Biomod/2013/Komaba/Design

Home,Project,Design,Experiment,Supplementation,Team,Sponsors

Overview

Figure D1

A ring and a cylinder are made of one scaffold and staples to make the distance between them close. DNA spider is made of DNA strands, streptavidin, and biotin. We designed them based on the following papers.
The cylinder: "Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors" by Yanming Fu et al.
The ring: "Unidirectional Scaffold-Strand Arrangement in DNA Origami" by Dongran Han,et al.
The spider: "Molecular robots guided by prescriptive landscapes" by Kyl Lund et al.

From the surface of the cylinder, 10mer long DNA strands, called probes, are jutting out and the probes bind footing DNAs. Two DNA spiders which have legs made of DNAzyme advance by cutting the footings. Those spiders are set in the opposite positions on the surface of the cylinder. The ring holds the cylinder and spiders inside of the ring sharing the same axis with the cylinder. Some strands coming out from the ring are hybridized with strands from the DNA spiders, which lets them connected to each other. The detail is explained following.

How to construct the DNA screw

Design of Cylinder

The cylinder is put in the center of the DNA screw as an axis supporting the rotation. DNA strands of staples and a scafold are formed into a cylindrical shape using DNA Origami technology. It was designed based on the work of Yanming Fu et al. with cadnano(FigureD2). The diameter of the cylinder is 30.5 nm and the axial length 43.5 nm. To identify the left and the right, one side of the cylinder projects out and we defined it as the right side as it shown in FigureD3. Not modified side is the left side. In order to bind footing DNAs on its surface spirally, 10mer long DNA strands, probes, are jutting out from the cylinder's surface.

Design of Ring

The ring is also composed with DNA Origami technology. We made the structure using cadnano referring to the work of Dongran Han,et al(FigureD2). The diameter of the ring is 62 nm and the thickness of ring is 12 nm in consideration of Atomic Force Microscope visibility(FigureD4). Two 10mer long strands come up from the inner side of the ring and are connected to the DNA spiders.

Design of DNA spider

Our DNA screw rotates by using DNA spiders, which is created based on the work of Lund, et al. Our DNA spider consists of a body, a CL-H strand, and three walking legs(FigureD5). The CL-H strand has two parts; capture leg(CL) part and head strand(H strand) part. A biotin is attached in the middle of the CL-H strand and attached to the DNA spider's body. Here is the part that we modified from the one in the original paper. The capture leg has a function of connecting the DNA spider to the specific strand at the start point on the cylinder. Head strand connects the DNA spider to the Ring. Walking legs make the DNA spider move forward and this function is described in the ....The body is tetramer streptavidin and the sequence of other parts are listed below.
CL-H strand: 5′ - AGG CGC ACT T /iSp18//iSp18//3Bio//iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG - 3′
(The head part is AGG CGC ACT T /iSp18//iSp18/ and the capture leg part is /iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG)
Walking Leg: 5′ - /5BioTEG//iSp18//iSp18/ TCT CTT CTC CGA GCC GGT CGA AAT AGT GAA AA - 3′

Cutting the scaffold

To make the DNA screw rotate, the ring and the cylinder, both of which are made of the same one scaffold, have to be separated(Figure D6). Here we carefully selected two appropriate enzyme considering the temperature, content of buffer, and other factor; BbvCI and SbfI.

How The DNA Screw Works

The function of DNA spider

DNA spider with one CL-H strand, which means capture leg and head stand, and three walking legs, is the core of the rotary function. A DNA spider's walking leg consists of 8-17DNAzyme and the spider advances by cutting common footings by the walking leg and utilizing Brownian motion. The process is described in the FigureD7 and D8. The sequence of the common footing is 5′- GGGTGAGAGG TTTTTCACTATrAGGAAGAG -3' and designed as it hybridizes with the sequence of the walking leg. First the tip of the common footing is cut away by walking leg. Second the partially cut common footing and the walking leg move by Brownian motion and one time walking leg hybridizes with a tip of next common footing. Finally, the walking leg dissociates from the last common footing followed by binding to the nearest common footing. This cutting process occurs again and again, and the spider walks down the track.

How the spider advances on the cylinder's surface

The cylinder is rounded from the rectangle shape. We operated two DNA spiders on the surface of cylinder so there are two tracks, each of which consists of three lines of the common footings. We designed the distance between the common footings, taking into account that the interval between the common footings on the same track is short enough for the walking leg to move to next common footing. In addition, the interval between the two tracks are wide enough for spiders not to jump to next footing track(Figure D9).

The start point and the end point

In order to make the DNA spider start to walk from the same starting point, the start probe is jut out at left end side(Figure D9). This start probe partially hybridizes with specific strand at the starting point, called a start footing, and then the start footing hybridizes with capture leg in the DNA spider. Also to stop the spider's walk, three end probes are attached at the right end side on each track. In addition, the end probes partially hybridizes with end footings. The sequence of the end footing is slightly different from common footing in that the the end footing uses rA instead of A. These sequences are listed below.
Start Footing: 5'- TGC ATCGCGA CGGCTCTTGGACTGCGTTCATCTGTA G -3'
Common Footing : 5′- GGGTGAGAGG TTTTTCACTATrAGGAAGAG -3'
End Footing: 5'- TGGCTCAACG TTTTTCACTATAGGAAGAG -3'

How the ring rotates

Two DNA spiders and a ring are connected by hybridization between the head strand in DNA spider and the strands coming out from the ring. Every time that the spiders advance, the ring rotates.

Overall process

The DNA screw is realized by assembling the above four parts: the cylinder, footings, DNA Spiders, and the ring (Figure 10). The DNA screw is assembled in the following process.

Step 1. The cylinder and the ring are synthesized.
Step 2. The DNA spider is synthesized
Step 3. The cylinder-ring structure, the DNA spider, and the start footing are mixed
Step 4. The common footings and the end footings are mixed with the solution made in the Step 3 and hybridized to the common probes and the end probes respectively.
Step 5. Put the two enzyme to cut the scaffold.
Step 6. Put a trigger strand which is complementary to the start footing, which start the spider to walk

Figure D11

Next Step

We developed a design in which the spider's body, streptavidin, is removed and the spider's walking legs are directly connected to the ring. With this design, the DNA screw could be more compact and less complex.

Figure D12

Figure D13

The process until we decided to adopt this design

At first, we were planning to design the ring and the cylinder separately. However, it could happen that the electrical repulsions between them reject each other and they do not connect to each other. Then we changed the designing method and decided to make them in one scaffold. In that case, the cylinder and the ring stay keeping some distance and will have more possibility to connect to each other.

In our design, We had some difficulties; First, we had to make the ring and cylinder within 7250 mer. Second, we had to find enzyme to cut the ring and cylinder. Third, we had to find cylinder and ring with compatible size in diameter. Fourth, we had to find a good design which allows us to put probes in an appropriate interval.

We found the following designing approaches of a cylinder and a ring. Some commented are added to each. Based on these designs we designed a lot of types of ring and cylinder structure on cadnano.

Designing method 1(From "DNA Origami with Complex Curvatures in Three-Dimensional Space" by Dongran Han et al.)
Figure D14
This cylinder's design is rigid enough. On the other hand, it is hard to grow probes which do not disturb the crossovers. Also, probes may come up from the back surface in this method and we can't separate it from the cylinder in which probes grow up from the front surface. The possibility would be 50:50

Designing method 2 (From "Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors" by Yanming Fu et al.)
Figure D15
This cylinder's design is rigid as well as flexible in designing. In addition, this cylinder's yield of 88% is high. With this reason, we adopted this. However, we cannot designate which becomes the front surface and the back surface. This is the same problem as one in the Designing method 1. Also, if the diameter of this gets wide compared to its axial length, this does not form a cylinder shape. We met this difficulty of this in our experiment.

Designing method 3 (From "Unidirectional Scaffold-Strand Arrangement in DNA Origami" by Dongran Han et al.)
Figure D16
This designing method is useful both to a ring and a cylinder. It would have some flexibility in the length of the diameter. Moreover, because there is no crossover, it is easy to grow probes. However, this designing method of this is not clearly written so hard to copy.

Designing method 4
Figure D17

Designing method 5 (From "DNA Origami with Complex Curvatures in Three-Dimensional Space" by Dongran Han et al.)
Figure D18
This ring's design is easy to adjust the diameter in the range from 22nm to 50nm. However, if you want to design a ring with a larger diameter, you need to consider the crossovers deeply and it is hard to find good points of crossovers.

Designing method 6 (From "Self-Assembly of DNA Rings from Scaffold-Free DNA Tiles" by Yang Yang et al.)
Figure D19
This ring consists of only staples. So this is against our policy in which we construct a ring and a cylinder in one scaffold. You must be careful about the electrical repulsion problem between a ring and a cylinder when you adopt this in DNA screw. However, once it is proved that this ring and a cylinder can connect, it would give a much wider option to the DNA screw design because a cylinder can use all the 7250 mer scaffold and the ring's designing method covers a wide range of a diameter.