Biomod/2013/Komaba/Design

Home,Project,Design,Experiment,Supplementation,Team,Sponsors

Overview

Figure 1

A ring and cylinder are made of one scaffold and staples to make the distance between them close. DNA spider is made of DNA strands, streptavidin, and biotin. We designed them based on the following papers.
The cylinder: "Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors" by Yanming Fu et al.
The ring: "Unidirectional Scaffold-Strand Arrangement in DNA Origami" by Dongran Han,et al.
The spider: "Molecular robots guided by prescriptive landscapes" by Kyl Lund et al.

From the surface of the cylinder, 10mer long DNA strands, called probes, are jutting out and the probes bind footing DNAs. Two DNA spiders which have legs made of DNAzyme advance by cutting the footings. Those spiders are set in the opposite positions on the surface of the cylinder. The ring holds the cylinder and spiders inside of the ring sharing the same axis with the cylinder. Some strands coming out from the ring are hybridized with strands from the DNA spiders, which lets them connected each other. The detail is explained following.

Design of Cylinder and Ring

The cylinder is put in the center of the DNA screw as an axis supporting the rotation. DNA strands of staples and a scafold are formed into a cylindrical shape using DNA Origami technology. It was designed based on the work of Yanming Fu et al. with cadnano software, which "simplifies and enhances the process of designing three-dimensional DNA origami nanostructures"(FigureD2). The diameter of the cylinder is 30.5 nm and the axial length 43.5 nm(FigureD3). To identify the left and the right, one side of the cylinder is modified and we defined it as the right side. Not modified side is the left side. In order to bind footing DNAs on its surface spirally, 10mer long DNA strands, probes, are jutting out from the cylinder's surface.

The ring is also composed with DNA Origami technology. We made the structure using cadnano referring to the work of Dongran Han,et al(FigureD2). The diameter of the ring is 62 nm and the thickness of ring is 12 nm in consideration of Atomic Force Microscope visibility (FigureD4). Two 10mer long strands come up from the inner side of the ring and are connected to the DNA spiders.

DNA spider

Design

Our DNA screw rotates by using DNA spiders, which is being created based on the work of Lund, et al. Our DNA spider consists of a body, a double leg, and three walking legs(FigureD5). The double leg has two parts in one strand; head strand part and capture leg part. Here is the part that we modified from the one in the original paper. The body is tetramer streptavidin and the sequence of other parts are listed below.
Double Leg: 5′ - AGG CGC ACT T /iSp18//iSp18//3Bio//iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG - 3′
(The head part is AGG CGC ACT T /iSp18//iSp18/ and the capture leg part is /iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG)
Walking Leg: 5′ - /5BioTEG//iSp18//iSp18/ TCT CTT CTC CGA GCC GGT CGA AAT AGT GAA AA - 3′

How It Works

A DNA spider's walking leg consists of 8-17DNAzyme and the spider advances by cutting common footings by the walking leg and utilizing Brownian motion, which is described in the FigureD6 and D7. The sequence of the common footing is 5′- GGGTGAGAGG TTTTTCACTATrAGGAAGAG -3' and designed as it is hybridized with the sequence of the walking leg. First the tip of the common footing is cut away by walking leg. Second the partially cut common footing and the walking leg move by Brownian motion and one time walking leg hybridizes with a tip of next common footing. Finally, the walking leg is disconnected from the last common footing and the common footing is binding to the nearest track strand. This cutting process is occurring again.

Relationship Between DNA Spider and Cylinder

The cylinder is rounded from the rectangle shape. We operate two DNA spiders on the surface of cylinder so there are two tracks, each of which consists of three lines of the common footings. We designed the distance between the common footings taking into account that the internal between the common footings on the same track is short enough for the walking leg to move to next common footing but the interval between the two tracks are wide enough for spiders not to jump to next footing track(Figure D8).

In order to make the DNA spider start to walk from the same starting point, the start probe is jut out at left end side. This start probe partially hybridizes with specific strand at the starting point, called a start footing, and then the start footing hybridizes with capture leg in the DNA spider. Also to stop the spider's walk, three end probes are attached at the right end side. In addition, the end probes partially hybridizes with end footings. The sequence of the end footing is slightly different from common footing in that the the end footing uses rA instead of A. These sequences are listed below.
Start Footing: 5'- TGC ATCGCGA CGGCTCTTGGACTGCGTTCATCTGTA G -3'
Common Footing : 5′- GGGTGAGAGG TTTTTCACTATrAGGAAGAG -3'
End Footing: 5'- TGGCTCAACG TTTTTCACTATAGGAAGAG -3'

Relationship Between DNA Spider and Ring

Two DNA spiders and the ring are connected by hybridization between the head strand in DNA spider and the strands coming out from the ring.

Cutting the scaffold

To make the DNA screw rotate, the ring and the cylinder, both of which are made of the same one scaffold, have to be separated(Figure D9). Here we carefully selected two appropriate enzyme considering the temperature, content of buffer, and other factor; BbvCI and SbfI.

Overall process

The DNA screw is realized by assembling the above four parts: the cylinder, footings, DNA Spiders, and the rotary ring (Figure 6). The DNA screw is assembled in the following process.

Step 1. The cylinder and the ring are synthesized.
Step 2. The DNA spider is synthesized
Step 3. The cylinder-ring structure, the DNA spider, and the start footing are mixed
Step 4. The common footings and the end footings are mixed with the solution made in the Step 3 and hybridized to the common probes and the end probes respectively.
Step 5. Put the two enzyme to cut the scaffold.
Step 6. Put a trigger strand which is complementary to the start footing, which start the spider to walk

Figure D10

The process until we decided to adopt this design

At first, we were planning to design the ring and the cylinder separately. However, it could happen that the electrical repulsions between them reject each other and they do not connect each other. Then we changed the designing method and decided to make them in one scaffold. In that case, the cylinder and the ring stay keeping some distance and will have more possibility to connect each other.

In our design, We had some difficulties; First, we had to make the ring and cylinder within 7250 mer. Second, we had to find enzyme to cut the ring and cylinder. Third, we had to find cylinder and ring with compatible size in diameter. Fourth, we had to find a good design which allows us to put probes in an appropriate interval.

We found the following designing approaches of a cylinder and a ring. We commented each advantage and disadvantage.

Designing method 1