mainly derived from prediction, and were information necessary to design our nanostructure more specifically, for example,  we need to know about the interaction between DNA and liposome(as cell membrane) and develop assay. We simplyfied our general design, and made “Cylinder in barrel”. We did some experiments with “Cylinder in barrel” in advance to the more specific design.
        <ul class="Contents-list">
    </p>


  </article>
        <li>
  <br>
        <b>Anchoring and penetration</b>
  <br>
        </a>
<br>
<p class="paragraph">
OCKs anchor and penetrate lipid bilayer by their cholesterols.
<br>
-->Cholesterol sticking site, structure
</p>
<br>
</li>


<!--2. Cylinder in barrel by DNA origami-->


  <h1 class="heading"><a name="CylinderinBarrel">&nbsp;2. Cylinder in barrel by DNA origami</a></h1>
        <li>
  <br>
<b>Recognition (safety lock system)</b>
        <br>
<p class="paragraph">
The DNA aptamer of OCK recognizes cancer cell specific membrane protein and release the biotin-modified strand locked by the DNA aptamer.
<br>
-->Aptamer lock system
</p>
<br>
</li>
        <li><b>Oligomerization</b>
<br>
<p class="paragraph">
        The activated biotins bind to the streptavidins of other monomers, resulting in the trimerization of OCKs
<br>
-->Trimerization by streptavidin-biotin complex
</p>
        <br>
</li>
        <li>
        <b>Pore formation</b>
<br>
<p class="paragraph">
The physical constraint induced by oligomerization activates the azides and alkynes reactive groups on OCK, covalently bonding the stick-domain of


  <center>
each subunits of trimeric OCKs by click chemistry. Lipids are excluded from the gap made by stick-domain of OCKs. As a result, a part of membrane is punched,
  <iframe width="420" height="315" src="http://www.youtube.com/embed/2I802ed96t0?rel=0" frameborder="0" allowfullscreen>
  </iframe>
  </center>
  <br>


and pore formation is achieved
<br>
-->Click chemistry
</p>
<br>
</li>
</ul>
    <br>


<!--2-0. Purpose-->
<!--1. Structure-->


   <article>
   <article>
     <h1 class="title"><a name="2-0.Purpose">&nbsp;2-0. Purpose</a></h1>
     <h1 class="title"><a name="1._Structure">&nbsp;1. Structure</a></h1>
     <br>
     <br>


     <p class="paragraph">
     <p class="paragraph">
    This barrel structure was designed first in order to get some feedback for our general design. caDNAno(version 2.2)was used to design the structure, and M13mp18 was chosen as the scaffold strand.
The detailed structure and scale of OCK are shown below. OCK is composed of two main domains. The plane-like domain (red) sticks to lipid bilayer, and  
 
the stick-domain (blue) penetrates into the lipid bilayer.
     </p>
     </p>
     <br>
     <br>
   
    <p class="paragraph">General design needs to oligomerize and form pore on the membrane, so we check following things by Cylinder.</p>


    <figure>
       <center>
       <center>
      <img src="http://openwetware.org/images/1/1e/OCKnaname-Todai.png" width="300" height="300">
      </center>
    </figure>
    <br>
    <p class="paragraph" id="par3">
Recognizing specific trigger signal, OCK can trimerize, making a small hole (inner and outer diameter is 4 nm and 12 nm, respectively) to punch the
cell.
</p>
<center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/7/76/OCKmigipng-Todai.png" width="300px" height="300px" >
        </figure>
        </td>
        <td>
        <figure>
          <img src="http://openwetware.org/images/0/02/OCKshoumen-Todai.png" width="300px" height="300px" >
        </figure>
        </td>
        </tr>
      </table>
    </center>
<br>
<center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/4/4d/Assemblyup-Todai.png" width="300px" height="300px" >
        </figure>
        </td>
        <td>
         <figure>
         <figure>
           <img src="http://openwetware.org/images/4/42/Des2_0purpose-Todai.png" width="420" height="420" style="border:solid 1.5px black;">
           <img src="http://openwetware.org/images/3/37/Assembly1-Todai.png" width="300px" height="300px" >
        <br>
        <br>
        <figcaption style="position:relative;left:-10px;">
        What is intended to confirm by "Cylinder".
        </figcaption>
         </figure>
         </figure>
      </center>
    <br>


    <p class="item">1) Can DNA nanostructures penetrate lipid membranes?</p>
        </td>
    <p class="item">2) Can DNA nanostructures bind each other and make dimer(or more complex structure )in solution?</p>
        </tr>
    <p class="item">3) Is that connection possible with penetrating membranes?</p>
      </table>
    <p class="item">4) Can the direction of connection be controlled?</p>
    </center>
    <br>
 
    <p class="paragraph">Therefore, the structure was equiped with following features.</p>
    
    
<!--2. Function-->
  <article>
    <h1 class="title"><a name="2._Function">&nbsp;2. Function</a></h1>
<p class="paragraph" id="par4">
OCK is equipped with functional sites for penetration and oligomerization.
</p>
   </article>
   </article>
   <br>
   <br>
  <br>
 
  <br>
<!--2.1 Sites for penetration-->
 
 
<article>
<h2 class="title"><a name ="2.1_Sites for penetration"></a>2.1 Sites for penetration</h2>
<h3 class="title">&nbsp;1)Cholesterol sticking sites</h3>
<center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/f/f6/OCK_anchoring-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
 
 
        <td>
        <figure>
          <img src="http://openwetware.org/images/2/28/OCK_penetrate-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
        </tr>
      </table>
    </center>
 
<p class="paragraph" id="par5">It requires enough free energy to penetrate membranes. This is compensated by the free energy gained from biding of the
 
DNA nanostructure bound cholesterols to the lipid bilayer. The more cholesterols are equipped to the structure, the more stabilized it stays near
 
the membrane. We attached cholesterol to our OCK by two methods; hybridization and direct incorporation. Hybridization method is accomplished by hybridizing
 
the scaffold strand and cholesterol-modified ssDNA strands. Regarding direct incorporation method, we supplemented cholesterol modified
 
staples at the formation of OCK. For both methods, we design four cholesterol sites shown below.
</p>
<br>
          <center>
          <figure>
          <img src="http://openwetware.org/images/6/66/OCK_Cholesterol-Todai.png" width="300px" height="300px" >
          </figure>
          </center>
 
<h3 class="title">&nbsp;2)Plane-domain and stick-domain</h3>
<p class="paragraph id="par6">
To ensure the penetration of DNA nanostructure (six double-helical DNA domains. diameter of 6 nm), previous research used 26 cholesterol
 
binding sites (Martin Langecker, et al.<span class="ref-sup"><a href="#desref-1">[1]</a></span>) However, too much sites may cause the heterogeneity of the
 
sample and lower yields. To resolve this points, we paid attention to character of DNA : non-specific binding to the liposome (Danilo D. Lasic, et al.<span
 
class="ref-sup"><a href="#desref-2">[2]</a></span>), which we confirmed using Rectangle type DNA origami and POPC (see \Experiment\\Pilot study section).
 
Although the non-specific binding is usually an undesirable feature, we thought that we could utilize this feature positively by means of the broad plane-
 
domain. Integrating broad plane into our DNA nanostructure, we expect some free energy gain by the non-specific binding of the broad plane to the bilayer,
 
which may stabilize the binding of our DNA structure to the bilayer. Combining the assistant of cholesterols and plane-domain, we thought that it is easy for the stick domain to penetrate into membrane.
</p>
 
</article>
<br>
<!--2.2 Recognition system (safely lock system)-->
<h2 class="title"><a name="2.2_Recognition_system"></a>2.2 Recognition system (safely lock system)</h2>
<p class="paragraph" id="par7">
The key feature of OCK is keeping monomeric state in solution and on normal cell, while oligomerization on cancer cell. To ensure this feature,
 
recognition system (safety lock system) is required to prevent the non-specific oligomerization, while having ability to oligomerization.
</p>
 
    <center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/d/d1/OCK_AptamerLockBiotin-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
 
 
        <td>
        <figure>
          <img src="http://openwetware.org/images/d/d1/OCK_AptamerUnlockBiotin-Todai.png" width="300px" height="300px"
        </figure>
        </td>
        </tr>
      </table>
    </center>
 
 
<p class="paragraph" id="par8">
As a recognition system, we use DNA aptamer. In general, DNA aptamer recognize specific ligand. And if some part of DNA aptamer is hybridized with
 
complementary strand, the complementary strand is released from the DNA aptamer on the binding of ligands, because ligands take over the DNA strands of DNA
 
aptamer from the complementally strands. We used this scheme as followings. Shown in the figure, the biotin modified aptamer complementary strands are
 
adhering to OCK, therefore the streptavidins cannot access to the biotin. On recognition of cancer specific membrane protein, biotin modified strands are
 
released and can bind to streptavidin. Therefore, the cancer cell recognition and OCK oligomerization are achieved simultaneously.
</p>
<p class="paragraph" id="par9"
In this project, PDGF was modified with cholesterols and used as model mimic membrane protein, as DNA aptamer system for PDGF was established.(S. M.
 
Douglas, et al.<span class="ref-sup"><a href="#desref-3">[3]</a></span>)
</p>
 
</article>
<br>
<!--2.3 Sites for oligomerization-->
<article>
<h2 class="title"><a name="2.3_Sites_for_oligomerization"></a>2.3 Sites for oligomerization</h2>
<h3 class="title">&nbsp;1)Necessity of precise control</h3>
<p class="paragraph" id="par10">
When OCKs recognize cancer cell on the membrane, they are oligomerized (get trimer) and make pore. To achieve these steps, we designed the structure
 
of prototype, which was simpler than the current design.
</p>
 
    <center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/3/35/OCK_prototype-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
 
 
        <td>
        <figure>
          <img src="http://openwetware.org/images/1/1d/OCK_current-Todai.png" width="300px" height="300px"
        </figure>
        </td>
        </tr>
      </table>
    </center>
 
<p class="paragraph" id="par11">
We choose biotin-streptavidin interaction as the oligomerization method, as the preliminary experiments using barrel structure (see \Experiment\\Pilot
 
study section) showed that the hybridization method was not a suitable way to oligomerization because of the difficulty to prevent the non-specific
 
interaction between monomers. We designed our prototype OCK as shown above, which has tow biotins on the left and right sides. However this simple design
 
produce not only the desired trimer structure, but also the undesired oligomer shown below.
</p>
 
    
    
<!--2-1. Geometrical features-->
    <center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/d/d2/OCK_goodTrimer.png" width="300px" height="300px" >
 
        </figure>
        </td>
 
 
        <td>
        <figure>
          <img src="http://openwetware.org/images/d/dc/OCK_badTrimer.png" width="300px" height="300px">
        </figure>
        </td>
        </tr>
      </table>
    </center>
    <div>
            <figure>
          <img src="http://openwetware.org/images/b/b4/OCK_Biotin-Todai.png" width="300" height="300" style="float:right; margin:0;margin-left:10px;margin-


  <article>
bottom:10px; margin-top:10px; position:relative;
    <h1 class="title"><a name="2-1.Geometrical features">&nbsp;2-1. Geometrical features</a></h1>
  left:35px;">
   
        </figure>
    <br>
        <br>
    <figure>
        <br>
      <center>
<p class="paragraph" id="par12">
      <img src="http://openwetware.org/images/7/79/BarrelSize-Todai.png" width="300px" height="300px" >
As a solution, we introduce the asymmetry into OCK, because symmetry of prototype produces the alternative form of oligomer. To do this, we built in  
      <figcaption style="position:relative;left:-25px;">
      The dimentions of a cylinder in barrel
      </figcaption>
      </center>
    </figure>
    <br>


    <p class="paragraph">
biotin in one side (with recognition system to control the oligomerization), and streptavidin in other side. However, we found that simply attaching
    To get reliable information, the design of  cylinder needs to be simple and realistic. We refered to the past research (Martin Langecker et al.)<span class="ref-sup"><a href="#desref-2">[2]</a></span>and designed geometrical features.
    </p>


    <p class="paragraph">
streptavidin in one side is not enough for our OCK, especially in the oligomerization process of OCK (see next section). We solved this problem by introducing
The cylinder domain is about 65nm long(195bp) and consists of six dsDNA helixes, so its diameter is 6nm long. The barrel domain is approximately 43nm long(128bp) and 48 helixes builds this domain. Because the  part of the cylinder sticking out needs to penetrate lipid membranes, which is 2nm thick liposome used in experiments, the length of that part(about 20nm) is enough to go through lipid membranes. By covering the cylinder with barrel, this structure can be equiped with more cholesterols than that without barrels.</p>
    <p class="paragraph">
    (Cholesterol is necessary to penetrate membranes, about which is written in next section.)
    </p>


  </article>
a well in OCK and embedding the streptavidin in the well.
  <br>
</p>
</div>


<!--2-2. Functional features-->


  <article>
<br>
    <h1 class="title"><a name="2-2.Functional features">&nbsp;2-2. Functional features</a></h1>
<br>
   
<br>
     <br>
     <br>
    <figure>
      <center>
      <img src="http://openwetware.org/images/a/a1/BarrelCholesterol-Todai.png" width="300px" height="300px" >
      <br>
      <br>
      <figcaption style="position:relative;left:-10px;">
      How "Cylinder" penetrates membranes
      </figcaption>
      <figcaption style="position:relative;left:-10px;">
      (This arrangement of lipids is refered to previous research. <span class="ref-sup"><a href="#desref-2">[2]</a></span>)
      </figcaption>
      </center>
    </figure>
     <br>
     <br>


    <p class="paragraph">
<h3 class="title">&nbsp;2)DNA well</h3>
    Because DNA has negative charge, the DNA nanorobots have to gain some energy to penetrate lipid membrane, which is composed of amphiphilic molecules. This problem is solved by binding cholesterols to the structures. The barrel domain has 26 staple strands complementary to cholesterol modified DNA oligo, and the oligomers are hybridized to these staples.The DNA structure anchors itself to membrane by cholesterols, and it gives stability for the structure to stay near membranes.Therefore, the structure can pierce lipid bilayer.
    </p>
        <figure>
    <br>
          <img src="http://openwetware.org/images/3/34/OCK_SAWell.png" width="300" height="300" style="float:left; margin:0;margin-left:10px;margin-
 
bottom:10px;  position:relative;
  left:-35px;">
        </figure>
<p class="paragraph" id="par13">
Precise arrangement of OCK subunit is necessary for proper oligomerization, especially for the tight connection of stick-domain, as the size of lipids


   
are much small (-1 nm) compare to the size of OCK (-100nm). In this point of view, the flexibility of the position of streptavidin makes the situation


    <center>
difficult. To solve this problem easily, DNA well is equipped to OCK and the streptavidins were stored.
</p>
<br>
<br>
<br>
<br>
       <table cellpadding="0">
       <table cellpadding="0">
         <tr>
         <tr>
         <td>
         <td>
         <figure>
         <figure>
           <img src="http://openwetware.org/images/e/e3/Des2_2_3rdparagraph1-Todai.png" width="200px" height="200px" >
           <img src="http://openwetware.org/images/7/7f/OCK_SAjammer.png" width="300px" height="300px" >
          <figcaption>[Mechanism of binding-1]</figcaption>
 
          <figcaption>
          dimerized by the strands <br>
          sticking out from the top
          </figcaption>
         </figure>
         </figure>
         </td>
         </td>


         <td>
         <td>
         <figure>
         <figure>
           <img src="http://openwetware.org/images/7/7a/Des_2_2_3rdparagraph2-Todai.png" width="200px" height="200px" >
           <img src="http://openwetware.org/images/8/8c/OCK_SAinWell-Todai.png" width="300px" height="300px" >
              <figcaption>[Mechanism of binding-2]</figcaption>
 
              <figcaption>dimerized by the strands <br>
              sticking out from the side
              </figcaption>
         </figure>
         </figure>
         </td>
         </td>
         </tr>
         </tr>
       </table>
       </table>
    </center>
</article>
<p class="paragraph">
<br>
    Three different sequences of staples to hybridize cholesterol modified oligomers were prepared.
<!--2.4 Pore formation-->
    </p>
<h2 class="title"><a name ="2.4_Pore_formation"></a>2.4 Pore formation</h2>
<h3 class="title">&nbsp;1)Click chemistry</h3>
        <figure>
          <img src="http://openwetware.org/images/d/d1/OCK_Clickgroup-Todai.png" width="300" height="300" style="  position:relative;
  left:-35px; float:left; margin:0;margin-right:-10px;margin-bottom:10px;">
 
        </figure>
<p class="paragraph" id="par14">
Thus far, the devices for regioselective oligomerization have been explained. However, there still remains a task; exclusion of lipids out from the
 
gab made by trimer of OCKs. To do this, the linkers connecting each OCK subunits must be short enough to ensure the inter-subunit adhesion of OCKs's stick-
 
domain. In that view of point, streptavidin is not suitable glue, because the diameter of streptavidins is approximately 5 nm. On the other hand, 1, 2, 3 -


    <p class="item">
triazole (the product of Click chemistry) is adequate, because the scale of the product is in the sub- to a few nanometer range (In this section, click
1:CCTCTCACCCACCATTCATC (from previous research(Alexander johnson-Buck et al.<span class="ref-sup"><a href="#desref-3">[3]</a></span>))
    </p>
    <p class="item">
2:TAACAGGATTAGCAGAGCGAGG (from previous research(Martin Langecker et al.<span class="ref-sup"><a href="#desref-2">[2]</a></span>))
    </p>
    <p class="item">
3:GGAACTTCAGCCCAACTAACATTTT
    </p>


    <p class="noindent-paragraph">
chemistry means the Huisgen cycloaddition reaction between alkyne and azide). Therefore, OCKs are equipped with alkyne and azide reactive groups.  
They are different in the length of the hybridizing sequence. About cholesterol modified oligomers, their sequences are perfectly complementary to the three sequences above, and their 5' ends are modified by a cholesterol.
</p>
    </p>
<!--necessary to change graphics-->
    <p class="paragraph">
To achieve the purpose iii), the structure has binding site by hybridization. Two pairs of sequences were assigned for hybridization. Both are refered to previous work about logic-gated nanorobot of DNA(Shawn M. Douglas, et al.
    <span class="ref-sup"><a href="#desref-4">[4]</a></span>).
    They are derived from aptamer sequence,one is TE17, the other is sgc8c(and the complementary strands to these, so two pairs). These sequences were chosen because it is considered that these sequences don't prevent the folding of scaffold. The sequences of them are below:
    </p>
    <p class="item">1:TCTAACCGTACAGTATTTTCCCGGCGGCGCAGCAGTTAGA TT(sgc8c aptamer + TT)
    </p>
    <p class="item">2:TT CAGCACCCAGTCAGAAGCAGGTGTTCGGAGTTTTGTATTGCGTAGCTG(TT+ TE17 aptamer )
    </p>


    <p class="noindent-paragraph">
    Designed structures have either the aptamer sequences(1,2) or the two complementary strands(1,2). When two structures with different pairs are mixed and hybridization happens, these structures hence bind each other through two binding sites. Two types of binding sites were designed to test that the direction of connection can be controlled. One type of binding site uses staples sticking out from the ends of scaffolds. The other from near sites, but the direction in which staples stick out is controlled. It is intended to controll the direction of binding by the intereference between structure and hybridized aptamers.
    </p>


    <figure>
     
       <center>
       <center>
      <img src="http://openwetware.org/images/5/5a/Des_2_2_4thparagraph-Todai.png" width="300px" height="300px" >
        <figure>
      <figcaption style="position:relative;left:-20px">
          <img src="http://openwetware.org/images/d/d1/600x240CLick-Todai.png" width="600" height="240" >
      Fluorescent materials are equipped
        <br>
      <br>by streptavidin-biotin interaction.
        <br>
      </figcaption>
 
        </figure>
       </center>
       </center>
    </figure>
     <br>
     <br>
<p clas="paragraph" id="par15">
Usually, this click reaction demands copper as catalyst. However, copper does not exist in human body. Therefore, copper free click chemistry was
studied in this project. As explained in result, the reaction rate of copper free click chemistry is very slow in solution (association rate constant ~ 8.1
/M/s = 17h@2uM reagents), but is accelerated when the reaction groups (azide and alkyne) are forced to be close. In other words, azide and alkyne reactive


    <p class="paragraph">
groups do not react each other in solution, but easy to react each other after oligomerization. This character is very suitable to prevent non-specific
To detect the cylinder piercing membrane, two biotin modified staple strands are out from its bottom. Streptavidins with fluoresence bind them in advance, and only the cylinders penetrating liposome are protected from protease when the cylinders are mixed with liposome. Therefore, it is possible to observe whether there are cylinders penetrating by their fluoresence.
 
    </p>
oligomerization, while accelerating the specific oligomerization.  
</p>
      <center>
        <figure>
          <img src="http://openwetware.org/images/c/c5/OCK_ConstraintClick-Todai.png" width="300" height="300" style="border:solid 1.5px black;">
        <br>
        <br>


        </figure>
      </center>
     <br>
     <br>
    <p class="paragraph">
<p class="paragraph">
From the results of experiments with “Cylinder” we will decide our final design.
To detect whether click reaction happened, OCKs have two fluorescent dyes, Cy3 and Cy5. These fluorescent dyes are adhere to the azide-modified site
    </p>
 
  </article>
and the alkyne-modified site respectively (dye - dye distance is roughly 1 - 2 nm), so FRET signal between Cy3 and Cy5 is observed if click reaction occurred.
  <br>
</p>
    <center>
      <table cellpadding="0">
        <tr>
        <td>
        <figure>
          <img src="http://openwetware.org/images/a/a2/OCK_Cy3fluorescent-Todai.png" width="300px" height="300px" >
 
        </figure>
        </td>
 
 
        <td>
        <figure>
          <img src="http://openwetware.org/images/8/83/OCK_Cy5FRET-Todai.png" width="300px" height="300px" >


        </figure>
        </td>
        </tr>
      </table>
    </center>
<!--References-->
<!--References-->


Line 320: Line 598:
     <h1 class="title"><a name="References">&nbsp;References</a></h1>
     <h1 class="title"><a name="References">&nbsp;References</a></h1>
     <br>
     <br>


     <div>     
     <div>     
         <div class="reference-title">
         <div class="reference-title">
          <a name="#desref-1">
        <a name="desref-1">
          [1] The Structure of DNA−Liposome Complexes
        [1] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures  
          </a>
        </div>
          <div class="reference-author">
          Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik,  and Peter M. Frederik
          </div>
              <div class="reference-journal">
              Journal of the American Chemical Society 1997 119 (4), 832-833
              </div>
    </div>
    <br>
    <div>   
        <div class="reference-title">
        <a name="#desref-2">
        [2] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures  
         </a>
         </a>
         </div>
         </div>
Line 349: Line 612:
               </div>
               </div>
     </div>
     </div>
    <br>
<br>
     <div>     
     <div>     
         <div class="reference-title">
         <div class="reference-title">
        <a name="#desref-3">
          <a name="desref-2">
        [3] Multifactorial Modulation of Binding and Dissociation Kinetics on Two-Dimensional DNA Nanostructures
          [2] The Structure of DNA−Liposome Complexes
        </a>
          </a>
         </div>
         </div>
           <div class="reference-author">
           <div class="reference-author">
           Alexander Johnson-Buck, Jeanette Nangreave, Shuoxing Jiang, Hao Yan, and Nils G.  
           Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik, and Peter M. Frederik
           </div>
           </div>
               <div class="reference-journal" style="font-style:italic;">
               <div class="reference-journal">
               WalterNano Letters 2013 13 (6), 2754-2759
               Journal of the American Chemical Society 1997 119 (4), 832-833
               </div>
               </div>
     </div>
     </div>
     <br>
     <br>
    <div>   
 
         <div class="reference-title">
         <div class="reference-title">
         <a name="#desref-4">
         <a name="desref-3">
         [4] A logic-gated nanorobot for targeted transport of molecular payloads.  
         [3] A logic-gated nanorobot for targeted transport of molecular payloads.  
         </a>
         </a>
         </div>
         </div>
Line 388: Line 651:
   <br>
   <br>
   <br>
   <br>
<footer style="position:relative;left:400px">
<footer style="position:relative;left:400px">
<small>
<small>

Latest revision as of 23:28, 26 October 2013

<html> <head> <meta name="viewport" content="width=1200">

<style> <!--

body{

 font-family:Verdana;
 Myriad Pro;
 Arial;
 background-color: #fffc77;
 overflow-y:scroll;
 overflow-x:hidden;
 }

article{

 background-color: #ffffff
 }

.Logo {

 position: relative;
 left: -39px;
 }

.zairyou-heading {

 font-size: 120%;
 position: relative;
 left:30px;
 line-height: 2.2;
 }

.zairyou-heading-sub {

 font-size: 110%;
 position: relative;
 left:30px;
 line-height: 2.2;
 }

.zairyou-list {

 font-size: 100%;
 position: relative;
 left: 40px;
 }

p.paragraph{

 font-size :110%;
 line-height:1.5;
 margin:0 20px;
 text-indent: 1em;
 }

p.noindent-paragraph {

 font-size :110%;
 line-height:1.5;
 margin:0 20px;
 }

p.item {

 font-size :110%;
 line-height:1.5;
 margin:0px 20px;
 text-indent: 2em;
 }

h1.title a{

 font-size :90%;
 font-style:italic;
 display: block;
 text-decoration: none;
 color: #000000;

 font-weight:bolder;

 border-left: solid 5px #e00000 
 }

h1.big-title a{

 font-size :110%;
 display: block;
 text-decoration: none;
 color: #000000;

 font-weight:300;

 }

h1.heading a{

 font-size :95%;
 display: block;
 text-decoration: none;
 color: #000000;

 font-weight:100;

 border-left: solid 7px #ffa500
 }

h2.small-title a{

 font-size :100%;
 display:block;
 text-decoration: none;

 font-weight:bolder;

 color: #e00000;
 }

.sidebar {

 font-size: 110%;
 width: 110px;
 background-color: #ffffff;
 padding: 7px;
 position: fixed;
 top: 167px;
 left: auto;
 z-index: 20;
 margin: 0 0 0 -175px;
 border:solid 1.5px orange;
 }

.sidebar ul {

 position:relative;
 top:-3px;
 left:-3px;
 }

.sidebar ul li ul {

 list-style: none;
 position: relative;
 left: -15px
 }

.sidebar ul li ul li a{

 font-size: 85%;
 }

a:link {color:#000000;} a:visited {color:#000000;} a:hover {color:#e00000;} a:active {color:#e00000;}

.Return-Logo a{

 position: fixed;
 bottom: 10px;
 left: auto;
 margin: 0 0 0 789px;
 z-index: 20;
 display:block;
 width:60px;
 height:0px;
 padding-top:60px;
 background:url(http://openwetware.org/images/b/b1/Return-top-0828new.png);
 overflow:hidden;
 }

.Return-Logo a:hover {

 background-position: left bottom;
 }

.reference-title a{

 color:#000000;
 font-size:110%;
 font-weight:bolder;
 text-decoration:none;
 }

.reference-author {

 font-size:110%;
 position:relative;
 left:30px;
 }

.reference-journal {

 font-size:110%;
 font-style:italic;
 position:relative;
 left:30px;
 }

.ref-sup a{

 vertical-align:super;
 color:#e00000;
 text-decoration:none;
 }
  1. column-one { display:none; width:0px;}

.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}

  1. content { width: 0px; margin: 0 auto auto 0; padding: 0em 0em 0em 0em; align: center;}
  2. column-content {width: 0px; float: left; margin: 0 0 0 0;padding: 0;}

.firstHeading {display:none; width:0px;}

  1. globalWrapper{width:800px; background-color: #ffffff; margin-left: auto; margin-right: auto}
  2. column-one {display:none; width:0px;background-color: #ffffff;}
  3. content{ margin: 0 0 0 0;padding: 12px 12px 12px 12px; width:775px;border: 0;}
  4. bodyContent{ width: 730px; align: center; background-color: #ffffff;position:relative;left:20px;}
  5. column-content{width: 800px;background-color: #ffffff;}
  6. footer{position: center; width: 800px}

-->

</style> </head>

<body>

   <div id="top">	
     <figure>
       <div  class="Logo">
         <img src="http://openwetware.org/images/9/9c/Logo-OCKver.png" width=730px height=128px>
       </div>
     </figure>
   </div>
   <br>

<div class="sidebar">

 <ul>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai">Home</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Project">Project</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Design">Design</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Result">Result</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment">Experiment</a>
       <ul style="list-style-type: none;">

<li>

          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Contents">
          Contents</a></li>
          <li>
          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#PilotStudy">
          Pilot Study</a></li>
          <li>
          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Protocols">
          Protocols</a></li>
       </ul>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Team">Team</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Sponsors">Sponsors</a>
    </li>
 </ul>

</div>


<div class="Return-Logo">

 <a href="#TOP">
   <figure>
     <img src="http://openwetware.org/images/b/b1/Return-top-0828new.png" width:60px height:60px>
   </figure>
 </a>

</div>

</body> </html>

<html> <head> <title>Design-Todai nanORFEVRE-</title> <style>

.rightbar-des {

 font-size: 90%;
 width: 155px;
 background-color: #ffffff;
 padding: 5px;
 padding-right:0px;
 position: fixed;
 top: 220px;
 left: auto;
 z-index: 20;
 margin: 0 0 0 797px;
 border:solid 1.5px orange;
 }

.rightbar-des ul {

 position:relative;
 left:-15px;
 line-height:1.5;
 list-style:none;
 }

.rightbar-des ul li {

 }

.rightbar-des ul li ul li{

 position:relative;
 left:10px;
 }

.reference-title {

 font-size:110%;
 font-weight:bolder;
 }

.reference-author {

 font-size:110%;
 }

.reference-journal {

 font-size:110%;
 font-style:italic;
 }


.Contents-list li a {

 color:black;
 text-decoration:none;
 }
 .Contents-list li {
 list-style:none;
 list-style-type: decimal;
 }

.Contents-list {

 width:650px;
 font-size: 100%;
 position: relative;
 }

</style>

</head>

<body>

<!--rightbar-->

<div class="rightbar-des">

 <ul>
    <li><a href="#Oligomeric_Cell_Killer"> Oligomeric Cell Killer</a>
       <ul>
         <li><a href="#1._Structure">1. Structure</a>
         </li>
         <li><a href="#2._Function">2. Function</a>

<ul>

         <li><a href="#2.1_Sites for_penetration">2.1 Sites for penetration</a>

</li>

         <li><a href="#2.2_Recognition_system">2.2 Recognition system</a>
         </li>
         <li><a href="#2.3_Sites_for_oligomerization">2.3 Sites for oligomerization</a>
         </li>

<li><a href="#2.4_Pore_formation">2.4 Pore formation</a>

         </li>

</ul> </li> <li><a href="#References">References</a>

         </li>
       </ul>
    </li>
    
 </ul>

</div>


<!--Design-->

  <h1 class="big-title"><a name="Design">&nbsp;Design</a></h1>
  <br>

<!--1. Oligomeric Cell Killer-->

  <h1 class="heading"><a name="Oligomeric_Cell_Killer">&nbsp;Oligomeric Cell Killer</a></h1>

<!--1-1. Design as an approach to our goal-->

  <article>


    <p class="paragraph" id="par1">

Inspired by immune system, our goal is to fabricate pore forming DNA nanostructure killing the cancer cell (termed Oligomeric Cell killer: OCK). The designed

structure is shown below. Our design is characterized with four features: a broad plane-like domain to anchor on the cell surface, stick-domain to invade into

the cell membrane, safety lock system for cell recognition, and connectable sites for oligomerization and pore formation.

    </p>
    <br>


<center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/7/73/OCK_all-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/e/e1/Todai_OCK_flow.png" width="300px" height="300px" style="border:solid 1.5px black;">
       </figure>
       </td>
       </tr>
     </table>
   </center>
      <article>
        <ul class="Contents-list">
        <li>
        <b>Anchoring and penetration</b>
        </a>

<br> <p class="paragraph"> OCKs anchor and penetrate lipid bilayer by their cholesterols. <br> -->Cholesterol sticking site, structure </p> <br> </li>


       <li>

<b>Recognition (safety lock system)</b>

       <br>

<p class="paragraph"> The DNA aptamer of OCK recognizes cancer cell specific membrane protein and release the biotin-modified strand locked by the DNA aptamer. <br> -->Aptamer lock system </p> <br> </li>

       <li><b>Oligomerization</b>

<br> <p class="paragraph">

       The activated biotins bind to the streptavidins of other monomers, resulting in the trimerization of OCKs

<br> -->Trimerization by streptavidin-biotin complex </p>

       <br>

</li>

       <li>
       <b>Pore formation</b>

<br> <p class="paragraph"> The physical constraint induced by oligomerization activates the azides and alkynes reactive groups on OCK, covalently bonding the stick-domain of

each subunits of trimeric OCKs by click chemistry. Lipids are excluded from the gap made by stick-domain of OCKs. As a result, a part of membrane is punched,

and pore formation is achieved <br> -->Click chemistry </p> <br> </li> </ul>

    <br>

<!--1. Structure-->

  <article>
   <h1 class="title"><a name="1._Structure">&nbsp;1. Structure</a></h1>
   <br>
    <p class="paragraph">

The detailed structure and scale of OCK are shown below. OCK is composed of two main domains. The plane-like domain (red) sticks to lipid bilayer, and

the stick-domain (blue) penetrates into the lipid bilayer.

    </p>
    <br>
    <figure>
     <center>
      <img src="http://openwetware.org/images/1/1e/OCKnaname-Todai.png" width="300" height="300">
     </center>
    </figure>
    <br>
    	<p class="paragraph" id="par3">
	Recognizing specific trigger signal, OCK can trimerize, making a small hole (inner and outer diameter is 4 nm and 12 nm, respectively) to punch the 

cell. </p>


<center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/7/76/OCKmigipng-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/0/02/OCKshoumen-Todai.png" width="300px" height="300px" >
       </figure>
       </td>
       </tr>
     </table>
   </center>

<br>

<center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/4/4d/Assemblyup-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/3/37/Assembly1-Todai.png" width="300px" height="300px" >
       </figure>
       </td>
       </tr>
     </table>
   </center>
 
  

<!--2. Function-->

  <article>
   <h1 class="title"><a name="2._Function">&nbsp;2. Function</a></h1>

<p class="paragraph" id="par4"> OCK is equipped with functional sites for penetration and oligomerization. </p>

  </article>
  <br>

<!--2.1 Sites for penetration-->

<article> <h2 class="title"><a name ="2.1_Sites for penetration"></a>2.1 Sites for penetration</h2> <h3 class="title">&nbsp;1)Cholesterol sticking sites</h3> <center>

     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/f/f6/OCK_anchoring-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/2/28/OCK_penetrate-Todai.png" width="300px" height="300px" >
       </figure>
       </td>
       </tr>
     </table>
   </center>

<p class="paragraph" id="par5">It requires enough free energy to penetrate membranes. This is compensated by the free energy gained from biding of the

DNA nanostructure bound cholesterols to the lipid bilayer. The more cholesterols are equipped to the structure, the more stabilized it stays near

the membrane. We attached cholesterol to our OCK by two methods; hybridization and direct incorporation. Hybridization method is accomplished by hybridizing

the scaffold strand and cholesterol-modified ssDNA strands. Regarding direct incorporation method, we supplemented cholesterol modified

staples at the formation of OCK. For both methods, we design four cholesterol sites shown below. </p> <br>

         <center>
         <figure>
         <img src="http://openwetware.org/images/6/66/OCK_Cholesterol-Todai.png" width="300px" height="300px" >
         </figure>
         </center>

<h3 class="title">&nbsp;2)Plane-domain and stick-domain</h3> <p class="paragraph id="par6"> To ensure the penetration of DNA nanostructure (six double-helical DNA domains. diameter of 6 nm), previous research used 26 cholesterol

binding sites (Martin Langecker, et al.<span class="ref-sup"><a href="#desref-1">[1]</a></span>) However, too much sites may cause the heterogeneity of the

sample and lower yields. To resolve this points, we paid attention to character of DNA : non-specific binding to the liposome (Danilo D. Lasic, et al.<span

class="ref-sup"><a href="#desref-2">[2]</a></span>), which we confirmed using Rectangle type DNA origami and POPC (see \Experiment\\Pilot study section).

Although the non-specific binding is usually an undesirable feature, we thought that we could utilize this feature positively by means of the broad plane-

domain. Integrating broad plane into our DNA nanostructure, we expect some free energy gain by the non-specific binding of the broad plane to the bilayer,

which may stabilize the binding of our DNA structure to the bilayer. Combining the assistant of cholesterols and plane-domain, we thought that it is easy for the stick domain to penetrate into membrane. </p>

</article> <br> <!--2.2 Recognition system (safely lock system)--> <h2 class="title"><a name="2.2_Recognition_system"></a>2.2 Recognition system (safely lock system)</h2> <p class="paragraph" id="par7"> The key feature of OCK is keeping monomeric state in solution and on normal cell, while oligomerization on cancer cell. To ensure this feature,

recognition system (safety lock system) is required to prevent the non-specific oligomerization, while having ability to oligomerization. </p>


   <center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/d/d1/OCK_AptamerLockBiotin-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/d/d1/OCK_AptamerUnlockBiotin-Todai.png" width="300px" height="300px" 
       </figure>
       </td>
       </tr>
     </table>
   </center>


<p class="paragraph" id="par8"> As a recognition system, we use DNA aptamer. In general, DNA aptamer recognize specific ligand. And if some part of DNA aptamer is hybridized with

complementary strand, the complementary strand is released from the DNA aptamer on the binding of ligands, because ligands take over the DNA strands of DNA

aptamer from the complementally strands. We used this scheme as followings. Shown in the figure, the biotin modified aptamer complementary strands are

adhering to OCK, therefore the streptavidins cannot access to the biotin. On recognition of cancer specific membrane protein, biotin modified strands are

released and can bind to streptavidin. Therefore, the cancer cell recognition and OCK oligomerization are achieved simultaneously. </p> <p class="paragraph" id="par9" In this project, PDGF was modified with cholesterols and used as model mimic membrane protein, as DNA aptamer system for PDGF was established.(S. M.

Douglas, et al.<span class="ref-sup"><a href="#desref-3">[3]</a></span>) </p>

</article> <br> <!--2.3 Sites for oligomerization--> <article> <h2 class="title"><a name="2.3_Sites_for_oligomerization"></a>2.3 Sites for oligomerization</h2> <h3 class="title">&nbsp;1)Necessity of precise control</h3> <p class="paragraph" id="par10"> When OCKs recognize cancer cell on the membrane, they are oligomerized (get trimer) and make pore. To achieve these steps, we designed the structure

of prototype, which was simpler than the current design. </p>

   <center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/3/35/OCK_prototype-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/1/1d/OCK_current-Todai.png" width="300px" height="300px" 
       </figure>
       </td>
       </tr>
     </table>
   </center>

<p class="paragraph" id="par11"> We choose biotin-streptavidin interaction as the oligomerization method, as the preliminary experiments using barrel structure (see \Experiment\\Pilot

study section) showed that the hybridization method was not a suitable way to oligomerization because of the difficulty to prevent the non-specific

interaction between monomers. We designed our prototype OCK as shown above, which has tow biotins on the left and right sides. However this simple design

produce not only the desired trimer structure, but also the undesired oligomer shown below. </p>


   <center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/d/d2/OCK_goodTrimer.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/d/dc/OCK_badTrimer.png" width="300px" height="300px"> 
       </figure>
       </td>
       </tr>
     </table>
   </center>
   <div>
           <figure>
         <img src="http://openwetware.org/images/b/b4/OCK_Biotin-Todai.png" width="300" height="300" style="float:right; margin:0;margin-left:10px;margin-

bottom:10px; margin-top:10px; position:relative;

 left:35px;">
       </figure>
       <br>
       <br>

<p class="paragraph" id="par12"> As a solution, we introduce the asymmetry into OCK, because symmetry of prototype produces the alternative form of oligomer. To do this, we built in

biotin in one side (with recognition system to control the oligomerization), and streptavidin in other side. However, we found that simply attaching

streptavidin in one side is not enough for our OCK, especially in the oligomerization process of OCK (see next section). We solved this problem by introducing

a well in OCK and embedding the streptavidin in the well. </p> </div>


<br> <br> <br>

    <br>
    <br>

<h3 class="title">&nbsp;2)DNA well</h3>

       <figure>
         <img src="http://openwetware.org/images/3/34/OCK_SAWell.png" width="300" height="300" style="float:left; margin:0;margin-left:10px;margin-

bottom:10px; position:relative;

 left:-35px;">
       </figure>

<p class="paragraph" id="par13"> Precise arrangement of OCK subunit is necessary for proper oligomerization, especially for the tight connection of stick-domain, as the size of lipids

are much small (-1 nm) compare to the size of OCK (-100nm). In this point of view, the flexibility of the position of streptavidin makes the situation

difficult. To solve this problem easily, DNA well is equipped to OCK and the streptavidins were stored. </p> <br> <br> <br> <br>

     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/7/7f/OCK_SAjammer.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/8/8c/OCK_SAinWell-Todai.png" width="300px" height="300px" >
       </figure>
       </td>
       </tr>
     </table>

</article> <br> <!--2.4 Pore formation--> <h2 class="title"><a name ="2.4_Pore_formation"></a>2.4 Pore formation</h2> <h3 class="title">&nbsp;1)Click chemistry</h3> <figure>

         <img src="http://openwetware.org/images/d/d1/OCK_Clickgroup-Todai.png" width="300" height="300" style="  position:relative;
 left:-35px; float:left; margin:0;margin-right:-10px;margin-bottom:10px;">
       </figure>

<p class="paragraph" id="par14"> Thus far, the devices for regioselective oligomerization have been explained. However, there still remains a task; exclusion of lipids out from the

gab made by trimer of OCKs. To do this, the linkers connecting each OCK subunits must be short enough to ensure the inter-subunit adhesion of OCKs's stick-

domain. In that view of point, streptavidin is not suitable glue, because the diameter of streptavidins is approximately 5 nm. On the other hand, 1, 2, 3 -

triazole (the product of Click chemistry) is adequate, because the scale of the product is in the sub- to a few nanometer range (In this section, click

chemistry means the Huisgen cycloaddition reaction between alkyne and azide). Therefore, OCKs are equipped with alkyne and azide reactive groups. </p> <!--necessary to change graphics-->


     <center>
       <figure>
         <img src="http://openwetware.org/images/d/d1/600x240CLick-Todai.png" width="600" height="240" >
        <br>
        <br>
       </figure>
     </center>
    <br>

<p clas="paragraph" id="par15"> Usually, this click reaction demands copper as catalyst. However, copper does not exist in human body. Therefore, copper free click chemistry was

studied in this project. As explained in result, the reaction rate of copper free click chemistry is very slow in solution (association rate constant ~ 8.1

/M/s = 17h@2uM reagents), but is accelerated when the reaction groups (azide and alkyne) are forced to be close. In other words, azide and alkyne reactive

groups do not react each other in solution, but easy to react each other after oligomerization. This character is very suitable to prevent non-specific

oligomerization, while accelerating the specific oligomerization. </p>

     <center>
       <figure>
         <img src="http://openwetware.org/images/c/c5/OCK_ConstraintClick-Todai.png" width="300" height="300" style="border:solid 1.5px black;">
        <br>
        <br>
       </figure>
     </center>
    <br>

<p class="paragraph"> To detect whether click reaction happened, OCKs have two fluorescent dyes, Cy3 and Cy5. These fluorescent dyes are adhere to the azide-modified site

and the alkyne-modified site respectively (dye - dye distance is roughly 1 - 2 nm), so FRET signal between Cy3 and Cy5 is observed if click reaction occurred. </p>

   <center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/a/a2/OCK_Cy3fluorescent-Todai.png" width="300px" height="300px" >
       </figure>
       </td>


       <td>
       <figure>
         <img src="http://openwetware.org/images/8/83/OCK_Cy5FRET-Todai.png" width="300px" height="300px" >
       </figure>
       </td>
       </tr>
     </table>
   </center>

<!--References-->

  <article>
    <h1 class="title"><a name="References">&nbsp;References</a></h1>
    <br>
    <div>     
       <div class="reference-title">
       <a name="desref-1">
       [1] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures 
       </a>
       </div>
          <div class="reference-author">
          Martin Langecker, Vera Arnaut, Thomas G. Martin, Jonathan List, Stephan Renner, Michael Mayer, Hendrik Dietz, and Friedrich C. Simmel
          </div>
             <div class="reference-journal">
             Science 16 November 2012: 338 (6109), 932-936. [DOI:10.1126/science.1225624] 
             </div>
    </div>

<br>

    <div>     
       <div class="reference-title">
         <a name="desref-2">
         [2] The Structure of DNA−Liposome Complexes
         </a>
       </div>
          <div class="reference-author">
          Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik,  and Peter M. Frederik
          </div>
             <div class="reference-journal">
             Journal of the American Chemical Society 1997 119 (4), 832-833 
             </div>
    </div>
    <br>
  
       <div class="reference-title">
       <a name="desref-3">
       [3] A logic-gated nanorobot for targeted transport of molecular payloads. 
       </a>
       </div>
          <div class="reference-author">
          S. M. Douglas, I. Bachelet, G. M. Church
          </div>
             <div class="reference-journal">
             Science 335, 831 (2012)
             </div>
    </div>


  </article>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>

<footer style="position:relative;left:400px"> <small> Copyright &copy; Todai nanORFEVRE, all rights reserved. </small> </footer> </body> </html>