Biomod/2013/Sendai/protocol: Difference between revisions
No edit summary |
No edit summary |
||
(35 intermediate revisions by 3 users not shown) | |||
Line 53: | Line 53: | ||
<ul> | <ul> | ||
<li class="toclevel-1"><a href="#chain"> | <li class="toclevel-1"><a href="#chain"> | ||
<span class="tocnumber">1</span> <span class="toctext"> | <span class="tocnumber">1</span> <span class="toctext">First stage: Sensing system</span></a></li> | ||
<ul> | <ul> | ||
<li class="toclevel-2"><a href="#bending"> | <li class="toclevel-2"><a href="#bending"> | ||
Line 59: | Line 59: | ||
</ul> | </ul> | ||
<li class="toclevel-1"><a href="#Flower"> | <li class="toclevel-1"><a href="#Flower"> | ||
<span class="tocnumber">2</span> <span class="toctext"> | <span class="tocnumber">2</span> <span class="toctext">Second stage: Amplification system</span></a></li> | ||
<ul> | <ul> | ||
<li class="toclevel-2"><a href="#sensing"> | <li class="toclevel-2"><a href="#sensing"> | ||
Line 95: | Line 95: | ||
</td></tr></table> | </td></tr></table> | ||
<h3 id=chain> | <h3 id=chain>First stage: Sensing system </h3> | ||
<h4 id=bending>1-1 Disruption of temperature sensitive liposomes</h4> | <h4 id=bending>1-1 Disruption of temperature sensitive liposomes</h4> | ||
<h5> Structure of NIPAM</h5> | <h5> Structure of NIPAM</h5><br> | ||
<img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210"><br> | <img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210"><br> | ||
poly-N-isopropyl acrylamide | poly-N-isopropyl acrylamide<br> | ||
<h5> Making liposome</h5> | <h5> Making liposome</h5> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Egg York PC(10mM)</td> | <td> Egg York PC(10mM)</td> | ||
<td> | <td> 10µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Cholesterol(10mM)</td> | <td> Cholesterol(10mM)</td> | ||
<td> | <td> 1µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> CHCl<sub>3</sub></td> | <td> CHCl<sub>3</sub></td> | ||
<td> | <td> 90µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
Table1 Materials for | <div class="captiontable"> | ||
Table1 Materials for liposome preparation<br><br> | |||
</div> | |||
1. Egg york PC and cholesterol solution was mixed and put on a glass tube.<br> | |||
2. To create a dried lipid film, the lipid solution was put on a glass tube then The solution was dried by argon gas and then in vacuum for a night. <br> | |||
3. Adding the pure water onto the dried lipid film to obtaining the giant liposomes.<br> | |||
4. The liposome solution 10µL was gently mixed with 25μl NIPAM solution (2mg/ml in the pure water).<br> | |||
<h3 id=Flower>Second stage: Amplification system</h5> | |||
<h3 id=Flower> | |||
<h4 id=sensing>2-1 DNA Origami approach</h4> | <h4 id=sensing>2-1 DNA Origami approach</h4> | ||
<h5 id=5>2-1-1 Making DNA Origami</h5> | <h5 id=5>2-1-1 Making DNA Origami</h5> | ||
Line 131: | Line 132: | ||
<h6>DNA origami recipe</h6> | <h6>DNA origami recipe</h6> | ||
We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.<br> | We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.<br> | ||
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is | Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is “<font color="#00a0c0">each DNA origami staple</font>-TTTTTTTTTTTTTTT<font color="red">CTGTCGCATCGAGAG</font>”.<br> | ||
Between the staple and unique ( | Between the staple and unique (<font color="red">CTGTCGCATCGAGAG</font>) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.<br> | ||
The 30nt single-stranded parts are stable till | The 30nt single-stranded parts are stable till 37°C, according to <A Href="http://www.nupack.org/">NUPACK</A>).<br> | ||
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.<br> | The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.<br> | ||
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.<br> | Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.<br> | ||
Line 166: | Line 167: | ||
</tr> | </tr> | ||
</table> | </table> | ||
Table2 The sequence of the strands<br> | <div class="captiontable">Table2 The sequence of the strands</div><br> | ||
<br> | <br> | ||
<h6>Annealing of DNA origami</h6> | <h6>Annealing of DNA origami</h6> | ||
The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to | The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25°C: lower 1°C per 2 minutes).<br> | ||
<br> | <br> | ||
<ur><li>Annealing solution with fluorescent-tagged DNA | <ur><li>Annealing solution with fluorescent-tagged DNA 50µL<br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>84nM M13mp18</td> | <td>84nM M13mp18</td> | ||
<td>2. | <td>2.4µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
Line 183: | Line 184: | ||
<tr> | <tr> | ||
<td>1µM migihaji</td> | <td>1µM migihaji</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>1µM hidarihaji</td> | <td>1µM hidarihaji</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>1µM ashibatemae</td> | <td>1µM ashibatemae</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>200nM ashiba</td> | <td>200nM ashiba</td> | ||
<td> | <td>5µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>1µM cholesterol-hybridizing ssDNA</td> | <td>1µM cholesterol-hybridizing ssDNA</td> | ||
<td> | <td>3µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>1µM fluorescent-tagged DNA-hybridizing ssDNA</td> | <td>1µM fluorescent-tagged DNA-hybridizing ssDNA</td> | ||
<td> | <td>3µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>5xTAE | <td>5xTAE Mg<sup>2+</sup></td> | ||
<td> | <td>10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>mQ</td> | <td>mQ</td> | ||
<td>20. | <td>20.6µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
Line 219: | Line 220: | ||
</table> | </table> | ||
</li> | </li> | ||
Table3 Annealing solution with fluorescent-tagged DNA<br> | <div class="captiontable">Table3 Annealing solution with fluorescent-tagged DNA</div><br> | ||
<br> | <br> | ||
<li>Annealing solution with no fluorescent-tagged DNA (control) | <li>Annealing solution with no fluorescent-tagged DNA (control) 50µL<br> | ||
We changed | We changed 3µL fluorescent-tagged DNA in the above solution into the same quantity of mQ.</li><br> | ||
<br> | <br> | ||
<h5 id=6>2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</h5> | <h5 id=6>2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</h5> | ||
Line 228: | Line 229: | ||
We confirmed that our DNA origami was fluorescently labeled by electrophoresis.<br> | We confirmed that our DNA origami was fluorescently labeled by electrophoresis.<br> | ||
<br> | <br> | ||
50µL of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µL of 1µM fluorescent-tagged DNA. <br> | |||
To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0. | To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µL of 1µM fluorescent-tagged DNA into 10 µL control annealing solution, and left it for 40 minutes.<br> | ||
<br> | <br> | ||
Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ<br> | Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ<br> | ||
Line 236: | Line 237: | ||
<br> | <br> | ||
<h5 id=7>2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)</h5> | <h5 id=7>2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)</h5> | ||
<h5> Making liposome</h5> | |||
1. Drying the liposomes below with argon gas and letting them stand for a night<br> | |||
2. Adding 1xTAE Mg<sup>2+</sup> 100µL to 1 and heating it in warm water (about 90 deg C) for a few hours<br><br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td> DOPC (10mM)</td> | |||
<td> 1µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> CHCl<sub>3</sub></td> | |||
<td> 99µL</td> | |||
</tr> | |||
</table> | |||
<div class="captiontable">Table4 Materials for Making liposomes</div><br><br> | |||
<h5>Concentration of Origami-anchor DNA</h5> | <h5>Concentration of Origami-anchor DNA</h5> | ||
To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.<br> | To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.<br> | ||
<ur><li>Liposome with 0.018µM Origami-anchor DNA: | <ur><li>Liposome with 0.018µM Origami-anchor DNA: 1µL 0.1µM Origami-anchor DNA and 2.5µL liposome</li> | ||
<li>Liposome with 0.069µM Origami-anchor DNA: | <li>Liposome with 0.069µM Origami-anchor DNA: 10µL 0.1µM DNAs and 2.5µL liposome</li> | ||
<li>Liposome with 1.8µM Origami-anchor DNA: | <li>Liposome with 1.8µM Origami-anchor DNA: 1µL 10µM DNAs and 2.5µL liposome</li> | ||
<li>Liposome with 6.9µM Origami-anchor DNA: | <li>Liposome with 6.9µM Origami-anchor DNA: 10µL 10µM DNAs and 2.5µL liposome</li> | ||
<br> | <br> | ||
<h5>Observation by phase and fluorescent microscope </h5> | <h5>Observation by phase and fluorescent microscope </h5> | ||
We observed each sample with a phase microscope.<br> | We observed each sample with a phase microscope.<br> | ||
<br> | <br> | ||
Then we added | Then we added 2µL DNA origami into each sample and saw if some change would happen with a fluorescent microscope.<br> | ||
The DNA origami for fluorescent microscope observation was made according to | The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation. <br> | ||
<br> | <br> | ||
Line 253: | Line 269: | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>84nM M13mp18</td> | <td>84nM M13mp18</td> | ||
<td>2. | <td>2.4µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
Line 261: | Line 277: | ||
<tr> | <tr> | ||
<td>1µM migihaji</td> | <td>1µM migihaji</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>1µM hidarihaji</td> | <td>1µM hidarihaji</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>1µM ashibatemae</td> | <td>1µM ashibatemae</td> | ||
<td> | <td>1µL</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>200nM ashiba</td> | <td>200nM ashiba</td> | ||
<td> | <td>5µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>100µM cholesterol-hybridizing ssDNA</td> | <td>100µM cholesterol-hybridizing ssDNA</td> | ||
<td>4. | <td>4.2µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>100µM fluorescent-tagged DNA-hybridizing ssDNA</td> | <td>100µM fluorescent-tagged DNA-hybridizing ssDNA</td> | ||
<td>4. | <td>4.2µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>5xTAE | <td>5xTAE Mg<sup>2+</sup></td> | ||
<td> | <td>10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>mQ</td> | <td>mQ</td> | ||
<td>23. | <td>23.5µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable">Table5 50µL Annealing solution for fluorescent microscope observation</div><br> | |||
<br> | <br> | ||
After annealing, we added 4. | After annealing, we added 4.2µL 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).<br> | ||
<br> | <br> | ||
<h5 id=13>2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</h5> | <h5 id=13>2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</h5> | ||
<h5>Making liposome</h5> | <h5>Making liposome</h5> | ||
<div class="caption-right"> | |||
Liposomes were formed by the droplet-transfer method | <Img Src="http://openwetware.org/images/6/6d/Wo_method-%E5%AE%8C%E6%88%90%E7%89%88.png" style="padding-left:10mm"><span>Fig.4 the droplet-transfer method</span> | ||
</div> | |||
We make phase-separatied liposomes made of DOPC, DPPC, DOPE and cholesterol.<br> | |||
Phase-separated liposomes are liposomes consisting of several kinds of lipids. It has less fluidity and its membranee is more stiff than normal liposomes.<br> | |||
Due to the above reasons, we consider that phase-separated liposomes are more suitable to be disrupted. Thus, this time, we used phase-separated liposomes.<br> | |||
Liposomes were formed by the droplet-transfer method Pautot et al., PNAS, 100, 10718-21 (2003).<br> | |||
<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> DOPC(10mM)</td> | <td> DOPC(10mM)</td> | ||
<td> | <td> 20µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> DPPC(10mM)</td> | <td> DPPC(10mM)</td> | ||
<td> | <td> 20µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Cholesterol(10mM) </td> | <td> Cholesterol(10mM) </td> | ||
<td> | <td> 20µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> DOPE(10mM)</td> | <td> DOPE(10mM)</td> | ||
<td> | <td> 20µL </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td>chloroform</td> | <td>chloroform</td> | ||
<td> | <td> 260µL </td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable">Table6 Materials for Making liposomes</div><br><br> | |||
1 Drying the liposomes above with argon gas and letting them stand for a night<br> | 1 Drying the liposomes above with argon gas and letting them stand for a night<br> | ||
2 Adding mineral oil | 2 Adding mineral oil 260µL to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)<br> | ||
3 Preparing 1.5ml microtube and pouring outer buffer | 3 Preparing 1.5ml microtube and pouring outer buffer 50µL. Then picking up 50µL from 2 and adding it on the outer buffer (softly, to make a bilayer)<br> | ||
<br> | <br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> glucose(1M)</td> | <td> glucose(1M)</td> | ||
<td> | <td> 125µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> 25xTAE | <td> 25xTAE Mg<sup>2+</sup></td> | ||
<td> | <td> 10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> mQ </td> | <td> mQ </td> | ||
<td> | <td> 110µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable">Table7 Outer Buffer (250µL)</div><br><br> | |||
<br> | <br> | ||
4 Preparing 0.2 ml microtube and pouring inner buffer | 4 Preparing 0.2 ml microtube and pouring inner buffer 2µL. Then picking up 50µL from 2, adding it on the inner buffer, and mixing them by tapping<br> | ||
<br> | <br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> GFP(0.5 mM)</td> | <td> GFP(0.5 mM)</td> | ||
<td> | <td> 5µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> sucrose(1M)</td> | <td> sucrose(1M)</td> | ||
<td> | <td> 125µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> 25xTAE | <td> 25xTAE Mg<sup>2+</sup> </td> | ||
<td> | <td> 10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> mQ </td> | <td> mQ </td> | ||
<td> | <td> 110µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
5 Pouring all the solution ( | <div class="captiontable">Table8 Inner Buffer (250µL)</div><br><br> | ||
5 Pouring all the solution (52µL) of 4 into the 1.5ml tube (softly, to make a three-layer) | |||
6 Centrifuging it for 30 seconds and taking only the bottom layer<br> | 6 Centrifuging it for 30 seconds and taking only the bottom layer<br> | ||
<br> | <br> | ||
Line 374: | Line 398: | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Liposome (with GFP inside) (4mM)</td> | <td> Liposome (with GFP inside) (4mM)</td> | ||
<td> | <td> 10µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Origami-anchor DNA (10uM)</td> | <td> Origami-anchor DNA (10uM)</td> | ||
<td> | <td> 25µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> 1xTAE | <td> 1xTAE Mg<sup>2+</sup></td> | ||
<td> | <td> 75µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable">Table9 Sample1: negative control</div><br><br> | |||
Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).<br> | Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).<br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Liposome (with GFP inside) (4mM)</td> | <td> Liposome (with GFP inside) (4mM)</td> | ||
<td> | <td> 10µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Origami-anchor DNA (10uM)</td> | <td> Origami-anchor DNA (10uM)</td> | ||
<td> | <td> 25µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> 1xTAE | <td> 1xTAE Mg<sup>2+</sup></td> | ||
<td> | <td> 75µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Surfactant (NP40)</td> | <td> Surfactant (NP40)</td> | ||
<td> | <td> 2µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable">Table10 Sample2: positive control</div><br><br> | |||
Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.<br> | Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.<br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | <table border cellspacing="3" bgcolor="lightyellow"> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Liposome (with GFP inside) (4mM)</td> | <td> Liposome (with GFP inside) (4mM)</td> | ||
<td> | <td> 10µL | ||
</td> | </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Origami-anchor DNA (10uM)</td> | <td> Origami-anchor DNA (10uM)</td> | ||
<td> | <td> 25µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> 1xTAE | <td> 1xTAE Mg<sup>2+</sup> </td> | ||
<td> | <td> 55µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td> Key DNA (5nM)</td> | <td> Key DNA (5nM)</td> | ||
<td> | <td> 20µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
<div class="captiontable"> | |||
Table11 Sample3</div><br><br> | |||
1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.<br> | 1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.<br> | ||
2. Adding Key DNA to each sample, and leaving it for 10 minutes.<br> | 2. Adding Key DNA to each sample, and leaving it for 10 minutes.<br> | ||
3. Taking each sample | 3. Taking each sample 50µL and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.<br><br> | ||
<h5>Image of Cell Lab Quanta SC Flow Cytometer</h5><br> | |||
<div align="center"> | |||
<table> | |||
<tbody> | |||
<tr align="center"> | |||
<td> | |||
<img src="http://openwetware.org/images/b/ba/Photo_%282%29.jpg" width="300px" height="250px" align="left"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/3/30/Photo_%284%29.jpg" width="300px" height="250px" align="right"> | |||
</td> | |||
</tr> | |||
</tbody> | |||
</table> | |||
</div> | |||
<div class="caption">Fig.1 Cell Lab Quanta SC Flow Cytometer</div><br> | |||
<h5 id=8>2-1-5 Confirming sequence specificity of DNA</h5> | |||
<h5>Making liposome</h5> | |||
We made liposomes in the same way as 2-1-4.<br> | |||
<h5>The list of strands</h5> | |||
To confirm sequence specificity of DNA, we prepared two different pairs of Origami-anchor DNA and adaptor strand. <br> | |||
We call Key DNA with adoptor strand(A) as Key DNA(A) and Key DNA with adoptor strand(B) as Key DNA(B) .<br> | |||
<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="lightyellow"> | |||
<td> The kinds of DNAtrands </td> | |||
<td> Its sequence </td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Origami-anchor DNA(A)</td> | |||
<td> CCAGAAGACG | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Adaptor strand for Origami-anchor DNA(A) </td> | |||
<td> CGTCTTCTGGCTCTCGATGCGACAG </td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Origami-anchor DNA(B)</td> | |||
<td> TCCACTAACG | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Adaptor strand for Origami-anchor DNA(B) </td> | |||
<td> CGTTAGTGGACTCTCGATGCGACAG </td> | |||
</tr> | |||
</table> | |||
<div class="captiontable"> | |||
Table12 The sequence of the strands</div><br> | |||
<br> | |||
<h5>Confirming sequence specificity of DNA</h5> | |||
Sample1 has complementary Origami-anchor DNA(A) and Key DNA(A).<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td> Liposome (with GFP inside) (4mM)</td> | |||
<td> 10µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Origami-anchor DNA(A) (10uM)</td> | |||
<td> 25µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 1xTAE Mg<sup>2+</sup></td> | |||
<td> 55µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Key DNA(A) (5nM)</td> | |||
<td> 20µL</td> | |||
</tr> | |||
</table><div class="captiontable"> | |||
Table13 Sample1</div><br><br> | |||
Sample2 has Origami-anchor DNA(A) and Key DNA(B).<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td> Liposome (with GFP inside) (4mM)</td> | |||
<td> 10µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Origami-anchor DNA(B) (10uM)</td> | |||
<td> 25µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 1xTAE Mg<sup>2+</sup></td> | |||
<td> 55µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> Key DNA(B) (5nM)</td> | |||
<td> 20µL</td> | |||
</tr> | |||
</table> | |||
<div class="captiontable"> | |||
Table14 Sample2</div><br><br> | |||
The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.<br> | |||
<br> | <br> | ||
< | <br> | ||
<br> | |||
<!--------2-1-5にはいってたやつ。とりあえず隠す。ここから---------------> | |||
<!-- | |||
<h5>Making liposome</h5> | <h5>Making liposome</h5> | ||
We made liposomes in a spontaneous-transfer way. They were divided into two types: liposomes A of GFP, Green Fluorescent Protein, and liposomes B of Red Fluorescent Protein. These two kinds of liposomes have the same Outer Buffer but different Inner Buffer. Composition of these two buffers is as follows.<br><br> | We made liposomes in a spontaneous-transfer way. They were divided into two types: liposomes A of GFP, Green Fluorescent Protein, and liposomes B of Red Fluorescent Protein. These two kinds of liposomes have the same Outer Buffer but different Inner Buffer. Composition of these two buffers is as follows.<br><br> | ||
Line 441: | Line 575: | ||
<td>Outer Buffer </td> | <td>Outer Buffer </td> | ||
<td>STE(as substitute for GFP)</td> | <td>STE(as substitute for GFP)</td> | ||
<td> | <td>10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td></td> | <td></td> | ||
<td>glucose(1M)</td> | <td>glucose(1M)</td> | ||
<td> | <td>250µL </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td></td> | <td></td> | ||
<td>25×TAE</td> | <td>25×TAE</td> | ||
<td> | <td>20µL </td> | ||
</tr> | </tr> | ||
<tr bgcolor="moccasin"> | <tr bgcolor="moccasin"> | ||
<td></td> | <td></td> | ||
<td>25×TAE</td> | <td>25×TAE</td> | ||
<td> | <td>20µL </td> | ||
</tr> | </tr> | ||
Line 462: | Line 596: | ||
<td>LiposomeA Inner Buffer</td> | <td>LiposomeA Inner Buffer</td> | ||
<td>GFP</td> | <td>GFP</td> | ||
<td> | <td>5µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="SpringGreen"> | <tr bgcolor="SpringGreen"> | ||
<td> </td> | <td> </td> | ||
<td>sucrose(1M)</td> | <td>sucrose(1M)</td> | ||
<td> | <td>125µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="SpringGreen"> | <tr bgcolor="SpringGreen"> | ||
<td> </td> | <td> </td> | ||
<td>25×TAE Mg<sup>2+</sup></td> | <td>25×TAE Mg<sup>2+</sup></td> | ||
<td> | <td>10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="SpringGreen"> | <tr bgcolor="SpringGreen"> | ||
<td> </td> | <td> </td> | ||
<td>mQ</td> | <td>mQ</td> | ||
<td> | <td>110µL</td> | ||
</tr> | </tr> | ||
Line 483: | Line 617: | ||
<td>LiposomeB Inner Buffer</td> | <td>LiposomeB Inner Buffer</td> | ||
<td>Rhodamine</td> | <td>Rhodamine</td> | ||
<td>0. | <td>0.5µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor="#FF6699"> | <tr bgcolor="#FF6699"> | ||
<td> </td> | <td> </td> | ||
<td>sucrose(1M)</td> | <td>sucrose(1M)</td> | ||
<td>12. | <td>12.5µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor=" #FF6699"> | <tr bgcolor=" #FF6699"> | ||
<td> </td> | <td> </td> | ||
<td>25×TAE Mg<sup>2+</sup></td> | <td>25×TAE Mg<sup>2+</sup></td> | ||
<td> | <td>10µL</td> | ||
</tr> | </tr> | ||
<tr bgcolor=" #FF6699"> | <tr bgcolor=" #FF6699"> | ||
<td> </td> | <td> </td> | ||
<td>mQ</td> | <td>mQ</td> | ||
<td> | <td>110µL</td> | ||
</tr> | </tr> | ||
</table> | </table> | ||
Line 507: | Line 641: | ||
4. Centrifuging 3 for 5 minutes<br> | 4. Centrifuging 3 for 5 minutes<br> | ||
5. Observing leak of liposomes from the bottom of tubes by needles<br> | 5. Observing leak of liposomes from the bottom of tubes by needles<br> | ||
--> | |||
<!-------------ここまで---------------------> | |||
<h4 id=9>2-2 Flower DNA approach</h4> | <h4 id=9>2-2 Flower DNA approach</h4> | ||
<h5 id=11>2-2-1 Disruption of liposomes by Flower DNA</h5> | <h5 id=11>2-2-1 Disruption of liposomes by Flower DNA</h5> | ||
2-2 | The protocol to prepare liposomes was the same as that in 2-1-4.<br> | ||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td>STE</td> | |||
<td> 10µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> glucose (1M)</td> | |||
<td> 250µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>HEPES (1M)</td> | |||
<td> 5µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> MgCl<sub>2</sub> (1M)</td> | |||
<td> 6.3µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>mQ</td> | |||
<td> 228.8µL</td> | |||
</tr> | |||
</table> | |||
<div class="captiontable">Table15 500µL outer buffer</div><br><br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td>GFP</td> | |||
<td> 10µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> glucose (1M)</td> | |||
<td> 250µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>HEPES (1M)</td> | |||
<td> 5µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> MgCl<sub>2</sub> (1M)</td> | |||
<td> 6.3µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>mQ</td> | |||
<td> 228.8µL</td> | |||
</tr> | |||
</table><div class="captiontable">Table16 Inner buffer (green) </div><br><br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td> Texas-Red dextran</td> | |||
<td> 20µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> glucose (1M)</td> | |||
<td> 250µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>HEPES (1M)</td> | |||
<td> 5µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> MgCl<sub>2</sub> (1M)</td> | |||
<td> 6.3µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>mQ</td> | |||
<td> 218.8µL</td> | |||
</tr> | |||
</table> | |||
<div class="captiontable">Table17 Inner buffer (red) </div><br><br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="moccasin"> | |||
<td>DOPC (10mM)</td> | |||
<td> 20µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> DPPC (10mM)</td> | |||
<td> 20µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>cholesterol (10mM)</td> | |||
<td> 20µL</td> | |||
</tr> | |||
</table> | |||
<div class="captiontable">Table18 Phase-separated liposome</div><br><br> | |||
1. Put inner buffer (2 μL) in mineral oil (50 μL), and tapping to form emulsion<br> | |||
2. Putting mineral oil (50 μL) on outer buffer (50 μL)<br> | |||
3. Putting 1(emulsion) on 2 (mineral oil on outer buffer) <br> | |||
4. Centrifuging 3 (sample) for 5minutes to form liposomes<br> | |||
5. Collecting liposomes from the bottom of tubes by needles<br><br> | |||
<h5 id="12">2-2-2 Confirming sequence specificity of DNA</h5> | |||
The components of inner buffer for the Green liposomes and outer buffer were the same as that in 2-2-1. The inner buffer for the Red liposomes, below is the recipe.<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
2 | <tr bgcolor="moccasin"> | ||
<td> Texas-Red dextran</td> | |||
<td> 100µL | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> glucose (1M)</td> | |||
<td> 250µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>HEPES (1M)</td> | |||
<td> 5µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> MgCl<sub>2</sub> (1M)</td> | |||
<td> 6.3µL</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td>mQ</td> | |||
<td> 138.8µL</td> | |||
</tr> | |||
</table><div class="captiontable"> | |||
Table19 Inner buffer (red)</div><br><br> | |||
We named liposomes with GFP inside “Green liposome”, and liposomes with Texas-Red dextran “Red liposome”. | |||
Each liposome has the corresponding Flower-anchor DNA of different sequences. <br> | |||
1. Liposome formation metohds is the same as 2-2-1<br> | |||
2. Adding 50 µM A-flower-anchor DNA (5 μL) into Green liposome (3 µL) or Red liposome (3 µL)<br> | |||
<br> | |||
<table border cellspacing="3" bgcolor="lightyellow"> | |||
<tr bgcolor="lightyellow"> | |||
<td> The kinds <br>of DNAtrands </td> | |||
<td> Its sequence </td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 10nt Flower-anchor DNA(A)</td> | |||
<td> CCAGAAGACG | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 50nt Flower-anchor DNA(A)</td> | |||
<td> CGTCTTCTGGGCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 10nt Flower-anchor DNA(B)</td> | |||
<td> TCCACTAACG | |||
</td> | |||
</tr> | |||
<tr bgcolor="moccasin"> | |||
<td> 50nt Flower-anchor DNA(B)</td> | |||
<td> CGTTAGTGGAGTATCCGTCAACCGCACCTATGGCAGCAAGTGAGCCTGTA</td> | |||
</tr> | |||
</table> | |||
< | <div class="captiontable">Table20 The sequence of Flower-anchor DNA</div><br> | ||
<br> | |||
In the case of control experiment, buffer solution (10mM HEPES Mg+2, 4µL) for the key DNA was added instead of Key DNA.<br> | |||
<br> | |||
<h6>Images</h6> | |||
Without Key DNA (Only buffer)<br> | |||
<font size=-1>A(Green):B(Red)=16:17 (n=23)</font> | |||
<table> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/c/cb/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%91.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/9/96/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%92.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/e/ee/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%93.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/f/ff/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%94.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/c/c0/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%97.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/0/06/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%98.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/4/4f/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%99.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
</td> | |||
</tr> | |||
</table> | |||
<br> | |||
With Key DNA<br> | |||
<font size=-1>A(Green):B(Red)=17:2 (n=19)</font> | |||
<table> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/d/dd/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%891.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/9/92/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%892.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%893.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/3/3b/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%894.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/a/aa/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%895.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/f/f1/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%896.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/d/d4/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%897.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%898.jpg" width="400" height="300"> | |||
</td> | |||
</tr> | |||
<tr> | |||
<td> | |||
<img src="http://openwetware.org/images/3/3f/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%899.jpg" width="400" height="300"> | |||
</td> | |||
<td> | |||
</td> | |||
</tr> | |||
</table> | |||
</article> | </article> | ||
Latest revision as of 23:55, 26 October 2013
<html> <head> <style>
/********************** Hide MediaWiki and init CSS, overwrite by bootstrap.css バルス**********************/
body{
background:none;
} html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video{
margin:0; padding:0; /* font-size:100%; */ border:0; outline:0;
} a, a:link, a:visited, a:hover, a:active{
text-decoration:none
}
/*訪れたリンクを白くするよ*/ .whiteSendai:visited{
color:#FFFFFF!important;
}
/*左詰め、真ん中、右詰め*/ .leftSendai { text-align: left; } .centerSendai { text-align: center; } .rightSendai { text-align: right; }
.firstHeading {
display:none;
}
- content{
border-style:none; margin:0; padding:0;
}
- globalWrapper{
font-size:100%;
}
- contentSub{
display:none;
}
- column-one{
display:none;
}
- footer{
display:none;
}
- globalWrapper{
font-size:100%;
}
- bodyContent h1, #bodyContent h2{
margin-top: 20px; margin-bottom: 10px;
}
- bodyContent h3{
margin-top: 20px; margin-bottom: 10px; border-bottom-width: medium; border-bottom-style: solid; border-bottom-color: gray;
}
- bodyContent h4{
margin-top: 20px; margin-bottom: 10px; border-bottom-width: thin; border-bottom-style: solid; border-bottom-color: gray;
}
- bodyContent h5, #bodyContent h6{
margin-top: 10px; margin-bottom: 10px;
/**** border-bottom-width: thin;
border-bottom-style: solid; border-bottom-color: gray;
- /
}
/********************************* Hide MediaWiki end *********************************/
/* Structure */ html{ background: #eee; } body {
padding: 0px; background: #fff; color: #333; margin: 0 auto; max-width: 900px; font: 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif; }
a {
color: #105672;
}
header {/****position: fixed; ****/
/******width: 100%;****/ height: 90px; z-index: 1;
background: #F17F25;
padding:0.01em 0.5em 1.5em ;
color: #fff; line-height: 1;
}
header h1{ margin-bottom: 0; }
header h1 span{ display: inline; color: rgba(255,255,255,.4); }
header span{ display: block; color: rgba(255,255,255,.2); font-weight: 300; margin-bottom: 1.6em }
header nav{ float: right; text-align: right } header nav div{ font-size: .8em; } header nav div a { font-weight: 300; padding: .3em .5em } header nav a{ color: #fff; display: inline-block; padding: .3em .8em }
header nav a:hover, header nav a:focus{ color: rgba(255,255,255,.6) }
[role=main]{
padding:1.5em 3em;
}
article{
padding: 1em 0;
text-align: justify;
text-justify: inter-ideograph;
}
footer{
background: #333;
color: #fff;
padding: 1em 3em;
clear: both; /***2段組みの左右のfloatを解除***/
}
/* Typography */
p{ font: 1em/1.5 Palatino, "Palatino Linotype", Georgia, Times, "Times New Roman", serif; }
p.sukima{
font-size: 150%; font-weight: normal; font-family: Helvetica; background: #bbb; padding-left: 1.2em;
}
img{ max-width: 100%; /***** height: auto; *****/ }
blockquote{
float: left;
margin: 1em 3em;
}
blockquote p{
font-size: 1.4em;
line-height: 1.2;
font-weight: 700;
font-style:italic;
}
a{
font: 700 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif;
text-decoration: none
}
a:hover, a:focus{
color: #000;
}
a:active{
position: relative;
top:1px;
}
ol{margin: 1em 0 1em 0; padding-left: 2em; } li{ margin: 0; }
/* Tabs */
- tabs
{ /*****position:fixed;****/
width: 900px;
}
.js-on #tabs article { display:none }
- tabs, #tabs nav a.active{
background: #FFF; color: #111; }
- tabs nav
{ position: relative; overflow: hidden; display: table; background: #bbb; }
- tabs nav a
{ width:900px; display:table-cell; padding:1em; text-align:center; color: #333; }
- tabs nav a:hover,#tabs nav a:focus
{ background:#eee }
- tabs article
{ padding:2em; }
.js-on #tabs article.active
{
display:block;
}
- tabs #mobiles{
display:none; border-radius: 0; }
- tabs #mobiles a, #tabs #mobiles a:first-child, #tabs #mobiles a:last-child{
width:300px; border-radius: 0; }
/* Media queries */ @media screen and (min-width:900px) { body{font-size: 1.1em;} }
@media screen and (max-width:600px) { #tabs nav{ display: none; position: relative; } #tabs #mobiles{ display:block; } #tabs article { display:block; } } @media screen and (max-width:480px) { blockquote{ float: none; }
header nav a{ padding:.7em .8em } header nav{ float: none; margin: -.5em -3em 0; background: #000; overflow: hidden; text-align: left } header nav a{ border-right: 1px solid #222 } [role=main]{ padding:1.5em 2em; } header nav div{ display: none; }
}
/*column content*/
- content-right {
width:48%; /***段落の横幅***/ float:right; /***右に寄せる(他の要素を左に回り込ませる)***/ margin: 10px; }
- content-left {
width:47%; /***サイドの横幅***/ float:left; /***左に寄せる***/ margin: 10px; }
/*****キャプションレフト*****/
div.caption-left{ float: left; padding: 0 5px 5px 5px; }
.caption-left span{ display: block; text-align: center;
font-size: smaller; font-weight: bold;
}
div.clear{ clear: both; margin: 0 0 10px 0; }
/*****キャプションライト*****/
div.caption-right{ float: right; padding: 0 5px 5px 5px; }
.caption-right span{ display: block; text-align: center;
font-size: smaller; font-weight: bold;
}
div.clear{ clear: both; margin: 0 0 10px 0; }
/***floatの影響を絶つ。<div class="c-both"></div> のように使う***/
.c-both { clear: both; }
div.title{
font-style: normal; font-weight: bold; font-size: 70px; line-height: 70px; font-family: Helvetica;
}
div.caption{
text-align: center; font-size: smaller; font-weight: bold;
}
div.captiontable{
font-size: smaller; font-weight: bold;
}
/*topに戻る*/
- ttop {position:fixed;
bottom:140px; left:auto;margin:0 0 0 905px; /* マージン:上 右 下 左 */ width:100px; height:390px; background:url(http://openwetware.org/images/f/f2/%E5%90%8D%E7%A7%B0%E6%9C%AA%E8%A8%AD%E5%AE%9A-1.png) no-repeat left bottom;}
/* IE6以下用、アスタリスクハックでググれ */
- html #ttop {margin:0 0 -390px 0;
position:relative;bottom:490px; /* 上で設定した ttopの高さ390px+下100px */ left:960px;}
- ttop:hover {background:url(http://openwetware.org/images/b/b9/Top2.png) no-repeat left bottom;/* 画像の高さによって適当に調整 */
}
a.page_top {display:block;width:100px;height:390px;}
</style>
</head>
</html>
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<title>Biomod2013 Sendai ver2.0</title> <meta name="viewport" content="width=device-width,initial-scale=1"> <style type="text/css"> h1{color: white;} </style>
</head>
<body> <!-- <div style="max-width:900px; position:fixed;">****/ -->
<header>
<nav> <div>
<!--
<a href="#" class="whiteSendai">Blog</a> <a href="#" class="whiteSendai">Twitter</a> <a href="#" class="whiteSendai">Facebook</a>
--> <br><br>
</div> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai" class="whiteSendai">Top</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/project" class="whiteSendai">Project</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/design" class="whiteSendai">Design</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/calcuation" class="whiteSendai">Calculation</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/experiment" class="whiteSendai">Experiment</a>
<a href="http://openwetware.org/wiki/Biomod/2013" class="whiteSendai" style="float:right;"><img src="http://openwetware.org/images/6/6e/Biomod-logo.jpg"
width="75" height="75" alt="Biomod2013" border="0"></a><br> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/protocol" class="whiteSendai">Protocol</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/future" class="whiteSendai">Future</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/member" class="whiteSendai">Member</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/sponsor" class="whiteSendai">Sponsor</a> </nav> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai"><h1 style="color:white;" ><b>Biomod<span>2013<br>  Team</span>Sendai</b></h1></a>
</header>
<div id="ttop"> <a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a></div>
<section role="main">
<article>
<h2>Protocol</h2>
<table id="toc" class="toc" summary="Contents"><tr><td><div id="toctitle"><h2>Contents</h2></div> <ul> <li class="toclevel-1"><a href="#chain"> <span class="tocnumber">1</span> <span class="toctext">First stage: Sensing system</span></a></li> <ul> <li class="toclevel-2"><a href="#bending"> <span class="tocnumber">1-1</span> <span class="toctext">Disruption of temperature sensitive liposomes</span></a></li> </ul> <li class="toclevel-1"><a href="#Flower"> <span class="tocnumber">2</span> <span class="toctext">Second stage: Amplification system</span></a></li> <ul> <li class="toclevel-2"><a href="#sensing"> <span class="tocnumber">2-1</span> <span class="toctext">DNA Origami approach</span></a></li> <ul> <li class="toclevel-2"><a href="#5"> <span class="tocnumber">2-1-1</span> <span class="toctext">Making DNA Origami</span></a></li> <li class="toclevel-2"><a href="#6"> <span class="tocnumber">2-1-2</span> <span class="toctext">Labeling DNA Origami with fluorescent-tagged DNA</span></a></li>
<li class="toclevel-2"><a href="#7"> <span class="tocnumber">2-1-3</span> <span class="toctext">Disruption of liposomes by DNA Origami (microscopic analysis)</span></a></li> <li class="toclevel-2"><a href="#13"> <span class="tocnumber">2-1-4</span> <span class="toctext">Disruption of liposomes by DNA Origami (quantitative analysis)</span></a></li>
<li class="toclevel-2"><a href="#8"> <span class="tocnumber">2-1-5</span> <span class="toctext">Confirming sequence specificity of DNA</span></a></li> </ul> <li class="toclevel-1"><a href="#9"> <span class="tocnumber">2-2</span> <span class="toctext">Flower DNA approach</span></a></li> <ul>
<li class="toclevel-2"><a href="#11"> <span class="tocnumber">2-2-1</span> <span class="toctext">Disruption of liposomes by Flower DNA</span></a></li> <li class="toclevel-2"><a href="#12"> <span class="tocnumber">2-2-2</span> <span class="toctext">Confirming sequence specificity of DNA</span></a></li>
</li>
</ul>
</li>
</ul>
</td></tr></table>
<h3 id=chain>First stage: Sensing system </h3> <h4 id=bending>1-1 Disruption of temperature sensitive liposomes</h4> <h5> Structure of NIPAM</h5><br> <img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210"><br> poly-N-isopropyl acrylamide<br> <h5> Making liposome</h5> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Egg York PC(10mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Cholesterol(10mM)</td> <td> 1µL</td> </tr> <tr bgcolor="moccasin"> <td> CHCl<sub>3</sub></td> <td> 90µL</td> </tr> </table> <div class="captiontable"> Table1 Materials for liposome preparation<br><br> </div>
1. Egg york PC and cholesterol solution was mixed and put on a glass tube.<br> 2. To create a dried lipid film, the lipid solution was put on a glass tube then The solution was dried by argon gas and then in vacuum for a night. <br> 3. Adding the pure water onto the dried lipid film to obtaining the giant liposomes.<br> 4. The liposome solution 10µL was gently mixed with 25μl NIPAM solution (2mg/ml in the pure water).<br>
<h3 id=Flower>Second stage: Amplification system</h5>
<h4 id=sensing>2-1 DNA Origami approach</h4>
<h5 id=5>2-1-1 Making DNA Origami</h5>
<h5>Making DNA origami</h5>
<h6>DNA origami recipe</h6>
We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.<br>
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is “<font color="#00a0c0">each DNA origami staple</font>-TTTTTTTTTTTTTTT<font color="red">CTGTCGCATCGAGAG</font>”.<br>
Between the staple and unique (<font color="red">CTGTCGCATCGAGAG</font>) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.<br>
The 30nt single-stranded parts are stable till 37°C, according to <A Href="http://www.nupack.org/">NUPACK</A>).<br>
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.<br>
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.<br>
This design enables each DNA origami to exist individually.<br>
<br>
<h6>The list of strands</h6>
The other strands exept DNA origami staples used in our experiment are shown in Table2.<br>
The sequence of Origami-anchor DNA is shown below (at the first sequence in Table2). For labeling, we also attached fluorescent-tagged DNA (at the second in Table2) to our DNA origami.<br>
To hybridize both Origami-anchor DNA and fluorescent-tagged DNA with the same unique single-stranded parts of our Origami, we arranged two kinds of adaptor DNA (at the third and fourth in Table2). One adaptor has complementary sequences to both the unique sequence and Origami-anchor DNA. The other has complementary sequences to both the unique sequence and the fluorescent-tagged DNA. Thanks to these two adaptors, two different strands can bind to the same unique sequence. <br>
<br>
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="lightyellow">
<td> The kinds of DNAtrands </td>
<td> Its sequence </td>
</tr>
<tr bgcolor="moccasin">
<td> Origami-anchor DNA</td>
<td> CCAGAAGACG
</td>
</tr>
<tr bgcolor="moccasin">
<td> Fluorescent-tagged DNA </td>
<td> ACTAGTGAGTGCAGCAGTCGTACCA </td>
</tr>
<tr bgcolor="moccasin">
<td> Adaptor strand for Origami-anchor DNA and the unique sequence in DNA origami </td>
<td> CGTCTTCTGGCTCTCGATGCGACAG </td>
</tr>
<tr bgcolor="moccasin">
<td> Adaptor strand for fluorescent-tagged DNA and the unique sequence in DNA origami </td>
<td> TGGTACGACTGCTGCACTCACTAGTCTCTCGATGCGACAG </td>
</tr>
</table>
<div class="captiontable">Table2 The sequence of the strands</div><br>
<br>
<h6>Annealing of DNA origami</h6>
The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25°C: lower 1°C per 2 minutes).<br>
<br>
<ur><li>Annealing solution with fluorescent-tagged DNA 50µL<br>
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<td>84nM M13mp18</td>
<td>2.4µL</td>
</tr>
<tr bgcolor="moccasin">
<td>Staples</td>
<td></td>
</tr>
<tr>
<td>1µM migihaji</td>
<td>1µL</td>
</tr>
<tr>
<td>1µM hidarihaji</td>
<td>1µL</td>
</tr>
<tr>
<td>1µM ashibatemae</td>
<td>1µL</td>
</tr>
<tr>
<td>200nM ashiba</td>
<td>5µL</td>
</tr>
<tr bgcolor="moccasin">
<td>1µM cholesterol-hybridizing ssDNA</td>
<td>3µL</td>
</tr>
<tr bgcolor="moccasin">
<td>1µM fluorescent-tagged DNA-hybridizing ssDNA</td>
<td>3µL</td>
</tr>
<tr bgcolor="moccasin">
<td>5xTAE Mg<sup>2+</sup></td>
<td>10µL</td>
</tr>
<tr bgcolor="moccasin">
<td>mQ</td>
<td>20.6µL</td>
</tr>
<tr bgcolor="moccasin">
<td>1µM fluorescent-tagged DNA</td>
<td>3µM</td>
</tr>
</table>
</li>
<div class="captiontable">Table3 Annealing solution with fluorescent-tagged DNA</div><br>
<br>
<li>Annealing solution with no fluorescent-tagged DNA (control) 50µL<br>
We changed 3µL fluorescent-tagged DNA in the above solution into the same quantity of mQ.</li><br>
<br>
<h5 id=6>2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</h5>
<h5>Electrophoresis </h5>
We confirmed that our DNA origami was fluorescently labeled by electrophoresis.<br>
<br>
50µL of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µL of 1µM fluorescent-tagged DNA. <br>
To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µL of 1µM fluorescent-tagged DNA into 10 µL control annealing solution, and left it for 40 minutes.<br>
<br>
Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ<br>
<br>
The electrophoresis was conducted with 1% agarose gel, CV 100V, for 50 minutes.<br>
<br>
<h5 id=7>2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)</h5>
<h5> Making liposome</h5>
1. Drying the liposomes below with argon gas and letting them stand for a night<br>
2. Adding 1xTAE Mg<sup>2+</sup> 100µL to 1 and heating it in warm water (about 90 deg C) for a few hours<br><br>
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<td> DOPC (10mM)</td>
<td> 1µL
</td>
</tr>
<tr bgcolor="moccasin">
<td> CHCl<sub>3</sub></td>
<td> 99µL</td>
</tr>
</table>
<div class="captiontable">Table4 Materials for Making liposomes</div><br><br>
<h5>Concentration of Origami-anchor DNA</h5>
To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.<br>
<ur><li>Liposome with 0.018µM Origami-anchor DNA: 1µL 0.1µM Origami-anchor DNA and 2.5µL liposome</li>
<li>Liposome with 0.069µM Origami-anchor DNA: 10µL 0.1µM DNAs and 2.5µL liposome</li>
<li>Liposome with 1.8µM Origami-anchor DNA: 1µL 10µM DNAs and 2.5µL liposome</li>
<li>Liposome with 6.9µM Origami-anchor DNA: 10µL 10µM DNAs and 2.5µL liposome</li>
<br>
<h5>Observation by phase and fluorescent microscope </h5>
We observed each sample with a phase microscope.<br>
<br>
Then we added 2µL DNA origami into each sample and saw if some change would happen with a fluorescent microscope.<br>
The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation. <br>
<br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td>84nM M13mp18</td> <td>2.4µL</td> </tr> <tr bgcolor="moccasin"> <td>Staples</td> <td></td> </tr> <tr> <td>1µM migihaji</td> <td>1µL</td> </tr> <tr> <td>1µM hidarihaji</td> <td>1µL</td> </tr> <tr> <td>1µM ashibatemae</td> <td>1µL</td> </tr> <tr> <td>200nM ashiba</td> <td>5µL</td> </tr> <tr bgcolor="moccasin"> <td>100µM cholesterol-hybridizing ssDNA</td> <td>4.2µL</td> </tr> <tr bgcolor="moccasin"> <td>100µM fluorescent-tagged DNA-hybridizing ssDNA</td> <td>4.2µL</td> </tr> <tr bgcolor="moccasin"> <td>5xTAE Mg<sup>2+</sup></td> <td>10µL</td> </tr> <tr bgcolor="moccasin"> <td>mQ</td> <td>23.5µL</td> </tr> </table>
<div class="captiontable">Table5 50µL Annealing solution for fluorescent microscope observation</div><br> <br> After annealing, we added 4.2µL 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).<br> <br> <h5 id=13>2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</h5> <h5>Making liposome</h5> <div class="caption-right">
<Img Src="http://openwetware.org/images/6/6d/Wo_method-%E5%AE%8C%E6%88%90%E7%89%88.png" style="padding-left:10mm"><span>Fig.4 the droplet-transfer method</span>
</div> We make phase-separatied liposomes made of DOPC, DPPC, DOPE and cholesterol.<br> Phase-separated liposomes are liposomes consisting of several kinds of lipids. It has less fluidity and its membranee is more stiff than normal liposomes.<br> Due to the above reasons, we consider that phase-separated liposomes are more suitable to be disrupted. Thus, this time, we used phase-separated liposomes.<br> Liposomes were formed by the droplet-transfer method Pautot et al., PNAS, 100, 10718-21 (2003).<br> <br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> DOPC(10mM)</td> <td> 20µL </td> </tr> <tr bgcolor="moccasin"> <td> DPPC(10mM)</td> <td> 20µL</td> </tr> <tr bgcolor="moccasin"> <td> Cholesterol(10mM) </td> <td> 20µL</td> </tr> <tr bgcolor="moccasin"> <td> DOPE(10mM)</td> <td> 20µL </td> </tr> <tr bgcolor="moccasin"> <td>chloroform</td> <td> 260µL </td> </tr> </table> <div class="captiontable">Table6 Materials for Making liposomes</div><br><br> 1 Drying the liposomes above with argon gas and letting them stand for a night<br> 2 Adding mineral oil 260µL to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)<br> 3 Preparing 1.5ml microtube and pouring outer buffer 50µL. Then picking up 50µL from 2 and adding it on the outer buffer (softly, to make a bilayer)<br> <br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> glucose(1M)</td> <td> 125µL </td> </tr> <tr bgcolor="moccasin"> <td> 25xTAE Mg<sup>2+</sup></td> <td> 10µL</td> </tr> <tr bgcolor="moccasin"> <td> mQ </td> <td> 110µL</td> </tr> </table> <div class="captiontable">Table7 Outer Buffer (250µL)</div><br><br> <br> 4 Preparing 0.2 ml microtube and pouring inner buffer 2µL. Then picking up 50µL from 2, adding it on the inner buffer, and mixing them by tapping<br> <br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> GFP(0.5 mM)</td> <td> 5µL </td> </tr> <tr bgcolor="moccasin"> <td> sucrose(1M)</td> <td> 125µL</td> </tr> <tr bgcolor="moccasin"> <td> 25xTAE Mg<sup>2+</sup> </td> <td> 10µL</td> </tr> <tr bgcolor="moccasin"> <td> mQ </td> <td> 110µL</td> </tr> </table> <div class="captiontable">Table8 Inner Buffer (250µL)</div><br><br> 5 Pouring all the solution (52µL) of 4 into the 1.5ml tube (softly, to make a three-layer) 6 Centrifuging it for 30 seconds and taking only the bottom layer<br> <br> <h5>Disruption of liposomes by DNA Origami</h5> Sample1 is the negative control. It is the mixture of liposome and Origami-anchor DNA.<br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Liposome (with GFP inside) (4mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA (10uM)</td> <td> 25µL</td> </tr> <tr bgcolor="moccasin"> <td> 1xTAE Mg<sup>2+</sup></td> <td> 75µL</td> </tr> </table> <div class="captiontable">Table9 Sample1: negative control</div><br><br> Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).<br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Liposome (with GFP inside) (4mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA (10uM)</td> <td> 25µL</td> </tr> <tr bgcolor="moccasin"> <td> 1xTAE Mg<sup>2+</sup></td> <td> 75µL</td> </tr> <tr bgcolor="moccasin"> <td> Surfactant (NP40)</td> <td> 2µL</td> </tr> </table> <div class="captiontable">Table10 Sample2: positive control</div><br><br> Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.<br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Liposome (with GFP inside) (4mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA (10uM)</td> <td> 25µL</td> </tr> <tr bgcolor="moccasin"> <td> 1xTAE Mg<sup>2+</sup> </td> <td> 55µL</td> </tr> <tr bgcolor="moccasin"> <td> Key DNA (5nM)</td> <td> 20µL</td> </tr> </table> <div class="captiontable"> Table11 Sample3</div><br><br> 1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.<br> 2. Adding Key DNA to each sample, and leaving it for 10 minutes.<br> 3. Taking each sample 50µL and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.<br><br> <h5>Image of Cell Lab Quanta SC Flow Cytometer</h5><br> <div align="center"> <table> <tbody> <tr align="center"> <td> <img src="http://openwetware.org/images/b/ba/Photo_%282%29.jpg" width="300px" height="250px" align="left"> </td> <td> <img src="http://openwetware.org/images/3/30/Photo_%284%29.jpg" width="300px" height="250px" align="right"> </td> </tr> </tbody> </table> </div> <div class="caption">Fig.1 Cell Lab Quanta SC Flow Cytometer</div><br> <h5 id=8>2-1-5 Confirming sequence specificity of DNA</h5> <h5>Making liposome</h5> We made liposomes in the same way as 2-1-4.<br>
<h5>The list of strands</h5> To confirm sequence specificity of DNA, we prepared two different pairs of Origami-anchor DNA and adaptor strand. <br> We call Key DNA with adoptor strand(A) as Key DNA(A) and Key DNA with adoptor strand(B) as Key DNA(B) .<br> <br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="lightyellow"> <td> The kinds of DNAtrands </td> <td> Its sequence </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA(A)</td> <td> CCAGAAGACG </td> </tr> <tr bgcolor="moccasin"> <td> Adaptor strand for Origami-anchor DNA(A) </td> <td> CGTCTTCTGGCTCTCGATGCGACAG </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA(B)</td> <td> TCCACTAACG </td> </tr> <tr bgcolor="moccasin"> <td> Adaptor strand for Origami-anchor DNA(B) </td> <td> CGTTAGTGGACTCTCGATGCGACAG </td> </tr> </table> <div class="captiontable"> Table12 The sequence of the strands</div><br> <br> <h5>Confirming sequence specificity of DNA</h5> Sample1 has complementary Origami-anchor DNA(A) and Key DNA(A).<br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Liposome (with GFP inside) (4mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA(A) (10uM)</td> <td> 25µL</td> </tr> <tr bgcolor="moccasin"> <td> 1xTAE Mg<sup>2+</sup></td> <td> 55µL</td> </tr> <tr bgcolor="moccasin"> <td> Key DNA(A) (5nM)</td> <td> 20µL</td> </tr> </table><div class="captiontable"> Table13 Sample1</div><br><br>
Sample2 has Origami-anchor DNA(A) and Key DNA(B).<br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Liposome (with GFP inside) (4mM)</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> Origami-anchor DNA(B) (10uM)</td> <td> 25µL</td> </tr> <tr bgcolor="moccasin"> <td> 1xTAE Mg<sup>2+</sup></td> <td> 55µL</td> </tr> <tr bgcolor="moccasin"> <td> Key DNA(B) (5nM)</td> <td> 20µL</td> </tr> </table> <div class="captiontable"> Table14 Sample2</div><br><br>
The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.<br>
<br> <br> <br>
<!--------2-1-5にはいってたやつ。とりあえず隠す。ここから---------------> <!-- <h5>Making liposome</h5> We made liposomes in a spontaneous-transfer way. They were divided into two types: liposomes A of GFP, Green Fluorescent Protein, and liposomes B of Red Fluorescent Protein. These two kinds of liposomes have the same Outer Buffer but different Inner Buffer. Composition of these two buffers is as follows.<br><br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td>Outer Buffer </td> <td>STE(as substitute for GFP)</td> <td>10µL</td> </tr> <tr bgcolor="moccasin"> <td></td> <td>glucose(1M)</td> <td>250µL </td> </tr> <tr bgcolor="moccasin"> <td></td> <td>25×TAE</td> <td>20µL </td> </tr> <tr bgcolor="moccasin"> <td></td> <td>25×TAE</td> <td>20µL </td> </tr>
<tr bgcolor="SpringGreen"> <td>LiposomeA Inner Buffer</td> <td>GFP</td> <td>5µL</td> </tr> <tr bgcolor="SpringGreen"> <td> </td> <td>sucrose(1M)</td> <td>125µL</td> </tr> <tr bgcolor="SpringGreen"> <td> </td> <td>25×TAE Mg<sup>2+</sup></td> <td>10µL</td> </tr> <tr bgcolor="SpringGreen"> <td> </td> <td>mQ</td> <td>110µL</td> </tr>
<tr bgcolor="#FF6699 "> <td>LiposomeB Inner Buffer</td> <td>Rhodamine</td> <td>0.5µL</td> </tr> <tr bgcolor="#FF6699"> <td> </td> <td>sucrose(1M)</td> <td>12.5µL</td> </tr> <tr bgcolor=" #FF6699"> <td> </td> <td>25×TAE Mg<sup>2+</sup></td> <td>10µL</td> </tr> <tr bgcolor=" #FF6699"> <td> </td> <td>mQ</td> <td>110µL</td> </tr> </table>
1. Tapping of inner 2 and lipid paraffin 50<br> 2. Putting paraffin 50 on outer 50<br> 3. Putting 1 on 2<br> 4. Centrifuging 3 for 5 minutes<br> 5. Observing leak of liposomes from the bottom of tubes by needles<br> -->
<!-------------ここまで--------------------->
<h4 id=9>2-2 Flower DNA approach</h4> <h5 id=11>2-2-1 Disruption of liposomes by Flower DNA</h5> The protocol to prepare liposomes was the same as that in 2-1-4.<br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td>STE</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> glucose (1M)</td> <td> 250µL</td> </tr> <tr bgcolor="moccasin"> <td>HEPES (1M)</td> <td> 5µL</td> </tr> <tr bgcolor="moccasin"> <td> MgCl<sub>2</sub> (1M)</td> <td> 6.3µL</td> </tr> <tr bgcolor="moccasin"> <td>mQ</td> <td> 228.8µL</td> </tr> </table> <div class="captiontable">Table15 500µL outer buffer</div><br><br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td>GFP</td> <td> 10µL </td> </tr> <tr bgcolor="moccasin"> <td> glucose (1M)</td> <td> 250µL</td> </tr> <tr bgcolor="moccasin"> <td>HEPES (1M)</td> <td> 5µL</td> </tr> <tr bgcolor="moccasin"> <td> MgCl<sub>2</sub> (1M)</td> <td> 6.3µL</td> </tr> <tr bgcolor="moccasin"> <td>mQ</td> <td> 228.8µL</td> </tr> </table><div class="captiontable">Table16 Inner buffer (green) </div><br><br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Texas-Red dextran</td> <td> 20µL </td> </tr> <tr bgcolor="moccasin"> <td> glucose (1M)</td> <td> 250µL</td> </tr> <tr bgcolor="moccasin"> <td>HEPES (1M)</td> <td> 5µL</td> </tr> <tr bgcolor="moccasin"> <td> MgCl<sub>2</sub> (1M)</td> <td> 6.3µL</td> </tr> <tr bgcolor="moccasin"> <td>mQ</td> <td> 218.8µL</td> </tr> </table> <div class="captiontable">Table17 Inner buffer (red) </div><br><br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td>DOPC (10mM)</td> <td> 20µL </td> </tr> <tr bgcolor="moccasin"> <td> DPPC (10mM)</td> <td> 20µL</td> </tr> <tr bgcolor="moccasin"> <td>cholesterol (10mM)</td> <td> 20µL</td> </tr> </table> <div class="captiontable">Table18 Phase-separated liposome</div><br><br> 1. Put inner buffer (2 μL) in mineral oil (50 μL), and tapping to form emulsion<br> 2. Putting mineral oil (50 μL) on outer buffer (50 μL)<br> 3. Putting 1(emulsion) on 2 (mineral oil on outer buffer) <br> 4. Centrifuging 3 (sample) for 5minutes to form liposomes<br> 5. Collecting liposomes from the bottom of tubes by needles<br><br>
<h5 id="12">2-2-2 Confirming sequence specificity of DNA</h5>
The components of inner buffer for the Green liposomes and outer buffer were the same as that in 2-2-1. The inner buffer for the Red liposomes, below is the recipe.<br>
<table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="moccasin"> <td> Texas-Red dextran</td> <td> 100µL </td> </tr> <tr bgcolor="moccasin"> <td> glucose (1M)</td> <td> 250µL</td> </tr> <tr bgcolor="moccasin"> <td>HEPES (1M)</td> <td> 5µL</td> </tr> <tr bgcolor="moccasin"> <td> MgCl<sub>2</sub> (1M)</td> <td> 6.3µL</td> </tr> <tr bgcolor="moccasin"> <td>mQ</td> <td> 138.8µL</td> </tr> </table><div class="captiontable"> Table19 Inner buffer (red)</div><br><br> We named liposomes with GFP inside “Green liposome”, and liposomes with Texas-Red dextran “Red liposome”. Each liposome has the corresponding Flower-anchor DNA of different sequences. <br> 1. Liposome formation metohds is the same as 2-2-1<br> 2. Adding 50 µM A-flower-anchor DNA (5 μL) into Green liposome (3 µL) or Red liposome (3 µL)<br> <br> <table border cellspacing="3" bgcolor="lightyellow"> <tr bgcolor="lightyellow"> <td> The kinds <br>of DNAtrands </td> <td> Its sequence </td> </tr> <tr bgcolor="moccasin"> <td> 10nt Flower-anchor DNA(A)</td> <td> CCAGAAGACG </td> </tr> <tr bgcolor="moccasin"> <td> 50nt Flower-anchor DNA(A)</td> <td> CGTCTTCTGGGCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT</td> </tr> <tr bgcolor="moccasin"> <td> 10nt Flower-anchor DNA(B)</td> <td> TCCACTAACG </td> </tr> <tr bgcolor="moccasin"> <td> 50nt Flower-anchor DNA(B)</td> <td> CGTTAGTGGAGTATCCGTCAACCGCACCTATGGCAGCAAGTGAGCCTGTA</td> </tr> </table>
<div class="captiontable">Table20 The sequence of Flower-anchor DNA</div><br> <br> In the case of control experiment, buffer solution (10mM HEPES Mg+2, 4µL) for the key DNA was added instead of Key DNA.<br> <br> <h6>Images</h6> Without Key DNA (Only buffer)<br> <font size=-1>A(Green):B(Red)=16:17 (n=23)</font> <table> <tr>
<td>
<img src="http://openwetware.org/images/c/cb/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%91.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/9/96/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%92.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/e/ee/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%93.jpg" width="400" height="300">
</td>
<td> <img src="http://openwetware.org/images/f/ff/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%94.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/c/c0/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%97.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/0/06/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%98.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/4/4f/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%99.jpg" width="400" height="300">
</td> <td> </td>
</tr> </table>
<br>
With Key DNA<br> <font size=-1>A(Green):B(Red)=17:2 (n=19)</font> <table> <tr>
<td>
<img src="http://openwetware.org/images/d/dd/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%891.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/9/92/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%892.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%893.jpg" width="400" height="300">
</td>
<td> <img src="http://openwetware.org/images/3/3b/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%894.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/a/aa/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%895.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/f/f1/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%896.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/d/d4/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%897.jpg" width="400" height="300">
</td> <td>
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%898.jpg" width="400" height="300">
</td>
</tr> <tr>
<td>
<img src="http://openwetware.org/images/3/3f/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%899.jpg" width="400" height="300">
</td> <td> </td>
</tr> </table>
</article>
</section>
<!-- /***** </div> ****/ -->
<footer> <p>© Copyright Biomod 2013 Team Sendai <a href="http://www.molbot.mech.tohoku.ac.jp/index.html">
<img src="http://openwetware.org/images/3/36/Murata-nomura-logo.png"
width="180" height="50" alt="Molcular Robotics Lab" border="0" align="right">
</a> </p>
<p>E-MAIL: <a href="mailto:biomod.teamsendai.2012@gmail.com">biomod.teamsendai.2012@gmail.com </a> </p> <br> <a href="?action=edit" align="center"><p>edit</p></a> </footer>
</body> </html> <html> <head>
<script type="text/javascript"> function tabs(a,g,j){document.body.className="js-on";var g=a.getElementsByTagName(g),d=[],c;this.active;this.total=g.length;this.container=a;e=a.insertBefore(document.createElement("nav"),g[0]),change=function(f){if(typeof this.active!=="undefined"){d[this.active].className=g[this.active].className=""}d[f].className=g[f].className="active";this.active=f},clickEvent=function(h,f){h.onclick=function(){change(f);return false}};for(var b=0;b<g.length;b++){d[b]=e.appendChild(document.createElement("a"));d[b].href="#";c=[g[b].getAttribute("data-title"),g[b].getElementsByTagName(j)[0]];d[b].innerHTML=c[0]!==null?c[0]:c[1]?c[1]["innerText"||"textContent"]:b+1;new clickEvent(d[b],b)}change(0)}tabs.prototype.change=function(b){change(b-1)};tabs.prototype.next=function(b){active===this.total-1?change(0):change(active+1)};tabs.prototype.prev=function(b){active===0?change(this.total-1):change(active-1)};tabs.prototype.responsive=function(d,c){nav=document.createElement("nav");nav.id="mobiles";nav.innerHTML='<a href="#" onclick="'+d+'.prev(); return false">'+c.prev+'</a><a href="#" onclick="'+d+'.next(); return false">'+c.next+"</a>";this.container.insertBefore(nav,this.container.firstChild);return this}; </script> <script type="text/javascript">
var myTabs = new tabs(document.getElementById("tabs"), "article", "h2").responsive("myTabs", { prev: "Previous", next: "Next" }); </script> </head> </html>