Biomod/2013/Komaba/Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(142 intermediate revisions by 5 users not shown)
Line 1: Line 1:
{{Biomod/2013/Komaba}}
{{Template:Biomod2013a}}


== Overview ==
== Overview ==
Figure 1


A ring and cylinder are made of one scaffold and staples to make the distance between them close. DNA spider is made of DNA strands, streptavidin, and biotin. We designed them based on the following papers.
[[Image:FigureD1-2.jpg|frame|Figure D1]]
<br>The cylinder: "Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors" by Yanming Fu et al.
<br>The ring: "Unidirectional Scaffold-Strand Arrangement in DNA Origami" by Dongran Han,et al.
<br>The spider: "Molecular robots guided by prescriptive landscapes" by Kyl Lund et al.


From the surface of the cylinder, 10mer long DNA strands, called probes, are jutting out and the probes bind footing DNAs. Two DNA spiders which have legs made of DNAzyme advance by cutting the footings. Those spiders are set in the opposite positions on the surface of the cylinder. The ring holds the cylinder and spiders inside of the ring sharing the same axis with the cylinder. Some strands coming out from the ring are hybridized with strands from the DNA spiders, which lets them connected each other. The detail is explained following.
Our goal is to design the DNA screw in Figure D1. It consists of three parts; a cylinder, a ring, and DNA spiders. Both cylinder and ring are made of DNA origami. A cylinder and a ring were made in one scaffold to avoid the electrostatic interaction which would cause them to keep away from each other. With our design, the cylinder and the ring stay keeping some distance and will have more possibility to connect to each other. However, with this condition, four difficulties exist. First, making the ring and cylinder within 7250 mer. Second, finding an enzyme to cut the ring and cylinder. Third, finding a cylinder and a ring with a compatible size in diameter. Fourth, a proper design which allows putting anchors in an appropriate interval. With careful selection, designs of a cylinder and a ring solving these problems were adopted. The structure of the cylinder and the ring were designed based on two papers<cite>cylinder</cite><cite>ring</cite>.


== Design of Cylinder and Ring ==
With the scaffold, the cylinder has tracks made of unpaired staples on its surface. The ring also has unpaired staples to connect to the spiders. The spiders consist of a tetrameric streptavidin bound to 4 biotinylated ssDNA: 3 walking legs and one CL-H strand. The DNA spider was designed based on this paper<cite>spider</cite>. From the surface of the cylinder, 10mer long DNA strands, called anchors, are jutting out and are hybridized with footing DNAs. Two DNA spiders, which have legs made of DNAzyme, advance by cleaving the footings. Those spiders are set in the opposite positions on the surface of the cylinder.  
The cylinder is put in the center of the DNA screw as an axis supporting the rotation. DNA strands of staples and a scafold are formed into a cylindrical shape using DNA Origami technology. It was designed based on the work of Yanming Fu et al. with cadnano software, which "simplifies and enhances the process of designing three-dimensional DNA origami nanostructures"(FigureD2). The diameter of the cylinder is 30.5 nm and the axial length 43.5 nm(FigureD3). To identify the left and the right, one side of the cylinder is modified and we defined it as the right side. Not modified side is the left side. In order to bind footing DNAs on its surface spirally, 10mer long DNA strands, probes, are jutting out from the cylinder's surface.  
{{-}}


The ring is also composed with DNA Origami technology. We made the structure using cadnano referring to the work of Dongran Han,et al(FigureD2). The diameter of the ring is 62 nm and the thickness of ring is 12 nm in consideration of Atomic Force Microscope visibility (FigureD4). Two 10mer long strands come up from the inner side of the ring and are connected to the DNA spiders.  
== How to construct the DNA screw ==
=== Design of Cylinder===
[[Image:FigureD2-2.jpg|frame|Figure D2]]
Some articles describing cylinder's designing methods were carefully read and the methods were tried with cadnano. Finally the following method was adopted; a rectangle, which is made of a scaffold and staples, are formed into a cylinder shape. This method has two advantages. This cylinder's design is rigid as well as flexible in designing. In addition, the yield is quite high (i.e.88%). However, it is not possible to designate which surface becomes the front surface. Anchors can come up from the back surface in this method. Also There is no separating it from the cylinder in which anchors grow up from the front surface.


== DNA spider  ==
The cylinder is put in the center of the DNA screw as an axis supporting the rotation. A rectangular DNA Origami (140 staples and a M13mp18 scaffold) is bent into the cylindrical shape. The two sides of the rectangular origami are connected by staples. The diameter of the cylinder is 30.5 nm and the axial length 43.5 nm. The design was constructed using cadnano<cite>cadnano</cite>. To identify the start and the end of anchors, one side of the cylinder projects out and it was defined as the end side as shown in Figure D2. Not modified side is the start side. In order to bind footing DNAs on its surface spirally, 10mer long DNA strands, anchors, are jutting out from the cylinder's surface. The anchors are designed for the 5' ends of the staples to be the anchors' tips.
=== Design ===
{{-}}
Our DNA screw rotates by using DNA spiders, which is being created based on the work of Lund, et al. Our DNA spider consists of a body, a double leg, and three walking legs(FigureD5). The double leg has two parts in one strand; head strand part and capture leg part. Here is the part that we modified from the one in the original paper. The body is tetramer streptavidin and the sequence of other parts are listed below.
<br>Double Leg:  5′ - AGG CGC ACT T /iSp18//iSp18//3Bio//iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG - 3′
<br>(The head part is AGG CGC ACT T /iSp18//iSp18/ and the capture leg part is /iSp18//iSp18/ TGA ACG CAG TCC AAG AGC CG)
<br>Walking Leg: 5′ - /5BioTEG//iSp18//iSp18/ TCT CTT CTC CGA GCC GGT CGA AAT AGT GAA AA - 3′


=== How It Works ===
=== Design of Ring ===
A DNA spider's walking leg consists of 8-17DNAzyme and the spider advances by cutting common footings by the walking leg and utilizing Brownian motion, which is described in the FigureD6 and D7. The sequence of the common footing is 5′- GGGTGAGAGG TTTTTCACTATrAGGAAGAG -3' and designed as it is hybridized with the sequence of the walking leg. First the tip of the common footing is cut away by walking leg. Second the partially cut common footing and the walking leg move by Brownian motion and one time walking leg hybridizes with a tip of next common footing. Finally, the walking leg is disconnected from the last common footing and the common footing is binding to the nearest track strand. This cutting process is occurring again.
[[Image:FigureD3-1.jpg|frame|200px|Figure D3]]
A winding helical pattern was adopted as a ring's part of cylinder-ring structure. The reason of adopting it is that it is small enough for the cylinder and the ring to be designed within 7250 mer of M13mp18. Moreover, because there is no crossover, it is easy to grow anchors. This designing method is not clearly written in the original paper<cite>ring</cite> so it required particular conditions to duplicate.


== Relationship Between DNA Spider and Cylinder ==
The ring is also composed of DNA Origami and designed using cadnano<cite>cadnano</cite>. A scaffold winds in a spiral shape as shown in Figure D3. There are four loops in the ring and neighboring loops are connected by staples as these loops are as close as possible. The diameter of the ring is 61.8 nm and the thickness of ring is 12.0 nm in consideration of Atomic Force Microscope visibility. Two 10mer long strands come up from the inner side of the ring and are connected to the DNA spiders.
The cylinder is rounded from the rectangle shape. We operate two DNA spiders on the surface of cylinder so there are two tracks, each of which consists of three lines of the common footings. We designed the distance between the common footings taking into account that the internal between the common footings on the same track is short enough for the walking leg to move to next common footing but the interval between the two tracks are wide enough for spiders not to jump to next footing track(Figure D8).  
{{-}}


In order to make the DNA spider start to walk from the same starting point, the start probe is jut out at left end side. This start probe partially hybridizes with specific strand at the starting point, called a start footing, and then the start footing hybridizes with capture leg in the DNA spider. Also to stop the spider's walk, three end probes are attached at the right end side. In addition, the end probes partially hybridizes with end footings. The sequence of the end footing is slightly different from common footing in that the the end footing uses rA instead of A. These sequences are listed below.
=== Design of DNA spider  ===
<br>Start Footing:  5'- TGC ATCGCGA  CGGCTCTTGGACTGCGTTCATCTGTA G -3'
[[Image:FigureD4-4.jpg|frame|Figure D4]]
<br>Common Footing : 5′- GGGTGAGAGG  TTTTTCACTATrAGGAAGAG -3'
The DNA screw rotates by using DNA spiders. Our DNA spider consists of a streptavidin tetramer body and biotinylated ssDNA as legs. There are two kinds of legs : the first is walking leg and the second is a CL-H strand (Figure D4). The CL-H strand has two parts; capture leg(CL) part and head strand(H strand) part. A biotin is fixed in the middle of the CL-H strand and attached to the DNA spider's body. This is the part that was modified from the one in the original paper<cite>spider</cite>. The sequences of those strands are listed [[here]]. The capture leg has a function of connecting the DNA spider to the specific strand at the start point on the cylinder. Head strand connects the DNA spider to the Ring. Walking legs make the DNA spider move forward and this function is described in Figure D5. The cohesion of the spider relies on the strong streptavidin/biotin interaction. The DNA spider with one CL-H strand and there walking legs are planned to be purified with electrophoresis。
<br>End Footing:    5'- TGGCTCAACG  TTTTTCACTATAGGAAGAG -3'


== Relationship Between DNA Spider and Ring ==
<html>
Two DNA spiders and the ring are connected by hybridization between the head strand in DNA spider and the strands coming out from the ring.  
<img src="http://openwetware.org/images/5/54/DNAwalking.gif" width=300>
 
</html>
== Cutting the scaffold ==
To make the DNA screw rotate, the ring and the cylinder, both of which are made of the same one scaffold, have to be separated(Figure D9). Here we carefully selected two appropriate enzyme considering the temperature, content of buffer, and other factor; BbvCI and SbfI.


== Overall process ==
{{-}}
The DNA screw is realized by assembling the above four parts: the cylinder, footings, DNA Spiders, and the rotary ring (Figure 6). The DNA screw is assembled in the following process.
 
== Motion of The DNA Screw ==
=== The function of DNA spider ===
DNA spider with one CL-H strand, and three walking legs, is the core of the rotary function. A DNA spider's walking leg consists of 8-17DNAzyme. The spider advances by cleaving common footings by the walking legs and utilizing Brownian motion. [[The sequence of the common footings]] is designed as they hybridizes with walking legs.
The process is described in the Figure D5. First the tip of the common footing is cleaved away by a walking leg. Second the partially cleaved common footing and the walking leg move by Brownian motion and one time walking leg hybridizes with a tip of next common footing. Finally, the walking leg dissociates from the last common footing followed by binding to the nearest common footing. This cleaving process occurs again and again, and the spider advances down the track.
 
=== How the spider advances on the cylinder's surface ===
[[Image:FigureD6.jpg|frame|Figure D6]]
The cylinder is rounded from the rectangle shape.Two DNA spiders are operated on the surface of cylinder so there are two tracks, each of which consists of three lines of the common footings. The distance between the common footings was designed as 10.5nm taking it into account that the interval between the common footings on the same track is short enough for the walking leg to move to next common footing. In addition, the interval between the two tracks, 16.2nm, are wide enough to avoid spiders from jumping to next footing track(Figure D6).  
 
{{-}}


<br>Step 1. The cylinder and the ring are synthesized.
=== The start point and the end point ===
<br>Step 2. The DNA spider is synthesized
In order to make the DNA spider start to advance from the same starting point, the start anchor is jutted out at left end side(Figure D6). This start anchor partially hybridizes with specific strand at the starting point, called a start footing, and then the start footing hybridizes with capture leg in the DNA spider. Also to stop the spider's walk, three end anchors are attached at the end side on each track. The end anchors partially hybridizes with end footings. The sequence of the end footing is slightly different from common footing in that the the end footing uses A instead of rA. These sequences are listed [[here]].
<br>Step 3. The cylinder-ring structure, the DNA spider, and the start footing are mixed
<br>Step 4. The common footings and the end footings are mixed with the solution made in the Step 3 and hybridized to the common probes and the end probes respectively.  
<br>Step 5. Put the two enzyme to cut the scaffold.
<br>Step 6. Put a trigger strand which is complementary to the start footing, which start the spider to walk


Figure D10
=== Cutting the scaffold ===
To make the DNA screw rotate, the ring and the cylinder, both of which are made of the same one scaffold, had to be separated. Here two appropriate enzymes were carefully selected considering the temperature, content of buffer, and other factors; BbvCI and SbfI. Both enzymes were incubated at 37℃.


== The process until we decided to adopt this design ==
== Overall process ==
At first, we were planning to design the ring and the cylinder separately. However, it could happen that the electrical repulsions between them reject each other and they do not connect each other. Then we changed the designing method and decided to make them in one scaffold. In that case, the cylinder and the ring stay keeping some distance and will have more possibility to connect each other.  
<html>
<iframe width="640" height="390" src="//www.youtube.com/embed/b04Uk3lB0Mw" frameborder="0" allowfullscreen style="float:right;margin:10px;"></iframe>
</html>


In our design, We had some difficulties; First, we had to make the ring and cylinder within 7250 mer. Second, we had to find enzyme to cut the ring and cylinder. Third, we had to find cylinder and ring with compatible size in diameter. Fourth, we had to find a good design which allows us to put probes in an appropriate interval.
The DNA screw was realized by assembling the above three parts: the cylinder, DNA Spiders, and the ring. The DNA screw was assembled in the following process.


We found the following designing approaches of a cylinder and a ring. Some commented are added to each. Based on these designs we designed a lot of types of ring and cylinder structure on cadnano.  
<br>Step 1. The cylinder and the ring were synthesized.
<br>Step 2. The DNA spider was synthesized
<br>Step 3. The cylinder-ring structure, the DNA spider, and the start footing were mixed
<br>Step 4. The common footings and the end footings were mixed with the solution made in the Step 3 and hybridized to the common anchors and the end anchors respectively.
<br>Step 5. The two enzymes were put to cut the scaffold.
<br>Step 6. A trigger strand was put. This is complementary to starting strand, which initiate the spider walking.


Designing method 1
== Other Designed Structures ==
<br>Figure D11
<br>This cylinder's design is rigid enough. On the other hand, it is hard to grow probes which do not disturb the crossovers. Also, probes may come up from the back surface in this method and we can't separate it from the cylinder in which probes grow up from the front surface. The possibility would be 50:50


Designing method 2
=== Cylinder(1st ver.) ===
<br>Figure D12
[[Image:cylinder(1st).jpg|frame|Figure D8]]
<br>This cylinder's design is rigid as well as flexible in designing. In addition, this cylinder's yield of 88% is high. With this reason, we adopted this. However, we cannot designate which becomes the front surface and the back surface. This is the same problem as one in the Designing method 1. Also, if the diameter of this gets wide compared to its axial length, this does not form a cylinder shape. We met this difficulty of this in our experiment.
Before we designed the cylinder-ring structure, we made only a cylinder and confirmed that a cylinder designed based on the paper<cite>cylinder</cite> was actually formed. The size is the diameter 38.2nm × the axial length 43.5nm. The interval of anchors of this cylinder was too wide for the DNA spiders to walk.
{{-}}


Designing method 3
=== Ring(1st ver.)&(2nd ver.) ===
<br>Figure D13
[[Image:ring(1st).jpg|frame|Figure D9]][[Image:ring(2st).jpg|frame|Figure D10]]
<br>This designing method is useful both to a ring and a cylinder. It would have some flexibility in the length of the diameter. Moreover, because there is no crossover, it is easy to grow probes. However, this designing method of this is not clearly written so hard to copy.  


Designing method 4
Rings with two other designs, Ring(1st ver.) and Ring(2nd ver.), were designed besides the ring shown in the cylinder-ring structure.
<br>Figure D14


Designing method 5
Ring(1st ver.) is a ring formed from a long tape using the same method as the cylinder<cite>cylinder</cite>.  
<br>Figure D15
<br>This ring's design is easy to adjust the diameter in the range from 22nm to 50nm. However, if you want to design a ring with a larger diameter, you need to consider the crossovers deeply and it is hard to find good points of crossovers.  


Designing method 6
The designing approach of Ring(2nd ver.) is that six-helix DNA bundle units, assembled from twelve single stranded DNAs arranged in networks of contiguous and semicrossover strands, are connected into nano rings without scaffold. It was designed based on this paper<cite>Ring2</cite>. The sequences of all the staples but one are the same as those in the original paper. The one is one mer longer than the counterpart in the paper. You can see the sequences from [[Ring(2nd ver.) sequences]]. These two rings were tried without being designed with a cylinder in one scaffold.
<br>Figure D16
{{-}}
<br>This ring consists of only staples. So this is against our policy in which we construct a ring and a cylinder in one scaffold. You must be careful about the electrical repulsion problem between a ring and a cylinder when you adopt this in DNA screw. However, once it is proved that this ring and a cylinder can connect, it would give a much wider option to the DNA screw design because a cylinder can use all the 7250 mer scaffold and the ring's designing method covers a wide range of a diameter.


Designing method 7
== Reference ==
<br>Figure D17
<biblio>
#cylinder Yanming Fu.''et al.'', ''Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors'', American Chemical Society, 2012
#ring Dongran Han ''et al.'', ''Unidirectional Scaffold-Strand Arrangement in DNA Origami''
#spider Kyle Lund ''et al.'', ''Molecular robots guided by prescriptive landscapes'', Nature Vol465, 2010
#cadnano http://cadnano.org/
#Ring2 Yang Yang ''et al.'', ''Self-Assembly of DNA Rings from Scaffold-Free DNA Tiles'', Nano Letters 2013
</biblio>

Latest revision as of 00:02, 27 October 2013

<html> <head> <title></title> <script type="text/javascript" src="http://code.jquery.com/jquery-1.10.2.min.js"></script> <script type="text/javascript" src="http://metroui.org.ua/js/metro/metro-dropdown.js"></script> <style> article, aside, details, figcaption, figure, footer, header, hgroup, nav, section, summary { display: block; }

audio, canvas, video { display: inline-block;

  • display: inline;
  • zoom: 1;

}

audio:not([controls]) { display: none; height: 0; }

[hidden] { display: none; }

html { font-size: 100%; -webkit-text-size-adjust: 100%; -ms-text-size-adjust: 100%; }

html, button, input, select, textarea { font-family: sans-serif; }

body { margin: 0; }

a:focus { outline: thin dotted; }

a:hover, a:active { outline: 0; }

h1 { font-size: 2em; margin: .67em 0; }

h2 { font-size: 1.5em; margin: .83em 0; }

h3 { font-size: 1.17em; margin: 1em 0; }

h4 { font-size: 1em; margin: 1.33em 0; }

h5 { font-size: .83em; margin: 1.67em 0; }

h6 { font-size: .75em; margin: 2.33em 0; }

abbr[title] { border-bottom: 1px dotted; }

b, strong { font-weight: bold; }

blockquote { margin: 1em 40px; }

dfn { font-style: italic; }

mark { background: #ff0; color: #000; }

p, pre { margin: 1em 0; }

pre, code, kbd, samp { font-family: monospace,serif; _font-family: 'courier new',monospace; font-size: 1em; }

pre { white-space: pre; white-space: pre-wrap; word-wrap: break-word; }

q { quotes: none; }

q:before, q:after { content: ''; content: none; }

small { font-size: 75%; }

sub, sup { font-size: 75%; line-height: 0; position: relative; vertical-align: baseline; }

sup { top: -0.5em; }

sub { bottom: -0.25em; }

dl, menu, ol, ul { margin: 1em 0; }

dd { margin: 0 0 0 40px; }

menu, ol, ul { padding: 0 0 0 40px; }

nav ul, nav ol { list-style: none; list-style-image: none; }

img { border: 0; -ms-interpolation-mode: bicubic; }

svg:not(:root) { overflow: hidden; }

figure { margin: 0; }

form { margin: 0; }

fieldset { border: 1px solid #c0c0c0; margin: 0 2px; padding: .35em .625em .75em; }

legend { border: 0; padding: 0; white-space: normal;

  • margin-left: -7px;

}

button, input, select, textarea { font-size: 100%; margin: 0; vertical-align: baseline;

  • vertical-align: middle;

}

button, input { line-height: normal; }

button, input[type="button"], input[type="reset"], input[type="submit"] { cursor: pointer; -webkit-appearance: button;

  • overflow: visible;

}

button[disabled], input[disabled] { cursor: default; }

input[type="checkbox"], input[type="radio"] { box-sizing: border-box; padding: 0;

  • height: 13px;
  • width: 13px;

}

input[type="search"] { -webkit-appearance: textfield; -moz-box-sizing: content-box; -webkit-box-sizing: content-box; box-sizing: content-box; }

input[type="search"]::-webkit-search-decoration, input[type="search"]::-webkit-search-cancel-button { -webkit-appearance: none; }

button::-moz-focus-inner, input::-moz-focus-inner { border: 0; padding: 0; }

textarea { overflow: auto; vertical-align: top; }

table { border-collapse: collapse; border-spacing: 0; }

@font-face { font-family: "PT Serif Caption"; font-style: normal; font-weight: 400; src: local("PT Serif Caption"),local("PTSerif-Caption"),url(https://themes.googleusercontent.com/static/fonts/ptserifcaption/v4/7xkFOeTxxO1GMC1suOUYWWhBabBbEjGd1iRmpyoZukE.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 700; src: local("Open Sans Bold"),local("OpenSans-Bold"),url(https://themes.googleusercontent.com/static/fonts/opensans/v6/k3k702ZOKiLJc3WVjuplzJ1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 300; src: local("Open Sans Light"),local("OpenSans-Light"),url(https://themes.googleusercontent.com/static/fonts/opensans/v6/DXI1ORHCpsQm3Vp6mXoaTZ1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 800; src: local("Open Sans Extrabold"),local("OpenSans-Extrabold"),url(https://themes.googleusercontent.com/static/fonts/opensans/v6/EInbV5DfGHOiMmvb1Xr-hp1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 400; src: local("Open Sans"),local("OpenSans"),url(https://themes.googleusercontent.com/static/fonts/opensans/v6/K88pR3goAWT7BTt32Z01mz8E0i7KZn-EPnyo3HZu7kw.woff) format('woff'); }

.text-rest-state { color: #000; }

.text-rest2-state { color: rgba(0,0,0,0.6); }

.text-hover-state { color: rgba(0,0,0,0.8); }

.text-pressed-state { color: rgba(0,0,0,0.4); }

  1. font .header {

font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 42pt; letter-spacing: .00em; line-height: 44pt; font-smooth: always; }

  1. font .subheader, #font .subheader-secondary {

font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; }

  1. font .subheader-smaller, #font .subheader-secondary-smaller {

font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; letter-spacing: .01em; line-height: 24pt; font-size: 16pt; font-smooth: always; }

  1. font .small-subheader, #font .small-subheader-secondary {

font-family: 'Segoe UI Semibold','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; }

  1. font .navigation {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; }

  1. font .body, #font .body-secondary, #font .normal {

font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

  1. font .link {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; font-smooth: always; }

  1. font .tertiary, #font .tertiary-secondary {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; }

  1. font .control {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; }

  1. font .small {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 8pt; font-smooth: always; }

  1. font .long-text {

font-family: 'PT Serif Caption',sans-serif,serif !important; font-weight: 300; font-size: 10pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

  1. font .long-text-smaller {

font-family: 'PT Serif Caption',sans-serif,serif !important; font-weight: 300; font-size: 10pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; font-size: 9pt; }

  1. font .long-text-lead {

font-family: 'PT Serif Caption',sans-serif,serif !important; font-weight: 300; font-size: 10pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; font-size: 20pt; }

  1. state .header, #state .subheader, #state .small-subheader, #state .navigation, #state .body, #state .tertiary {

color: #000; }

  1. state .header:hover, #state .subheader:hover, #state .small-subheader:hover, #state .navigation:hover, #state .body:hover, #state .tertiary:hover {

color: rgba(0,0,0,0.8); }

  1. state .header:active, #state .subheader:active, #state .small-subheader:active, #state .navigation:active, #state .body:active, #state .tertiary:active {

color: rgba(0,0,0,0.4); }

  1. state .subheader-secondary, #state .subheader-secondary-smaller, #state .small-subheader, #state .small-subheader-secondary, #state .body-secondary, #state .tertiary-secondary {

color: rgba(0,0,0,0.6); }

  1. state .subheader-secondary:hover, #state .subheader-secondary-smaller:hover, #state .small-subheader:hover, #state .small-subheader-secondary:hover, #state .body-secondary:hover, #state .tertiary-secondary:hover {

color: rgba(0,0,0,0.8); }

  1. state .subheader-secondary:active, #state .subheader-secondary-smaller:active, #state .small-subheader:active, #state .small-subheader-secondary:active, #state .body-secondary:active, #state .tertiary-secondary:active {

color: rgba(0,0,0,0.4); }

  1. state .link {

color: #2e92cf; }

  1. state .link:hover {

color: rgba(45,173,237,0.8); }

  1. state .link:active {

color: rgba(45,173,237,0.6); }

a, .link { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; font-smooth: always; color: #2e92cf; text-decoration: none; }

a:hover, .link:hover { color: rgba(45,173,237,0.8); }

a:active, .link:active { color: rgba(45,173,237,0.6); }

h1, h2, h3, h4, h5, h6 { margin: 0 0 10px 0; padding: 0; }

h1 { font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 42pt; letter-spacing: .00em; line-height: 44pt; font-smooth: always; color: #000; }

h2 { font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; color: #000; }

h3 { font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; color: rgba(0,0,0,0.6); font-size: 16pt; line-height: 24px; }

h4 { font-family: 'Segoe UI Semibold','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: #000; color: rgba(0,0,0,0.6); }

h5 { font-family: 'Segoe UI Semibold','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: rgba(0,0,0,0.6); font-size: 90%; }

h5:hover { color: rgba(0,0,0,0.8); }

h5:active { color: rgba(0,0,0,0.4); }

h6 { font-family: 'Segoe UI Semibold','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: rgba(0,0,0,0.6); font-size: 80%; }

h6:hover { color: rgba(0,0,0,0.8); }

h6:active { color: rgba(0,0,0,0.4); }

body, p, div { font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

p.long-text { font-family: 'PT Serif Caption',sans-serif,serif !important; font-weight: 300; font-size: 10pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

p { margin: 0 0 10px; }

p.indent:first-letter { padding-left: 25px; }

.lead { font-size: 120%; line-height: 26px; }

.tertiary-info-text, .tertiary-text { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #000; }

.tertiary-info-text:hover, .tertiary-text:hover { color: rgba(0,0,0,0.8); }

.tertiary-info-text:active, .tertiary-text:active { color: rgba(0,0,0,0.4); }

.tertiary-info-secondary-text, .tertiary-secondary-text { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: rgba(0,0,0,0.6); }

.tertiary-info-secondary-text:hover, .tertiary-secondary-text:hover { color: rgba(0,0,0,0.8); }

.tertiary-info-secondary-text:active, .tertiary-secondary-text:active { color: rgba(0,0,0,0.4); }

abbr.initialism { font-size: 90%; text-transform: uppercase !important; }

abbr[title] { cursor: help !important; }

address { display: block; margin-bottom: 20px; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; font-smooth: always; line-height: 20px; font-style: normal; }

blockquote { margin: 0; padding: 5px 20px; border-left: 4px #ccc solid; display: block; background-color: rgba(204,204,204,0.1); }

blockquote p { margin-bottom: 0; }

blockquote small:before { content: '\2014'; color: rgba(0,0,0,0.4); margin-right: 5px; }

blockquote.place-right { float: none !important; text-align: right; border: 0; border-right: 4px #ccc solid; }

blockquote.place-right small { text-align: right; }

blockquote.place-right small:before { content: ""; }

blockquote.place-right small:after { content: '\2014'; color: rgba(0,0,0,0.4); margin-left: 5px; }

ul, ol { padding: 0; margin: 0 0 10px 0; display: block; }

ul:nth-child(1) { margin-left: 25px; }

ul ul, ul ol, ol ol, ol ul { margin-bottom: 0 !important; }

ul { list-style-position: inside; list-style-type: square; }

ul ul { list-style-type: circle; }

ul, ol { list-style-position: inside; }

ul li, ol li { display: list-item; font-size: 14px; line-height: 20px; }

ol { list-style-type: decimal; }

ul.unstyled, ol.unstyled, .unstyled { margin-left: 0; list-style: none; }

.place-left { float: left !important; margin-right: 10px; }

.place-right { float: right !important; margin-left: 10px; }

.scroll-y, .scroll-vertical { overflow-y: scroll; }

.scroll-x, .scroll-horizontal { overflow-x: scroll; }

.pos-rel { position: relative; }

.pos-abs { position: absolute; }

.pos-fix { position: fixed; }

.text-left { text-align: left; }

.text-right { text-align: right; }

.text-center { text-align: center; }

.text-justify { text-align: justify; }

.top-left { position: absolute; top: 0; left: 0; }

.top-right { position: absolute; top: 0; right: 0; }

.bottom-right { position: absolute; bottom: 0; right: 0; }

.bottom-left { position: absolute; bottom: 0; left: 0; }

.no-overflow { overflow: hidden; }

.no-display { display: none; }

.as-block { display: block; float: none !important; }

.as-inline-block { display: inline-block; }

.nlm { margin-left: 0 !important; }

.nrm { margin-right: 0 !important; }

.clearfix {

  • zoom: 1;

}

.clearfix:before, .clearfix:after { display: table; content: ""; }

.clearfix:after { clear: both; }

.padding5 { padding: 5px; }

.padding10 { padding: 10px; }

.padding15 { padding: 15px; }

.padding20 { padding: 20px; }

.padding30 { padding: 30px; }

.padding40 { padding: 40px; }

.padding80 { padding: 80px; }

.selected { border: 4px #2d89ef solid; }

.selected:after { width: 0; height: 0; border-top: 40px solid #2d89ef; border-left: 40px solid transparent; position: absolute; display: block; right: 0; content: "."; top: 0; z-index: 1001; }

.selected:before { position: absolute; content: "\e08a"; color: #fff; right: 4px; font-family: iconFont; z-index: 1002; }

.border { border: 1px #ccc solid; }

@font-face { font-family: "iconFont"; src: url('../fonts/iconFont.eot'); src: url('../fonts/iconFont.eot?#iefix') format('embedded-opentype'),url('../fonts/iconFont.svg#iconFont') format('svg'),url('../fonts/iconFont.woff') format('woff'),url('../fonts/iconFont.ttf') format('truetype'); font-weight: normal; font-style: normal; }

[class^="icon-"], [class*=" icon-"] { font-family: "iconFont"; font-weight: normal; font-style: normal; text-decoration: inherit; -webkit-font-smoothing: antialiased; display: inline-block; width: auto; height: auto; line-height: normal; vertical-align: baseline; background-image: none; background-position: 0 0; background-repeat: repeat; margin-top: 0; position: relative; }

[class^="icon-"]:before, [class*=" icon-"]:before { text-decoration: inherit; display: inline-block; speak: none; }

a [class^="icon-"], a [class*=" icon-"] { display: inline-block; }

.icon-large:before { vertical-align: -10%; font-size: 1.3333333333333333em; }

a [class^="icon-"], button [class^="icon-"], .button [class^="icon-"], .page-control > ul > li [class^="icon-"], a [class*=" icon-"], button [class*=" icon-"], .button [class*=" icon-"], .page-control > ul > li [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

a [class^="icon-"].icon-large, button [class^="icon-"].icon-large, .button [class^="icon-"].icon-large, .page-control > ul > li [class^="icon-"].icon-large, a [class*=" icon-"].icon-large, button [class*=" icon-"].icon-large, .button [class*=" icon-"].icon-large, .page-control > ul > li [class*=" icon-"].icon-large { line-height: .9em; }

a.big [class^="icon-"], button.big [class^="icon-"], .button.big [class^="icon-"], .page-control > ul > li.big [class^="icon-"], a.big [class*=" icon-"], button.big [class*=" icon-"], .button.big [class*=" icon-"], .page-control > ul > li.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

li [class^="icon-"], li [class*=" icon-"] { display: inline-block; width: 1.2em; text-align: center; }

li [class^="icon-"].icon-large, li [class*=" icon-"].icon-large { width: 1.5625em; }

ol.icons { list-style-type: none; }

ol.icons li { line-height: 24px; }

ol.icons li [class^="icon-"], ol.icons li [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; }

.icon-muted { color: #eee; }

.icon-border { border: solid 1px #eee; padding: .2em .25em .15em; }

.icon-2x { font-size: 2em; }

.icon-2x.icon-border { border-width: 2px; }

.icon-3x { font-size: 3em; }

.icon-3x.icon-border { border-width: 3px; }

.icon-4x { font-size: 4em; }

.icon-4x.icon-border { border-width: 4px; }

a [class^="icon-"], button [class^="icon-"], .button [class^="icon-"], .page-control > ul > li [class^="icon-"], a [class*=" icon-"], button [class*=" icon-"], .button [class*=" icon-"], .page-control > ul > li [class*=" icon-"] { margin-right: 5px; }

a [class^="icon-"].right, button [class^="icon-"].right, .button [class^="icon-"].right, .page-control > ul > li [class^="icon-"].right, a [class*=" icon-"].right, button [class*=" icon-"].right, .button [class*=" icon-"].right, .page-control > ul > li [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar [class^="icon-"], .toolbar [class*=" icon-"] { margin: 0 !important; }

.image-button [class^="icon-"], .image-button [class*=" icon-"] { position: absolute; right: 0; margin-left: 32px; padding: 5px; height: 100%; top: 0; box-sizing: border-box; border: 1px transparent solid; z-index: 2; margin: 0; font-size: 16px; }

.shortcut > .icon [class^="icon-"], .shortcut > .icon [class*=" icon-"] { font-size: 32px; line-height: 32px; height: 32px; margin: 0 !important; }

.icon-home:before { content: "\e000"; }

.icon-newspaper:before { content: "\e001"; }

.icon-pencil:before { content: "\e002"; }

.icon-droplet:before { content: "\e003"; }

.icon-pictures:before { content: "\e004"; }

.icon-camera:before { content: "\e005"; }

.icon-music:before { content: "\e006"; }

.icon-film:before { content: "\e007"; }

.icon-camera-2:before { content: "\e008"; }

.icon-spades:before { content: "\e009"; }

.icon-clubs:before { content: "\e00a"; }

.icon-diamonds:before { content: "\e00b"; }

.icon-broadcast:before { content: "\e00c"; }

.icon-mic:before { content: "\e00d"; }

.icon-book:before { content: "\e00e"; }

.icon-file:before { content: "\e00f"; }

.icon-new:before { content: "\e010"; }

.icon-copy:before { content: "\e011"; }

.icon-folder:before { content: "\e012"; }

.icon-folder-2:before { content: "\e013"; }

.icon-tag:before { content: "\e014"; }

.icon-cart:before { content: "\e015"; }

.icon-basket:before { content: "\e016"; }

.icon-calculate:before { content: "\e017"; }

.icon-support:before { content: "\e018"; }

.icon-phone:before { content: "\e019"; }

.icon-mail:before { content: "\e01a"; }

.icon-location:before { content: "\e01b"; }

.icon-compass:before { content: "\e01c"; }

.icon-history:before { content: "\e01d"; }

.icon-clock:before { content: "\e01e"; }

.icon-bell:before { content: "\e01f"; }

.icon-calendar:before { content: "\e020"; }

.icon-printer:before { content: "\e021"; }

.icon-mouse:before { content: "\e022"; }

.icon-screen:before { content: "\e023"; }

.icon-laptop:before { content: "\e024"; }

.icon-mobile:before { content: "\e025"; }

.icon-cabinet:before { content: "\e026"; }

.icon-drawer:before { content: "\e027"; }

.icon-drawer-2:before { content: "\e028"; }

.icon-box:before { content: "\e029"; }

.icon-box-add:before { content: "\e02a"; }

.icon-box-remove:before { content: "\e02b"; }

.icon-download:before { content: "\e02c"; }

.icon-upload:before { content: "\e02d"; }

.icon-database:before { content: "\e02e"; }

.icon-flip:before { content: "\e02f"; }

.icon-flip-2:before { content: "\e030"; }

.icon-undo:before { content: "\e031"; }

.icon-redo:before { content: "\e032"; }

.icon-forward:before { content: "\e033"; }

.icon-reply:before { content: "\e034"; }

.icon-reply-2:before { content: "\e035"; }

.icon-comments:before { content: "\e036"; }

.icon-comments-2:before { content: "\e037"; }

.icon-comments-3:before { content: "\e038"; }

.icon-comments-4:before { content: "\e039"; }

.icon-comments-5:before { content: "\e03a"; }

.icon-user:before { content: "\e03b"; }

.icon-user-2:before { content: "\e03c"; }

.icon-user-3:before { content: "\e03d"; }

.icon-busy:before { content: "\e03e"; }

.icon-loading:before { content: "\e03f"; }

.icon-loading-2:before { content: "\e040"; }

.icon-search:before { content: "\e041"; }

.icon-zoom-in:before { content: "\e042"; }

.icon-zoom-out:before { content: "\e043"; }

.icon-key:before { content: "\e044"; }

.icon-key-2:before { content: "\e045"; }

.icon-locked:before { content: "\e046"; }

.icon-unlocked:before { content: "\e047"; }

.icon-wrench:before { content: "\e048"; }

.icon-equalizer:before { content: "\e049"; }

.icon-cog:before { content: "\e04a"; }

.icon-pie:before { content: "\e04b"; }

.icon-bars:before { content: "\e04c"; }

.icon-stats-up:before { content: "\e04d"; }

.icon-gift:before { content: "\e04e"; }

.icon-trophy:before { content: "\e04f"; }

.icon-diamond:before { content: "\e050"; }

.icon-coffee:before { content: "\e051"; }

.icon-rocket:before { content: "\e052"; }

.icon-meter-slow:before { content: "\e053"; }

.icon-meter-medium:before { content: "\e054"; }

.icon-meter-fast:before { content: "\e055"; }

.icon-dashboard:before { content: "\e056"; }

.icon-fire:before { content: "\e057"; }

.icon-lab:before { content: "\e058"; }

.icon-remove:before { content: "\e059"; }

.icon-briefcase:before { content: "\e05a"; }

.icon-briefcase-2:before { content: "\e05b"; }

.icon-cars:before { content: "\e05c"; }

.icon-bus:before { content: "\e05d"; }

.icon-cube:before { content: "\e05e"; }

.icon-cube-2:before { content: "\e05f"; }

.icon-puzzle:before { content: "\e060"; }

.icon-glasses:before { content: "\e061"; }

.icon-glasses-2:before { content: "\e062"; }

.icon-accessibility:before { content: "\e063"; }

.icon-accessibility-2:before { content: "\e064"; }

.icon-target:before { content: "\e065"; }

.icon-target-2:before { content: "\e066"; }

.icon-lightning:before { content: "\e067"; }

.icon-power:before { content: "\e068"; }

.icon-power-2:before { content: "\e069"; }

.icon-clipboard:before { content: "\e06a"; }

.icon-clipboard-2:before { content: "\e06b"; }

.icon-playlist:before { content: "\e06c"; }

.icon-grid-view:before { content: "\e06d"; }

.icon-tree-view:before { content: "\e06e"; }

.icon-cloud:before { content: "\e06f"; }

.icon-cloud-2:before { content: "\e070"; }

.icon-download-2:before { content: "\e071"; }

.icon-upload-2:before { content: "\e072"; }

.icon-upload-3:before { content: "\e073"; }

.icon-link:before { content: "\e074"; }

.icon-link-2:before { content: "\e075"; }

.icon-flag:before { content: "\e076"; }

.icon-flag-2:before { content: "\e077"; }

.icon-attachment:before { content: "\e078"; }

.icon-eye:before { content: "\e079"; }

.icon-bookmark:before { content: "\e07a"; }

.icon-bookmark-2:before { content: "\e07b"; }

.icon-star:before { content: "\e07c"; }

.icon-star-2:before { content: "\e07d"; }

.icon-star-3:before { content: "\e07e"; }

.icon-heart:before { content: "\e07f"; }

.icon-heart-2:before { content: "\e080"; }

.icon-thumbs-up:before { content: "\e081"; }

.icon-thumbs-down:before { content: "\e082"; }

.icon-plus:before { content: "\e083"; }

.icon-minus:before { content: "\e084"; }

.icon-help:before { content: "\e085"; }

.icon-help-2:before { content: "\e086"; }

.icon-blocked:before { content: "\e087"; }

.icon-cancel:before { content: "\e088"; }

.icon-cancel-2:before { content: "\e089"; }

.icon-checkmark:before { content: "\e08a"; }

.icon-minus-2:before { content: "\e08b"; }

.icon-plus-2:before { content: "\e08c"; }

.icon-enter:before { content: "\e08d"; }

.icon-exit:before { content: "\e08e"; }

.icon-loop:before { content: "\e08f"; }

.icon-arrow-up-left:before { content: "\e090"; }

.icon-arrow-up:before { content: "\e091"; }

.icon-arrow-up-right:before { content: "\e092"; }

.icon-arrow-right:before { content: "\e093"; }

.icon-arrow-down-right:before { content: "\e094"; }

.icon-arrow-down:before { content: "\e095"; }

.icon-arrow-down-left:before { content: "\e096"; }

.icon-arrow-left:before { content: "\e097"; }

.icon-arrow-up-2:before { content: "\e098"; }

.icon-arrow-right-2:before { content: "\e099"; }

.icon-arrow-down-2:before { content: "\e09a"; }

.icon-arrow-left-2:before { content: "\e09b"; }

.icon-arrow-up-3:before { content: "\e09c"; }

.icon-arrow-right-3:before { content: "\e09d"; }

.icon-arrow-down-3:before { content: "\e09e"; }

.icon-arrow-left-3:before { content: "\e09f"; }

.icon-menu:before { content: "\e0a0"; }

.icon-enter-2:before { content: "\e0a1"; }

.icon-backspace:before { content: "\e0a2"; }

.icon-backspace-2:before { content: "\e0a3"; }

.icon-tab:before { content: "\e0a4"; }

.icon-tab-2:before { content: "\e0a5"; }

.icon-checkbox:before { content: "\e0a6"; }

.icon-checkbox-unchecked:before { content: "\e0a7"; }

.icon-checkbox-partial:before { content: "\e0a8"; }

.icon-radio-checked:before { content: "\e0a9"; }

.icon-radio-unchecked:before { content: "\e0aa"; }

.icon-font:before { content: "\e0ab"; }

.icon-paragraph-left:before { content: "\e0ac"; }

.icon-paragraph-center:before { content: "\e0ad"; }

.icon-paragraph-right:before { content: "\e0ae"; }

.icon-paragraph-justify:before { content: "\e0af"; }

.icon-left-to-right:before { content: "\e0b0"; }

.icon-right-to-left:before { content: "\e0b1"; }

.icon-share:before { content: "\e0b2"; }

.icon-new-tab:before { content: "\e0b3"; }

.icon-new-tab-2:before { content: "\e0b4"; }

.icon-embed:before { content: "\e0b5"; }

.icon-code:before { content: "\e0b6"; }

.icon-bluetooth:before { content: "\e0b7"; }

.icon-share-2:before { content: "\e0b8"; }

.icon-share-3:before { content: "\e0b9"; }

.icon-mail-2:before { content: "\e0ba"; }

.icon-google:before { content: "\e0bb"; }

.icon-google-plus:before { content: "\e0bc"; }

.icon-google-drive:before { content: "\e0bd"; }

.icon-facebook:before { content: "\e0be"; }

.icon-instagram:before { content: "\e0bf"; }

.icon-twitter:before { content: "\e0c0"; }

.icon-feed:before { content: "\e0c1"; }

.icon-youtube:before { content: "\e0c2"; }

.icon-vimeo:before { content: "\e0c3"; }

.icon-flickr:before { content: "\e0c4"; }

.icon-picassa:before { content: "\e0c5"; }

.icon-dribbble:before { content: "\e0c6"; }

.icon-deviantart:before { content: "\e0c7"; }

.icon-github:before { content: "\e0c8"; }

.icon-github-2:before { content: "\e0c9"; }

.icon-github-3:before { content: "\e0ca"; }

.icon-github-4:before { content: "\e0cb"; }

.icon-github-5:before { content: "\e0cc"; }

.icon-git:before { content: "\e0cd"; }

.icon-github-6:before { content: "\e0ce"; }

.icon-wordpress:before { content: "\e0cf"; }

.icon-joomla:before { content: "\e0d0"; }

.icon-blogger:before { content: "\e0d1"; }

.icon-tumblr:before { content: "\e0d2"; }

.icon-yahoo:before { content: "\e0d3"; }

.icon-amazon:before { content: "\e0d4"; }

.icon-tux:before { content: "\e0d5"; }

.icon-apple:before { content: "\e0d6"; }

.icon-finder:before { content: "\e0d7"; }

.icon-android:before { content: "\e0d8"; }

.icon-windows:before { content: "\e0d9"; }

.icon-soundcloud:before { content: "\e0da"; }

.icon-skype:before { content: "\e0db"; }

.icon-reddit:before { content: "\e0dc"; }

.icon-linkedin:before { content: "\e0dd"; }

.icon-lastfm:before { content: "\e0de"; }

.icon-delicious:before { content: "\e0df"; }

.icon-stumbleupon:before { content: "\e0e0"; }

.icon-pinterest:before { content: "\e0e1"; }

.icon-xing:before { content: "\e0e2"; }

.icon-flattr:before { content: "\e0e3"; }

.icon-foursquare:before { content: "\e0e4"; }

.icon-paypal:before { content: "\e0e5"; }

.icon-yelp:before { content: "\e0e6"; }

.icon-libreoffice:before { content: "\e0e7"; }

.icon-file-pdf:before { content: "\e0e8"; }

.icon-file-openoffice:before { content: "\e0e9"; }

.icon-file-word:before { content: "\e0ea"; }

.icon-file-excel:before { content: "\e0eb"; }

.icon-file-powerpoint:before { content: "\e0ec"; }

.icon-file-zip:before { content: "\e0ed"; }

.icon-file-xml:before { content: "\e0ee"; }

.icon-file-css:before { content: "\e0ef"; }

.icon-html5:before { content: "\e0f0"; }

.icon-html5-2:before { content: "\e0f1"; }

.icon-css3:before { content: "\e0f2"; }

.icon-chrome:before { content: "\e0f3"; }

.icon-firefox:before { content: "\e0f4"; }

.icon-IE:before { content: "\e0f5"; }

.icon-opera:before { content: "\e0f6"; }

.icon-safari:before { content: "\e0f7"; }

.icon-IcoMoon:before { content: "\e0f8"; }

.icon-sunrise:before { content: "\e0f9"; }

.icon-sun:before { content: "\e0fa"; }

.icon-moon:before { content: "\e0fb"; }

.icon-sun-2:before { content: "\e0fc"; }

.icon-windy:before { content: "\e0fd"; }

.icon-wind:before { content: "\e0fe"; }

.icon-snowflake:before { content: "\e0ff"; }

.icon-cloudy:before { content: "\e100"; }

.icon-cloud-3:before { content: "\e101"; }

.icon-weather:before { content: "\e102"; }

.icon-weather-2:before { content: "\e103"; }

.icon-weather-3:before { content: "\e104"; }

.icon-lines:before { content: "\e105"; }

.icon-cloud-4:before { content: "\e106"; }

.icon-lightning-2:before { content: "\e107"; }

.icon-lightning-3:before { content: "\e108"; }

.icon-rainy:before { content: "\e109"; }

.icon-rainy-2:before { content: "\e10a"; }

.icon-windy-2:before { content: "\e10b"; }

.icon-windy-3:before { content: "\e10c"; }

.icon-snowy:before { content: "\e10d"; }

.icon-snowy-2:before { content: "\e10e"; }

.icon-snowy-3:before { content: "\e10f"; }

.icon-weather-4:before { content: "\e110"; }

.icon-cloudy-2:before { content: "\e111"; }

.icon-cloud-5:before { content: "\e112"; }

.icon-lightning-4:before { content: "\e113"; }

.icon-sun-3:before { content: "\e114"; }

.icon-moon-2:before { content: "\e115"; }

.icon-cloudy-3:before { content: "\e116"; }

.icon-cloud-6:before { content: "\e117"; }

.icon-cloud-7:before { content: "\e118"; }

.icon-lightning-5:before { content: "\e119"; }

.icon-rainy-3:before { content: "\e11a"; }

.icon-rainy-4:before { content: "\e11b"; }

.icon-windy-4:before { content: "\e11c"; }

.icon-windy-5:before { content: "\e11d"; }

.icon-snowy-4:before { content: "\e11e"; }

.icon-snowy-5:before { content: "\e11f"; }

.icon-weather-5:before { content: "\e120"; }

.icon-cloudy-4:before { content: "\e121"; }

.icon-lightning-6:before { content: "\e122"; }

.icon-thermometer:before { content: "\e123"; }

.icon-compass-2:before { content: "\e124"; }

.icon-none:before { content: "\e125"; }

.icon-Celsius:before { content: "\e126"; }

.icon-Fahrenheit:before { content: "\e127"; }

.icon-forrst:before { content: "\e128"; }

.icon-headphones:before { content: "\e129"; }

.icon-bug:before { content: "\e12a"; }

.icon-cart-2:before { content: "\e12b"; }

.icon-earth:before { content: "\e12c"; }

.icon-battery:before { content: "\e12d"; }

.icon-list:before { content: "\e12e"; }

.icon-grid:before { content: "\e12f"; }

.icon-alarm:before { content: "\e130"; }

.icon-location-2:before { content: "\e131"; }

.icon-pointer:before { content: "\e132"; }

.icon-diary:before { content: "\e133"; }

.icon-eye-2:before { content: "\e134"; }

.icon-console:before { content: "\e135"; }

.icon-location-3:before { content: "\e136"; }

.icon-move:before { content: "\e137"; }

.icon-gift-2:before { content: "\e138"; }

.icon-monitor:before { content: "\e139"; }

.icon-mobile-2:before { content: "\e13a"; }

.icon-switch:before { content: "\e13b"; }

.icon-star-4:before { content: "\e13c"; }

.icon-address-book:before { content: "\e13d"; }

.icon-shit:before { content: "\e13e"; }

.icon-cone:before { content: "\e13f"; }

.icon-credit-card:before { content: "\e140"; }

.icon-type:before { content: "\e141"; }

.icon-volume:before { content: "\e142"; }

.icon-volume-2:before { content: "\e143"; }

.icon-locked-2:before { content: "\e144"; }

.icon-warning:before { content: "\e145"; }

.icon-info:before { content: "\e146"; }

.icon-filter:before { content: "\e147"; }

.icon-bookmark-3:before { content: "\e148"; }

.icon-bookmark-4:before { content: "\e149"; }

.icon-stats:before { content: "\e14a"; }

.icon-compass-3:before { content: "\e14b"; }

.icon-keyboard:before { content: "\e14c"; }

.icon-award-fill:before { content: "\e14d"; }

.icon-award-stroke:before { content: "\e14e"; }

.icon-beaker-alt:before { content: "\e14f"; }

.icon-beaker:before { content: "\e150"; }

.icon-move-vertical:before { content: "\e151"; }

.icon-move-horizontal:before { content: "\e153"; }

.icon-steering-wheel:before { content: "\e152"; }

.icon-volume-3:before { content: "\e154"; }

.icon-volume-mute:before { content: "\e155"; }

.icon-play:before { content: "\e156"; }

.icon-pause:before { content: "\e157"; }

.icon-stop:before { content: "\e158"; }

.icon-eject:before { content: "\e159"; }

.icon-first:before { content: "\e15a"; }

.icon-last:before { content: "\e15b"; }

.icon-play-alt:before { content: "\e15c"; }

.icon-battery-empty:before { content: "\e15d"; }

.icon-battery-half:before { content: "\e15e"; }

.icon-battery-full:before { content: "\e15f"; }

.icon-battery-charging:before { content: "\e160"; }

.icon-left-quote:before { content: "\e161"; }

.icon-right-quote:before { content: "\e162"; }

.icon-left-quote-alt:before { content: "\e163"; }

.icon-right-quote-alt:before { content: "\e164"; }

.icon-smiley:before { content: "\e165"; }

.icon-umbrella:before { content: "\e166"; }

.icon-info-2:before { content: "\e167"; }

.icon-chart-alt:before { content: "\e168"; }

.icon-save:before { content: "\e169"; }

.fg-color-blue { color: #2d89ef !important; }

.fg-color-blueLight { color: #eff4ff !important; }

.fg-color-blueDark { color: #2b5797 !important; }

.fg-color-green { color: #00a300 !important; }

.fg-color-greenLight { color: #99b433 !important; }

.fg-color-greenDark { color: #1e7145 !important; }

.fg-color-red { color: #b91d47 !important; }

.fg-color-yellow { color: #ffc40d !important; }

.fg-color-orange { color: #e3a21a !important; }

.fg-color-orangeDark { color: #da532c !important; }

.fg-color-pink { color: #9f00a7 !important; }

.fg-color-pinkDark { color: #7e3878 !important; }

.fg-color-purple { color: #603cba !important; }

.fg-color-darken { color: #1d1d1d !important; }

.fg-color-lighten { color: #d5e7ec !important; }

.fg-color-white { color: #fff !important; }

.fg-color-grayDark { color: #525252 !important; }

.fg-color-magenta { color: #ff0097 !important; }

.fg-color-teal { color: #00aba9 !important; }

.fg-color-redLight { color: #e11 !important; }

.bg-color-blue { background-color: #2d89ef !important; }

.bg-color-blueLight { background-color: #eff4ff !important; }

.bg-color-blueDark { background-color: #2b5797 !important; }

.bg-color-green { background-color: #00a300 !important; }

.bg-color-greenLight { background-color: #99b433 !important; }

.bg-color-greenDark { background-color: #1e7145 !important; }

.bg-color-red { background-color: #b91d47 !important; }

.bg-color-yellow { background-color: #ffc40d !important; }

.bg-color-orange { background-color: #e3a21a !important; }

.bg-color-orangeDark { background-color: #da532c !important; }

.bg-color-pink { background-color: #9f00a7 !important; }

.bg-color-pinkDark { background-color: #7e3878 !important; }

.bg-color-purple { background-color: #603cba !important; }

.bg-color-darken { background-color: #1d1d1d !important; }

.bg-color-lighten { background-color: #d5e7ec !important; }

.bg-color-white { background-color: #fff !important; }

.bg-color-grayDark { background-color: #525252 !important; }

.bg-color-magenta { background-color: #ff0097 !important; }

.bg-color-teal { background-color: #00aba9 !important; }

.bg-color-redLight { background-color: #e11 !important; }

[class*=border-color] { border: 2px solid; }

.border-color-blue { border-color: #2d89ef !important; }

.border-color-blueLight { border-color: #eff4ff !important; }

.border-color-blueDark { border-color: #2b5797 !important; }

.border-color-green { border-color: #00a300 !important; }

.border-color-greenLight { border-color: #99b433 !important; }

.border-color-greenDark { border-color: #1e7145 !important; }

.border-color-red { border-color: #b91d47 !important; }

.border-color-yellow { border-color: #ffc40d !important; }

.border-color-orange { border-color: #e3a21a !important; }

.border-color-orangeDark { border-color: #da532c !important; }

.border-color-pink { border-color: #9f00a7 !important; }

.border-color-pinkDark { border-color: #7e3878 !important; }

.border-color-purple { border-color: #603cba !important; }

.border-color-darken { border-color: #1d1d1d !important; }

.border-color-lighten { border-color: #d5e7ec !important; }

.border-color-white { border-color: #fff !important; }

.border-color-grayDark { border-color: #525252 !important; }

.border-color-magenta { border-color: #ff0097 !important; }

.border-color-teal { border-color: #00aba9 !important; }

.border-color-redLight { border-color: #e11 !important; }

  • hover[class=outline-color] {

outline: 3px solid; }

.outline-color-blue { outline-color: #2d89ef !important; }

.outline-color-blueLight { outline-color: #eff4ff !important; }

.outline-color-blueDark { outline-color: #2b5797 !important; }

.outline-color-green { outline-color: #00a300 !important; }

.outline-color-greenLight { outline-color: #99b433 !important; }

.outline-color-greenDark { outline-color: #1e7145 !important; }

.outline-color-red { outline-color: #b91d47 !important; }

.outline-color-yellow { outline-color: #ffc40d !important; }

.outline-color-orange { outline-color: #e3a21a !important; }

.outline-color-orangeDark { outline-color: #da532c !important; }

.outline-color-pink { outline-color: #9f00a7 !important; }

.outline-color-pinkDark { outline-color: #7e3878 !important; }

.outline-color-purple { outline-color: #603cba !important; }

.outline-color-darken { outline-color: #1d1d1d !important; }

.outline-color-lighten { outline-color: #d5e7ec !important; }

.outline-color-white { outline-color: #fff !important; }

.outline-color-grayDark { outline-color: #525252 !important; }

.outline-color-magenta { outline-color: #ff0097 !important; }

.outline-color-teal { outline-color: #00aba9 !important; }

.outline-color-redLight { outline-color: #e11 !important; }

.item-margin { margin: 0 10px 10px 0; }

.column-margin { margin: 0 20px 10px 0; }

.group-margin { margin: 0 80px 10px 0; }

.brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; }

.short-brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 150px; height: 150px; }

.medium-brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 310px; height: 150px; }

.square { display: block; float: left; margin-right: 10px; height: 20px; width: 20px; }

  • , *:after, *:before {

-webkit-box-sizing: border-box; -moz-box-sizing: border-box; box-sizing: border-box; }

.one-column { -moz-columns: 1; -webkit-columns: 1; columns: 1; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.two-columns { -moz-columns: 2; -webkit-columns: 2; columns: 2; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.three-columns { -moz-columns: 3; -webkit-columns: 3; columns: 3; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.four-columns { -moz-columns: 4; -webkit-columns: 4; columns: 4; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.five-columns { -moz-columns: 5; -webkit-columns: 5; columns: 5; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

  1. bodyContent {

height: 100%; min-height: 100%; width: 100%;

  • zoom: 1;

}

.page:before, .page:after { display: table; content: ""; }

.page:after { clear: both; }

  1. bodyContent .page-header {

width: 100%; position: relative; display: block; }

  1. bodyContent .page-header .page-header-content {

height: 100px; min-height: 100px; width: 100%; position: relative; display: block; }

  1. bodyContent .page-header .page-header-content h1, #bodyContent .page-header .page-header-content h2, #bodyContent .page-header .page-header-content h3, #bodyContent .page-header .page-header-content h4, #bodyContent .page-header .page-header-content h5 {

position: absolute; margin: 0; padding: 0; left: 20px; bottom: 0; }

  1. bodyContent .page-header .page-header-content h1 small {

font-size: 12pt; margin-left: 5px; }

  1. bodyContent .page-header .page-header-content h1.sub-menu {

cursor: pointer; }

  1. bodyContent .page-header .page-header-content h1.sub-menu:after {

position: absolute; content: "\3009"; display: inline-block; font-size: 10pt; bottom: -5px; right: -15px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); }

  1. bodyContent .page-header .page-header-content > .page-back {

position: absolute; top: 34px; left: 30px; }

  1. bodyContent .page-header .page-header-content .user-login {

float: right; margin: 55px 44px 0 0; cursor: pointer; }

  1. bodyContent .page-header .page-header-content .user-login .avatar {

float: right; border: 1px #ccc solid; width: 40px; height: 40px; }

  1. bodyContent .page-header .page-header-content .user-login .avatar img, #bodyContent .page-header .page-header-content .user-login .avatar [class^="icon-"], #bodyContent .page-header .page-header-content .user-login .avatar [class*=" icon-"] {

width: 100%; height: 100%; }

  1. bodyContent .page-header .page-header-content .user-login .avatar [class^="icon-"], #bodyContent .page-header .page-header-content .user-login .avatar [class*=" icon-"] {

margin-top: 2px; font-size: 30px; line-height: 30px; display: block; }

  1. bodyContent .page-header .page-header-content .user-login .name {

float: left; margin: -5px 10px 0; text-align: right; }

  1. bodyContent .page-header .page-header-content .user-login .name .first-name {

font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; display: block; margin: 0; }

  1. bodyContent .page-header .page-header-content .user-login .name .last-name {

font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; display: block; margin: 0; }

  1. bodyContent .page-region {

display: block; }

  1. bodyContent .page-region .page-region-content {

padding-top: 10px; padding-left: 0; padding-right: 0; padding-bottom: 20px; display: block; height: 100%; position: relative; }

.page.secondary .page-header .page-header-content h1, .page.secondary .page-header .page-header-content h2, .page.secondary .page-header .page-header-content h3, .page.secondary .page-header .page-header-content h4, .page.secondary .page-header .page-header-content h5 { position: absolute; margin: 0; padding: 0; left: 120px; bottom: 0; }

.page.secondary .page-region .page-region-content { padding-left: 120px; }

.page.snapped { width: 33.33%; height: 100%; float: left; border-right: 1px #ccc solid; }

.page.fill { width: 66.66%; height: 100%; float: right; border-left: 1px #ccc solid; }

.page.snapped #bodyContent .page-header .page-header-content h1, .page.snapped #bodyContent .page-header .page-header-content h2, .page.snapped #bodyContent .page-header .page-header-content h3, .page.snapped #bodyContent .page-header .page-header-content h4, .page.snapped #bodyContent .page-header .page-header-content h5 { margin-left: 20px; }

.page.snapped #bodyContent .page-region .page-region-content { padding-left: 20px; }

.page.fixed-header .page-header { position: fixed; top: 0; left: 0; right: 0; }

.page.fixed-header .page-region { padding-top: 140px; }

.page.with-sidebar .page-region { margin-left: 220px; width: auto;

  • zoom: 1;

}

.page.with-sidebar .page-region .page-region-content { padding-left: 20px; }

.page.with-sidebar .page-region:before, .page.with-sidebar .page-region:after { display: table; content: ""; }

.page.with-sidebar .page-region:after { clear: both; }

.app-bar { position: fixed; bottom: 0; left: 0; right: 0; min-height: 100px; background-color: #1d1d1d !important; }

.charms { position: fixed; right: 0; top: 0; bottom: 0; height: 100%; min-width: 200px; width: auto; }

.charms.place-left { left: 0; right: auto; }

.message-dialog { position: fixed; left: 0; right: 0; height: auto; min-height: 100px; top: 30%; padding: 10px 10px 0; }

.error-bar, .warning-bar, .info-bar { position: fixed; top: 0; left: 0; right: 0; padding: 10px 20px; color: #fff; min-height: 100px; }

.error-bar { background-color: #b91d47 !important; }

.warning-bar { background-color: #ffc40d !important; }

.info-bar { background-color: #2d89ef !important; }

.modern-ui-logo, .metro-ui-logo { height: 28px; width: 28px; display: block; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAGESURBVFhH7ZevTsNQFIfbZgKxB9gjIHgABAIcS0CSQIJE4LEIEgQCyQNMIiHhIRAgEAgECWKIySUTCEjLd3t/Cyml3em6DtMvOTn33PM3XdvbBU2SJMmKlssnjuNtZIisa2t50HQNmXAFEvQHsi9X89CzR8M31/wXZwppDpp0aX7v++XBd41q7r5Qg1I0YE8pQYixqbWFpzAMx1pnoPA5vlOZpdDzHdWPoujZGVX4c1iaH8pvhpwJshOpxtxQawM18JYdrlYXdbKIAa4o1pFphrxX8g5qD0CRPsUeZZogfkzeLjJaxAAjZIuit9oqhbgv4veQl+lGFQqfGHwdbqpLH1YMMUdK8WjfysxHlgbHyKfiM7B/obAf5LNiemfQyB1E6VkwBfsGlb9ZvduM+aVFQ3cgDV0S+gHlHrs8LqAC5gEcxLuD6c5pbeVJy9qpNECLCV1aK+lPwO86kD0TF5s2KqD2m7Au7QDtAO0A7QD/PsBcf0zIWWVdfMRmcd+M/vsvRxB8A6+/IU2N93KYAAAAAElFTkSuQmCC); -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; background-size: cover; }

.back-button { height: 32px; width: 32px; display: block; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAbrSURBVGhDzZpPaBRXHMdnZkMJsocchO4hJhYsBAm9GEVxYyJ4ULSQoEIpuQQqeOghpUorIlWsKNQSCx56KQgKFhQSUVBoS02yMYKR9hCk0FCN7mELOaSYSg7ZnX6+b94uyWY3zmw3u/lCMvP+zHvf7+/93m/ee7OuUyV07d69M+d53a7vv+u4brPvOAnH95tNoetm6ChDOu277t9eLpdyGhpSIyMji6b8f6BiAV1dXY3ZbLbbc5zDkN3vQtoWhYLv+7M88yDn+3disdgDxMzbokiILADiDblcrg8GFyGQsNkGCJmiwSnKMrI0WZmgxEnYkUlQZwt1Omy+AWLmKDvned73CFmw2aEQSUAymTwE6Ys81K40HS+SfgipO3Q+TOdpU/EtwAgbMUIP7RykDY1eo/K5n6atc6lU6oapGAKhBNBh3M/lrnPbo7Qh7jg33FjsFKTzVq4ItN3kZ7OnIf5pQYjjpDDI0TBtv1UAHTRjrft5q4Nh1/NE/A+brgrUD0LOQ74PIQ0YKc1k7x159GjSVimJVQWYyOK6QzSYoMEFGj8WZXgrAW66D1K36LOJPudtnz/a4hUoK8CS/4mG4jSU8Xy/d2R8/LEtXlMwGm25bFaGa1MaEf1jY2PXTGERSgowbpPNPjGWJ6rgjwfCTtBqQXMD170LwaRGHwPuLWXAFQJ4MM6DExS0G8vHYttrTT4PwyUwZFs5LryHlkPRxpKX6t56kRfoex7SH8JFL70Ehh1CVIMtNlgmQHGeSxAqmTy18vnVgIhpDHkUEQrdHYj4xBYZFFxIyij8TdYnOTw6NtYblKwP7EkmB3lbD1hXel+jo/zCCEC+z7rOouK8zV434KV5AW5z1pVO2OxgBLB+I5PluQp5zV4bTaX6TWkF2LFjRzPtFPz09evXs8+ePatooVaMzs7OsxD+CiGaGxqFjBkBrSpF3lif5YGpXQE6OjoGsM4r2ntu/7T8qBoI55fgqAmtSGnmqhHAv8O6UvBQqnQfFSLPZTBIGaTevHlzoFrWF+C2wAgM656r4WwEEHH22+sdXaOiFuTzyFmOjERS7wlPSwYsbzYjWhLrGgW1JC+w+flZcwDO2lAd8rQNVIGWDAxRpJdWrckLxo1wdd3jPl2e2SkBfGpK17CoB/kCfD9YyhN4PP4Fe1leEOYaAnUlD+x2VV7T7BJbx7B+ksQplqyXTI1VUExeoZfLFf7+NRlVwNOnT8/a25JgydPnue51+k67ncmkXmCbEVB2zZ1HCcuvCSYnJ7FpeRB4un3P+1X3CqPmrWktuSqo02pv1w3kQlr772QETjICl21+WWzbtm2QEdNIGCBKxyBX+aulC32EC92k74y7p7NziLwemFxmDXQyqLI6EPElIi7apFDTSYzRBzD6IEb/3YN4EPu1kAsJLKTJ/lmQMkhu2LDh/tatW+M2vaZYEvrT3pKQZDbQYcFEU+SpjwjX3WKu2huYg1blEWRYW2w0BSFRDxHaeOH7+3SP8cc9nRKTMauM/BI1Cmotwi79dWa0yNrtnsfaQuebD1TIKBw0tSKiliKI+wFH130M91mznNYRt66o2s8QNek+KmohwriP4xyxScPZCND5POS132zUQavyKoFE0MZ22tpr/87E4/GKDFIKuPhx2m+mXbnPbeXhNQGIrSdIfEPhgt1v1u08qBS0eWHf/icCtG+/wjvLjLYZAQFFVyH/wo7CeZu9bqCTCJGH45xOKGy2E7NXZ2ZmZrG1tfUfRqEHP2tvaWmZePny5V+2uK7o2rWrnZD5AwLeYfJeGB0dNUFHKIyAoNUo5FNUbEDILYYt0sttLQCHRC4WuwsnnZJP4ynL1mvLBAhU0DFemgeadMRdaVSqBhR1cB19K9gMp3kvm9VZ7bJvaCsEUCGjLyN6gAfb/OBAde2XB0UQefq+iScklcYz+kcmJlZse1cIEPRZhweO2WS3jrhpMFh/1AD0peNDbViCmO/7X6dSKRM2i1GYxMVgAk+1tLbO8LC+Iiawxsfvbdr0ZObVqxe2yppAEzbnOL/Q5wcmA/KEzDPmvgQK74FyKPpOpiPuqwpjeo3bKlWB3FShEsKf05cmrL6P9ZezfB5vFSDQuL5UDlHZfKCmcX2Y/o4Jf6l4UkWFfJ22j9PoaRlJebQ/bSZsCZ8vRigBQpmOZmlgWMd9OjELK0ZtaVXJBDyIlY/QnjnasYb5VqEybFuhBeRB5/r4NkBvX9Cx+TAtaMhJP+RmSpsk0pmYPWvKIlii7c8NtlC2j3QhPJOu2DUjC8gDIYoU+rnAYQgkl4oJA5HWkphb/UzhNsQrCg4VC1gKxMTNQSu3kNKn2WYYyup518iQr5/cpEnohyDjkL4X1dor4Tj/AaxI26ezfxeLAAAAAElFTkSuQmCC); -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; background-size: cover; }

.back-button.big { height: 48px; width: 48px; left: 36px; top: 40px; }

.back-button.white { background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAVESURBVGhDzZoxiFRJEIZ3hg0MNjAQnGADAw+EMzAw2EBxMzcw8MBgL9vQcA82EDRQLlgDRY9DEAwu8OCSAw/2QI8NDPQwuEDFQEThghUcUVBQUFB2/f7uej39Zt7M9NuZ92Z/qO3uqu6q6nnV/fpVb2NqTNjc3JxrNBrzW1tbe2nOQi0rhbbRS+g1/e5T3qf8SjkZ4OgunF6AbkAbtEuBMW+gm9ApmjOmtnpgbBpawvArOTIOoOsdtEx1l5lJRqkQwsgJilUe/UHP6QDjCo870GOoTZ8sZCRr0W6ppPk9tEB7v2QxkL+guNBsNn/3nDEBxTM4f4syB3jPKc5THrauyWDcAegMYx9KVwx49yg02dGBslnoiVftQVvxq0c+bd1GAnoUkv875QbaG1DpHyYHFMxBIdapf4FWqe62LmMDOrUprECfnDFA/QO0aF3KgYFy/oPpypRpDVQKs9u9QSyZOA0oUNjEv7xi/YCJKwe2Wtj8zxkH1D9BcyYeDPprwYaYN+f3mLg2YFN+PHBOAOqvoOzF2B90CrsNdYVQbb98N7CtJxFektT1VPpvHHQ44bu6zlqwlcf8MODDYShei6dNlAeyaYRx6KyaaOKQ0+aW/NLaDEeP8CaGqZX+m9Xf8qb8DnqvdgqkFFpmTPcjvg5Pb+VtA706vjxBTxbOF6ift7rroD043nWWTZQEhmjB6e2ZQ1k9g4C6k16r06uQ6rypYSx4kRNq10l+w9K3cuczoPOuqZf+zlqgccP4QufRDAF9a3NeQPWSt+BsrBvbTSDeqpLOH3St1XkB9Xu8FWdHR44ZOT/nWY65YX0Hgq61O58htkt9sclqnjeZoPP8QDBOu81txh0xlgO8nzjHX7VmlfjHSuFYE8P6hs2gj5G+2AHOC4+sFFpN/sTni7779Q5xXoh9nG0opiKnjlJXxiCHAc5fhfeLNavAZ/TnflT8nYXn1ir2X4oRfwntc70iwCtcsHUAu3fNjRxM7KAQCi8t2j15Gnhr3b/8ToIm4DIHhqLz9rWiiU0K+BKOENTbWgO3+IVPGu8H6n9ZPYA+pyj+QJY7YqDgT4qPvjV+YO8ZdNGaDtg8RPHQ6o/k3K9UHKgXn7WBJgF9sa4OtLU26suqAWzG57Y1hdBrL3JQ0qkQbJX6tX9kXAgnfp0jtG9DdU4iTqq19RiUkHVgRs9N0Bf0meiTwNa6t+qwpAnoS+yNbzsM/Qae1CSkP7NrpU820LgppuGMYw4BY2qfBPoXvSVvy9jeGeNL4FZ4CjQOqm0S6I4zJivGDo/mnRc5JGfCGFfLJNAXr1XZy58aYK54seug40Vyrp7+lU8CfXGS64qxO4CvD/twLqLeeUQJoH9lk5Bur9HpVKQUZwoRxN+c6fnICoEP+6GwS1I/Z6Ji0EG/mgN1pVrGc9GwDWBba7M7Tzs4tOlQlI8sfXc1KrCp99OacwJQV3q/52qrEHTszkdqAdX2JLClXz44L9DWgTIdDAgvDYH26Fc+CcCGYr77SutnE5cDY3V31X3lo0RrcuauDNCtnSw+1mzf+Qwo6Lnyof2UIvuGGBnomkdn2OcF2vqxyoVNP6BIV07hyicDPOUqtfWWvsFhjOJ8ESq8voWSFmxIrw8DepXi1gfPWb4DehY0MmUzlHRS3kaZhDbfEOGimyK76JZjx6H5gi88pfMvw78EffbcMQMjuyFdboe1MSrQpdugK1Tru4vDmN4Xp6H17UzGnL4H6QzWk85JRXIIDQIOKPGl+7RjkMLE/bsNYeCyHMhcSEEKKf0fxb+Uf1O+pRwBU1PfACwo53PCh30zAAAAAElFTkSuQmCC); }

button, .button { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; text-align: center; vertical-align: middle !important; min-width: 90px; min-height: 32px; height: 32px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; cursor: pointer; width: auto;

  • zoom: 1;

}

button:before, .button:before, button:after, .button:after { display: table; content: ""; }

button:after, .button:after { clear: both; }

button.standart, .button.standart { min-width: 90px; min-height: 32px; }

button:active, .button:active, button.default:active, .button.default:active { top: 1px; left: 1px; }

button:disabled, .button:disabled, button.disabled, .button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

button.default, .button.default { background-color: #008287; color: #fff; }

button:focus, .button:focus { outline: 0; border: 1px #353535 dotted; }

a.button:hover, a.button:active { color: inherit; }

a.button.big { padding: 14px 10px; }

button.mini, .button.mini, .tool-button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

button.big, .button.big, .tool-button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.tool-button.mini { min-width: 22px; width: 22px; }

.tool-button.big { min-width: 48px; width: 48px; }

.command-button { display: inline-block; width: 330px; text-align: left; padding: 10px 20px; height: auto; color: #000; background-color: #ccc; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

.command-button > small { display: block; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; font-size: 10pt; color: #505050; }

.command-button.default > small { color: #ccc; }

.tool-button { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; cursor: pointer; width: auto;

  • zoom: 1;

min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; }

.tool-button [class^="icon-"], .tool-button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.tool-button [class^="icon-"].icon-large, .tool-button [class*=" icon-"].icon-large { line-height: .9em; }

.tool-button.big [class^="icon-"], .tool-button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.tool-button [class^="icon-"], .tool-button [class*=" icon-"] { margin-right: 5px; }

.tool-button [class^="icon-"].right, .tool-button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.tool-button:before, .tool-button:after { display: table; content: ""; }

.tool-button:after { clear: both; }

.tool-button.standart { min-width: 90px; min-height: 32px; }

.tool-button:active, .tool-button.default:active { top: 1px; left: 1px; }

.tool-button:disabled, .tool-button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.tool-button.default { background-color: #008287; color: #fff; }

.tool-button:focus { outline: 0; border: 1px #353535 dotted; }

.tool-button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.tool-button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.tool-button img { width: 16px; height: 16px; top: 8px; }

.toolbar {

  • zoom: 1;

}

.toolbar a, .toolbar button { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; cursor: pointer; width: auto;

  • zoom: 1;

min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; margin-right: 0; }

.toolbar a.mini, .toolbar button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.toolbar a.big, .toolbar button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar a.mini, .toolbar button.mini { min-width: 22px; width: 22px; }

.toolbar a.big, .toolbar button.big { min-width: 48px; width: 48px; }

.toolbar a [class^="icon-"], .toolbar button [class^="icon-"], .toolbar a [class*=" icon-"], .toolbar button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.toolbar a [class^="icon-"].icon-large, .toolbar button [class^="icon-"].icon-large, .toolbar a [class*=" icon-"].icon-large, .toolbar button [class*=" icon-"].icon-large { line-height: .9em; }

.toolbar a.big [class^="icon-"], .toolbar button.big [class^="icon-"], .toolbar a.big [class*=" icon-"], .toolbar button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.toolbar a [class^="icon-"], .toolbar button [class^="icon-"], .toolbar a [class*=" icon-"], .toolbar button [class*=" icon-"] { margin-right: 5px; }

.toolbar a [class^="icon-"].right, .toolbar button [class^="icon-"].right, .toolbar a [class*=" icon-"].right, .toolbar button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar a:before, .toolbar button:before, .toolbar a:after, .toolbar button:after { display: table; content: ""; }

.toolbar a:after, .toolbar button:after { clear: both; }

.toolbar a.standart, .toolbar button.standart { min-width: 90px; min-height: 32px; }

.toolbar a:active, .toolbar button:active, .toolbar a.default:active, .toolbar button.default:active { top: 1px; left: 1px; }

.toolbar a:disabled, .toolbar button:disabled, .toolbar a.disabled, .toolbar button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.toolbar a.default, .toolbar button.default { background-color: #008287; color: #fff; }

.toolbar a:focus, .toolbar button:focus { outline: 0; border: 1px #353535 dotted; }

.toolbar a.mini, .toolbar button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.toolbar a.big, .toolbar button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar a img, .toolbar button img { width: 16px; height: 16px; top: 8px; }

.toolbar a { padding: 5px 0; }

.toolbar:before, .toolbar:after { display: table; content: ""; }

.toolbar:after { clear: both; }

.toolbar .toolbar-group { margin-right: 20px; margin-bottom: 10px; float: left; }

.toolbar-vertical { width: 33px; float: left; margin-right: 10px;

  • zoom: 1;

}

.toolbar-vertical a, .toolbar-vertical button { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; cursor: pointer; width: auto;

  • zoom: 1;

min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; margin-bottom: 5px; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-width: 22px; width: 22px; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-width: 48px; width: 48px; }

.toolbar-vertical a [class^="icon-"], .toolbar-vertical button [class^="icon-"], .toolbar-vertical a [class*=" icon-"], .toolbar-vertical button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.toolbar-vertical a [class^="icon-"].icon-large, .toolbar-vertical button [class^="icon-"].icon-large, .toolbar-vertical a [class*=" icon-"].icon-large, .toolbar-vertical button [class*=" icon-"].icon-large { line-height: .9em; }

.toolbar-vertical a.big [class^="icon-"], .toolbar-vertical button.big [class^="icon-"], .toolbar-vertical a.big [class*=" icon-"], .toolbar-vertical button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.toolbar-vertical a [class^="icon-"], .toolbar-vertical button [class^="icon-"], .toolbar-vertical a [class*=" icon-"], .toolbar-vertical button [class*=" icon-"] { margin-right: 5px; }

.toolbar-vertical a [class^="icon-"].right, .toolbar-vertical button [class^="icon-"].right, .toolbar-vertical a [class*=" icon-"].right, .toolbar-vertical button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar-vertical a:before, .toolbar-vertical button:before, .toolbar-vertical a:after, .toolbar-vertical button:after { display: table; content: ""; }

.toolbar-vertical a:after, .toolbar-vertical button:after { clear: both; }

.toolbar-vertical a.standart, .toolbar-vertical button.standart { min-width: 90px; min-height: 32px; }

.toolbar-vertical a:active, .toolbar-vertical button:active, .toolbar-vertical a.default:active, .toolbar-vertical button.default:active { top: 1px; left: 1px; }

.toolbar-vertical a:disabled, .toolbar-vertical button:disabled, .toolbar-vertical a.disabled, .toolbar-vertical button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.toolbar-vertical a.default, .toolbar-vertical button.default { background-color: #008287; color: #fff; }

.toolbar-vertical a:focus, .toolbar-vertical button:focus { outline: 0; border: 1px #353535 dotted; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar-vertical a img, .toolbar-vertical button img { width: 16px; height: 16px; top: 8px; }

.toolbar-vertical a { padding: 5px 0; }

.toolbar-vertical:before, .toolbar-vertical:after { display: table; content: ""; }

.toolbar-vertical:after { clear: both; }

.toolbar-vertical .toolbar-group { margin-bottom: 20px; }

.image-button { position: relative; border: 0; padding-right: 45px; }

.image-button img, .image-button:active img { position: absolute; right: 0; margin-left: 32px; padding: 5px; height: 100%; top: 0; margin-left: 0; box-sizing: border-box; border: 1px transparent solid; z-index: 2; }

.button-set a, .button-set button { margin-right: 0; text-align: center; }

.button-set a img, .button-set button img { background-color: transparent; }

.button-set a { padding: 5px 0; }

.button-set button.active { background-color: #008287; color: #fff; }

.shortcuts { margin-bottom: 10px; }

.shortcut { width: 92px; height: 92px; display: inline-block; margin: 0 10px 10px 0; vertical-align: top; text-decoration: none; background: #f3f3f3; text-align: center; cursor: pointer; border: 0; border-bottom: 2px transparent solid; position: relative; }

.shortcut:hover { border-color: red; }

.shortcut:active { background: #f3f3f3; top: 1px; left: 1px; }

.shortcut > .icon { margin-top: .25em; margin-bottom: .25em; color: #888; display: block; float: none; }

.shortcut > .label { display: block; font-weight: 400; color: #666; }

.shortcut > .badge { position: absolute; right: 0; top: 0; background-color: #2d89ef; padding: 5px; margin: 0 !important; text-align: center; display: block; font-size: 9pt; color: #fff; }

a.shortcut { padding: 12px 0; }

a.shortcut .label { font-size: 9pt; }

.pagination { width: auto; margin-bottom: 10px; }

.pagination > ul { margin-left: 0; list-style: none; margin: 0; }

.pagination > ul li { display: inline-block; margin-right: 1px; position: relative; }

.pagination > ul li a { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; width: auto;

  • zoom: 1;

min-height: 32px; width: 32px; padding: 0; position: relative; display: block; float: left; font-size: 10pt; padding: 5px; min-width: 32px; height: 32px; text-align: center; vertical-align: middle; cursor: pointer; margin-right: 1px; }

.pagination > ul li a.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.pagination > ul li a.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.pagination > ul li a.mini { min-width: 22px; width: 22px; }

.pagination > ul li a.big { min-width: 48px; width: 48px; }

.pagination > ul li a [class^="icon-"], .pagination > ul li a [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.pagination > ul li a [class^="icon-"].icon-large, .pagination > ul li a [class*=" icon-"].icon-large { line-height: .9em; }

.pagination > ul li a.big [class^="icon-"], .pagination > ul li a.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.pagination > ul li a [class^="icon-"], .pagination > ul li a [class*=" icon-"] { margin-right: 5px; }

.pagination > ul li a [class^="icon-"].right, .pagination > ul li a [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.pagination > ul li a:before, .pagination > ul li a:after { display: table; content: ""; }

.pagination > ul li a:after { clear: both; }

.pagination > ul li a.standart { min-width: 90px; min-height: 32px; }

.pagination > ul li a:active, .pagination > ul li a.default:active { top: 1px; left: 1px; }

.pagination > ul li a:disabled, .pagination > ul li a.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.pagination > ul li a.default { background-color: #008287; color: #fff; }

.pagination > ul li a:focus { outline: 0; border: 1px #353535 dotted; }

.pagination > ul li a.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.pagination > ul li a.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.pagination > ul li a img { width: 16px; height: 16px; top: 8px; }

.pagination > ul li a:hover { background-color: #1d1d1d; color: #fff; }

.pagination > ul li a:active { top: 1px; left: 1px; }

.pagination > ul li.first a, .pagination > ul li.prev a, .pagination > ul li.next a, .pagination > ul li.last a { font-size: 20pt; }

.pagination > ul li.first a:before, .pagination > ul li.prev a:before, .pagination > ul li.next a:before, .pagination > ul li.last a:before { position: absolute; left: 50%; top: 0; margin-left: -7px; content: "\25C4"; font-size: 1.5em; }

.pagination > ul li.first a:before { content: "\AB"; margin-left: -10px; }

.pagination > ul li.prev a:before { content: "\2039"; }

.pagination > ul li.next a:before { content: "\203A"; }

.pagination > ul li.last a:before { content: "\BB"; margin-left: -10px; }

.pagination > ul li.active a { background-color: #008287; color: #fff; }

.pagination > ul li.disabled a, .pagination > ul li.spaces a { background-color: #f2f2f2; color: #1e1e1e; cursor: not-allowed; }

.pagination > ul li.disabled a:active, .pagination > ul li.spaces a:active { top: 0; left: 0; }

.pagination > ul li.disabled a { color: #1e1e1e; }

.pagination > ul li.spaces a { background-color: #fff; cursor: default; }

table { width: 100%; border-collapse: separate; margin: 0 0 20px; }

table thead tr th, table thead tr td { display: table-cell; vertical-align: bottom; padding-bottom: 5px; padding-top: 10px; padding-left: 5px; border-bottom: 1px #ddd solid; border-right: 1px #ddd solid; border-left: 1px transparent solid; border-top: 1px transparent solid; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: rgba(0,0,0,0.6); text-align: left; }

table thead tr th.right, table thead tr td.right { text-align: right; padding-right: 10px; }

table thead tr th.last, table thead tr td.last { border-right: 1px transparent solid; }

table thead tr th:last-child, table thead tr td:last-child { border-right: 1px transparent solid; }

table tbody tr { border: 1px #fff solid; }

table tbody tr td { font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; padding: 3px 10px; border-right: 1px #ddd solid; border-bottom: 1px #ddd solid; border-left: 1px transparent solid; border-top: 1px transparent solid; box-sizing: border-box; }

table tbody tr td.right { text-align: right; }

table tbody tr td.center { text-align: center; }

table tbody tr td.last { border-right: 1px transparent solid; }

table tbody tr td:last-child { border-right: 1px transparent solid; }

table tbody tr.success { background-color: #00a300 !important; }

table tbody tr.error { background-color: #b91d47 !important; }

table tbody tr.warning { background-color: #e3a21a !important; }

table tbody tr.info { background-color: #2d89ef !important; }

table tbody tr.info td, table tbody tr.warning td, table tbody tr.error td, table tbody tr.success td { color: #fff !important; }

table tbody tr.selected-row { background-color: rgba(28,183,236,0.1) !important; }

table tbody tr.selected-row td:first-child { border-left: 1px #1c98cc solid; }

table tbody tr.selected-row td:last-child { border-right: 1px #1c98cc solid; }

table tbody tr.selected-row td { border-top: 1px #1c98cc solid; border-bottom: 1px #1c98cc solid; }

table.striped tbody tr:nth-child(odd) { background-color: #f9f9f9; }

table.hovered { border-collapse: separate !important; }

table.hovered thead tr th:hover, table.hovered thead tr td:hover { border: 1px #1c98cc solid; background: rgba(28,183,236,0.1); }

table.hovered tbody tr:hover { background-color: rgba(28,183,236,0.1); }

table.hovered tbody tr:hover td:first-child { border-left: 1px #1c98cc solid; }

table.hovered tbody tr:hover td:last-child { border-right: 1px #1c98cc solid; }

table.hovered tbody tr:hover td { border-top: 1px #1c98cc solid; border-bottom: 1px #1c98cc solid; }

table.bordered { border-collapse: separate !important; border: 1px #ccc solid !important; }

table.bordered tbody tr:last-child td { border-bottom: 0; }

.oh, .ot, .tt { float: left; margin: 0 2% 2% 0; width: 48%; }

.ot { width: 31%; }

.tt { width: 65%; }

.cl { clear: both; }

.item-padding { margin-right: 20px; margin-bottom: 5px; }

.column-padding { margin: 0 10px; }

.group-padding { margin: 0 40px; }

.span1 { width: 60px; }

.span2 { width: 140px; }

.span3 { width: 220px; }

.span4 { width: 300px; }

.span5 { width: 380px; }

.span6 { width: 460px; }

.span7 { width: 540px; }

.span8 { width: 620px; }

.span9 { width: 700px; }

.span10 { width: 780px; }

.span11 { width: 860px; }

.span12 { width: 980px; }

  1. bodyContent {

width: 1020px; }


.offset1 { margin-left: 80px; }

.offset2 { margin-left: 160px; }

.offset3 { margin-left: 240px; }

.offset4 { margin-left: 320px; }

.offset5 { margin-left: 400px; }

.offset6 { margin-left: 480px; }

.offset7 { margin-left: 560px; }

.offset8 { margin-left: 640px; }

.offset9 { margin-left: 720px; }

.offset10 { margin-left: 800px; }

.offset11 { margin-left: 880px; }

.offset12 { margin-left: 960px; }

[class*="span"] { float: none; min-height: 1px; margin-right: 20px; margin-bottom: 5px;

  • zoom: 1;

}

[class*="span"]:before, [class*="span"]:after { display: table; content: ""; }

[class*="span"]:after { clear: both; }

[class*="span"]:last-child { margin-right: 0; }

[class*="span"] > img { max-width: 100%; height: auto; }

.grid { margin: 0 0 20px; display: block; height: auto; width: 100%;

  • zoom: 1;

}

.grid.no-margin { margin: 0; }

.grid.margin-row { margin-bottom: 5px; }

.grid .grid { margin-top: 2.5px; margin-bottom: 2.5px; }

.grid .group { margin-right: 80px; float: left; width: auto; height: auto; min-height: 1px; }

.grid .row { width: 100%;

  • zoom: 1;

}

.grid .row:before, .grid .row:after { display: table; content: ""; }

.grid .row:after { clear: both; }

.grid .row [class*="span"] { float: left; }

.grid.element-border [class*="span"] { border: 1px #ccc dotted; }

.grid:before, .grid:after { display: table; content: ""; }

.grid:after { clear: both; }

.grid > .row::before, .grid > .row::after { content: normal; }

td[class*="span"], th[class*="span"] { display: table-cell !important; float: none !important; padding: 0 !important; }

.hero-unit { position: relative; margin: 0 0 10px; padding: 20px; background-color: #f1f1f1; width: 100%;

  • zoom: 1;

}

.hero-unit:before, .hero-unit:after { display: table; content: ""; }

.hero-unit:after { clear: both; }

.dropdown-menu { position: absolute; background-color: #fff; margin-left: 0; list-style: none; top: 100%; z-index: 11010; float: left; border: 1px solid rgba(0,0,0,0.2); box-shadow: 0 5px 10px rgba(0,0,0,0.2); min-width: 160px; padding-bottom: 5px; padding-top: 5px; padding-left: 0; display: none; }

.dropdown-menu.place-right { right: 0; left: auto; }

.dropdown-menu a { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: #000; display: block; width: 100%; padding: 3px 20px; white-space: nowrap; font-size: 14px; cursor: pointer; }

.dropdown-menu a:hover { color: rgba(0,0,0,0.8); }

.dropdown-menu a:active { color: rgba(0,0,0,0.4); }

.dropdown-menu a:hover { background-color: #2d89ef !important; color: #fff !important; }

.dropdown-menu li { display: list-item; line-height: 20px; }

.dropdown-menu .divider { height: 1px; margin: 9px 1px; overflow: hidden; background-color: #e5e5e5; }

.dropdown-menu.open { display: block !important; }

.nav-bar { background-color: #2d89ef; width: 100%; display: block; margin: 0; padding: 0; z-index: 1000;

  • zoom: 1;

}

.nav-bar .nav-bar-inner {

  • zoom: 1;

}

.nav-bar .nav-bar-inner .element, .nav-bar .nav-bar-inner a .element { margin: 5px; line-height: 20px; height: 20px; float: left; display: inline-block; padding: 0; font-weight: normal; font-size: 10pt; color: #fff; }

.nav-bar .nav-bar-inner .element.brand, .nav-bar .nav-bar-inner a .element.brand { font-size: 1.15em; }

.nav-bar .nav-bar-inner .element img, .nav-bar .nav-bar-inner a .element img { height: 100%; }

.nav-bar .nav-bar-inner .element a, .nav-bar .nav-bar-inner a .element a { line-height: 20px; height: 20px; font-size: 10pt; }

.nav-bar .nav-bar-inner .element [class^="icon-"]:before, .nav-bar .nav-bar-inner a .element [class^="icon-"]:before, .nav-bar .nav-bar-inner .element [class*=" icon-"]:before, .nav-bar .nav-bar-inner a .element [class*=" icon-"]:before { display: inline-block; margin: 0; padding: 0; display: block; float: left; margin: 0 5px; }

.nav-bar .nav-bar-inner > ul.menu { margin-left: 0; list-style: none; padding: 0; margin: 0; }

.nav-bar .nav-bar-inner > ul.menu > li { display: block; float: left; margin-right: 10px; position: relative; padding: 5px; }

.nav-bar .nav-bar-inner > ul.menu > li a { display: block; float: left; color: #fff; font-size: 10pt; }

.nav-bar .nav-bar-inner > ul.menu > li ul.dropdown-menu { z-index: 1001; border: 0; }

.nav-bar .nav-bar-inner > ul.menu > li ul.dropdown-menu li a { display: block; float: none; color: #1e1e1e; padding: 3px 20px; }

.nav-bar .nav-bar-inner > ul.menu.open { display: block !important; }

.nav-bar .nav-bar-inner > .divider, .nav-bar .nav-bar-inner > ul.menu > li.divider { position: relative; margin: 5px; line-height: 20px; height: 20px; float: left; display: inline-block; padding: 0; font-weight: normal; font-size: 10pt; color: #fff; width: 1px; border-right: 1px #e6e6e6 solid; }

.nav-bar .nav-bar-inner > .divider.brand, .nav-bar .nav-bar-inner > ul.menu > li.divider.brand { font-size: 1.15em; }

.nav-bar .nav-bar-inner > .divider img, .nav-bar .nav-bar-inner > ul.menu > li.divider img { height: 100%; }

.nav-bar .nav-bar-inner > .divider a, .nav-bar .nav-bar-inner > ul.menu > li.divider a { line-height: 20px; height: 20px; font-size: 10pt; }

.nav-bar .nav-bar-inner > .divider [class^="icon-"]:before, .nav-bar .nav-bar-inner > ul.menu > li.divider [class^="icon-"]:before, .nav-bar .nav-bar-inner > .divider [class*=" icon-"]:before, .nav-bar .nav-bar-inner > ul.menu > li.divider [class*=" icon-"]:before { display: inline-block; margin: 0; padding: 0; display: block; float: left; margin: 0 5px; }

.nav-bar .nav-bar-inner [data-role=dropdown] { margin-right: 20px !important; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a { cursor: pointer; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a:before { position: absolute; content: "\203A"; display: block; font-size: 1.4em; left: 100%; margin-left: 3px; top: 8px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); }

.nav-bar .nav-bar-inner .pull-menu { display: none; float: right; color: #fff; cursor: pointer; font: 1.8em sans-serif; margin-right: 0; position: relative; height: 20px; width: 20px; line-height: 20px; }

.nav-bar .nav-bar-inner .pull-menu:before { content: "\2261"; position: absolute; font-size: 20pt; top: 5px; left: 0; }

.nav-bar .nav-bar-inner:before, .nav-bar .nav-bar-inner:after { display: table; content: ""; }

.nav-bar .nav-bar-inner:after { clear: both; }

.nav-bar.bg-color-blue .nav-bar-inner .menu li a:hover { background-color: #2d89ef !important; }

.nav-bar.bg-color-blueLight .nav-bar-inner .menu li a:hover { background-color: #eff4ff !important; }

.nav-bar.bg-color-blueDark .nav-bar-inner .menu li a:hover { background-color: #2b5797 !important; }

.nav-bar.bg-color-green .nav-bar-inner .menu li a:hover { background-color: #00a300 !important; }

.nav-bar.bg-color-greenLight .nav-bar-inner .menu li a:hover { background-color: #99b433 !important; }

.nav-bar.bg-color-greenDark .nav-bar-inner .menu li a:hover { background-color: #1e7145 !important; }

.nav-bar.bg-color-red .nav-bar-inner .menu li a:hover { background-color: #b91d47 !important; }

.nav-bar.bg-color-yellow .nav-bar-inner .menu li a:hover { background-color: #ffc40d !important; }

.nav-bar.bg-color-orange .nav-bar-inner .menu li a:hover { background-color: #e3a21a !important; }

.nav-bar.bg-color-orangeDark .nav-bar-inner .menu li a:hover { background-color: #da532c !important; }

.nav-bar.bg-color-pink .nav-bar-inner .menu li a:hover { background-color: #9f00a7 !important; }

.nav-bar.bg-color-pinkDark .nav-bar-inner .menu li a:hover { background-color: #7e3878 !important; }

.nav-bar.bg-color-purple .nav-bar-inner .menu li a:hover { background-color: #603cba !important; }

.nav-bar.bg-color-darken .nav-bar-inner .menu li a:hover { background-color: #1d1d1d !important; }

.nav-bar.bg-color-lighten .nav-bar-inner .menu li a:hover { background-color: #d5e7ec !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li:hover { background-color: #e6e6e6 !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li a:hover { background-color: #e6e6e6 !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li a { color: #1d1d1d !important; }

.nav-bar.bg-color-white .nav-bar-inner .element { color: #1d1d1d !important; }

.nav-bar.bg-color-white .nav-bar-inner .pull-menu { color: #1d1d1d !important; }

.nav-bar.bg-color-grayDark .nav-bar-inner .menu li a:hover { background-color: #525252 !important; }

.nav-bar.bg-color-magenta .nav-bar-inner .menu li a:hover { background-color: #ff0097 !important; }

.nav-bar.bg-color-teal .nav-bar-inner .menu li a:hover { background-color: #00aba9 !important; }

.nav-bar.bg-color-redLight .nav-bar-inner .menu li a:hover { background-color: #e11 !important; }

.nav-bar:before, .nav-bar:after { display: table; content: ""; }

.nav-bar:after { clear: both; }

.nav-bar.fixed-top, .nav-bar.fixed-bottom { position: fixed; z-index: 10000; left: 0; }

.nav-bar.fixed-top { top: 0; bottom: auto; }

.nav-bar.fixed-bottom { bottom: 0; top: auto; }

.nav-bar .nav-bar-inner.container { width: 940px; margin: auto; }

.side-nav ul { margin: 0; padding: 0; list-style: none; margin-bottom: 20px; }

.side-nav ul .title { color: #4f4f4f; font-family: Segoe UI,Arial,Verdana,Tahoma,sans-serif; font-size: 12pt; margin: 0 0 5px 0; border-bottom: 1px #ccc solid; }

.side-nav ul > li > a { display: block; padding: 3px 10px 3px 0; position: relative; color: #014e85; padding-left: 3px; font-size: 10pt; }

.side-nav ul.close > li { display: none; }

.side-nav ul.close > li[class^=title] { display: list-item; }

.page-sidebar { display: block; width: 213px; float: left; min-height: 100% !important; height: auto; background-color: #ebebeb; padding-top: 10px; padding-bottom: 10px; margin-top: 10px; margin-left: 7px; }

.page-sidebar a { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; color: #000; display: block; width: 100%; padding: 5px 20px 5px 10px; white-space: nowrap; font-size: 14px; cursor: pointer; }

.page-sidebar a:hover { color: rgba(0,0,0,0.8); }

.page-sidebar a:active { color: rgba(0,0,0,0.4); }

.page-sidebar a:hover { background-color: #2d89ef !important; color: #fff !important; }

.page-sidebar li { display: list-item; line-height: 20px; position: relative; }

.page-sidebar > ul > li > a { font-size: 1.1em; }

.page-sidebar > ul > li a.lead, .page-sidebar > ul > li.lead a, .page-sidebar > ul > li.lead { font-weight: bold; }

.page-sidebar > ul > li.sticker:before { content: "."; position: absolute; width: 7px; height: 28px; left: -7px; text-indent: -9999px; border-top-left-radius: 10px; border-bottom-left-radius: 10px; background-color: #ebebeb; }

.page-sidebar > ul > li.sticker.sticker-color-blue:before { background-color: #2d89ef; }

.page-sidebar > ul > li.sticker.sticker-color-blueLight:before { background-color: #eff4ff; }

.page-sidebar > ul > li.sticker.sticker-color-blueDark:before { background-color: #2b5797; }

.page-sidebar > ul > li.sticker.sticker-color-green:before { background-color: #00a300 !important; }

.page-sidebar > ul > li.sticker.sticker-color-greenLight:before { background-color: #99b433 !important; }

.page-sidebar > ul > li.sticker.sticker-color-greenDark:before { background-color: #1e7145 !important; }

.page-sidebar > ul > li.sticker.sticker-color-red:before { background-color: #b91d47 !important; }

.page-sidebar > ul > li.sticker.sticker-color-yellow:before { background-color: #ffc40d !important; }

.page-sidebar > ul > li.sticker.sticker-color-orange:before { background-color: #e3a21a !important; }

.page-sidebar > ul > li.sticker.sticker-color-orangeDark:before { background-color: #da532c !important; }

.page-sidebar > ul > li.sticker.sticker-color-pink:before { background-color: #9f00a7 !important; }

.page-sidebar > ul > li.sticker.sticker-color-pinkDark:before { background-color: #7e3878 !important; }

.page-sidebar > ul > li.sticker.sticker-color-purple:before { background-color: #603cba !important; }

.page-sidebar > ul > li.sticker.sticker-color-darken:before { background-color: #1d1d1d !important; }

.page-sidebar > ul > li.sticker.sticker-color-white:before { background-color: #fff !important; }

.page-sidebar > ul > li.sticker.sticker-color-grayDark:before { background-color: #525252 !important; }

.page-sidebar .divider { height: 1px; margin: 9px 1px; overflow: hidden; background-color: #e5e5e5; }

.page-sidebar ul { margin-left: 0; list-style: none; background-color: #ebebeb; }

.page-sidebar ul.sub-menu { padding-top: 5px; padding-bottom: 5px; }

.page-sidebar ul.sub-menu a { padding: 5px 20px 5px 25px; }

.page-sidebar ul.sub-menu.light { background-color: #f9f9f9 !important; }

.page-sidebar .sidebar-dropdown-menu { display: none; }

.page-sidebar .sidebar-dropdown-menu.open { display: block; }

.page-sidebar > ul > li.dropdown { position: relative; }

.page-sidebar > ul > li.dropdown:after { content: ""; display: block; position: absolute; top: 6px; left: 100%; margin-left: -20px; width: 16px; height: 16px; background: no-repeat; background-position: 0 -1586px; z-index: 200; }

.page-sidebar > ul > li.dropdown.active:after { background-position: 0 -676px; }

.replies { margin-left: 0; list-style: none; }

.replies > div, .replies > li, .replies > span { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 310px; height: 150px; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; height: auto; min-height: 70px; padding: 10px; }

.replies > div .avatar, .replies > li .avatar, .replies > span .avatar { width: 50px; height: 50px; overflow: hidden; display: table-cell; vertical-align: middle !important; background: #6e6e6e; box-shadow-bottom: inset 0 0 3px #fff; }

.replies > div .avatar img, .replies > li .avatar img, .replies > span .avatar img { width: 100%; height: 100%; display: inline-block !important; vertical-align: middle !important; }

.replies > div .reply, .replies > li .reply, .replies > span .reply { margin-left: 60px; margin-top: -50px; }

.replies > div .reply .date, .replies > li .reply .date, .replies > span .reply .date { float: right; font-size: 55%; color: #fff; }

.replies > div .reply .author, .replies > li .reply .author, .replies > span .reply .author { color: #fff; }

.replies > div .reply .text, .replies > li .reply .text, .replies > span .reply .text { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #000; color: #fff; line-height: 16px; }

.replies > div .reply .text:hover, .replies > li .reply .text:hover, .replies > span .reply .text:hover { color: rgba(0,0,0,0.8); }

.replies > div .reply .text:active, .replies > li .reply .text:active, .replies > span .reply .text:active { color: rgba(0,0,0,0.4); }

.replies > div .reply .text:hover, .replies > li .reply .text:hover, .replies > span .reply .text:hover { color: #fff; }

.replies > div .sticker, .replies > li .sticker, .replies > span .sticker { width: 0; height: 0; border-top: 10px solid #fff; position: absolute; display: block; z-index: 1000; }

.replies > div .sticker.sticker-color-blue, .replies > li .sticker.sticker-color-blue, .replies > span .sticker.sticker-color-blue { border-color: #2d89ef !important; }

.replies > div .sticker.sticker-color-blueLight, .replies > li .sticker.sticker-color-blueLight, .replies > span .sticker.sticker-color-blueLight { border-color: #eff4ff !important; }

.replies > div .sticker.sticker-color-blueDark, .replies > li .sticker.sticker-color-blueDark, .replies > span .sticker.sticker-color-blueDark { border-color: #2b5797 !important; }

.replies > div .sticker.sticker-color-green, .replies > li .sticker.sticker-color-green, .replies > span .sticker.sticker-color-green { border-color: #00a300 !important; }

.replies > div .sticker.sticker-color-greenLight, .replies > li .sticker.sticker-color-greenLight, .replies > span .sticker.sticker-color-greenLight { border-color: #99b433 !important; }

.replies > div .sticker.sticker-color-greenDark, .replies > li .sticker.sticker-color-greenDark, .replies > span .sticker.sticker-color-greenDark { border-color: #1e7145 !important; }

.replies > div .sticker.sticker-color-red, .replies > li .sticker.sticker-color-red, .replies > span .sticker.sticker-color-red { border-color: #b91d47 !important; }

.replies > div .sticker.sticker-color-yellow, .replies > li .sticker.sticker-color-yellow, .replies > span .sticker.sticker-color-yellow { border-color: #ffc40d !important; }

.replies > div .sticker.sticker-color-orange, .replies > li .sticker.sticker-color-orange, .replies > span .sticker.sticker-color-orange { border-color: #e3a21a !important; }

.replies > div .sticker.sticker-color-orangeDark, .replies > li .sticker.sticker-color-orangeDark, .replies > span .sticker.sticker-color-orangeDark { border-color: #da532c !important; }

.replies > div .sticker.sticker-color-pink, .replies > li .sticker.sticker-color-pink, .replies > span .sticker.sticker-color-pink { border-color: #9f00a7 !important; }

.replies > div .sticker.sticker-color-pinkDark, .replies > li .sticker.sticker-color-pinkDark, .replies > span .sticker.sticker-color-pinkDark { border-color: #7e3878 !important; }

.replies > div .sticker.sticker-color-purple, .replies > li .sticker.sticker-color-purple, .replies > span .sticker.sticker-color-purple { border-color: #603cba !important; }

.replies > div .sticker.sticker-color-darken, .replies > li .sticker.sticker-color-darken, .replies > span .sticker.sticker-color-darken { border-color: #1d1d1d !important; }

.replies > div .sticker.sticker-color-white, .replies > li .sticker.sticker-color-white, .replies > span .sticker.sticker-color-white { border-color: #fff !important; }

.replies > div .sticker.sticker-color-lighten, .replies > li .sticker.sticker-color-lighten, .replies > span .sticker.sticker-color-lighten { border-color: #d5e7ec !important; }

.replies > div .sticker.sticker-color-grayDark, .replies > li .sticker.sticker-color-grayDark, .replies > span .sticker.sticker-color-grayDark { border-color: #525252 !important; }

.replies > div .sticker.sticker-color-magenta, .replies > li .sticker.sticker-color-magenta, .replies > span .sticker.sticker-color-magenta { border-color: #ff0097 !important; }

.replies > div .sticker.sticker-color-teal, .replies > li .sticker.sticker-color-teal, .replies > span .sticker.sticker-color-teal { border-color: #00aba9 !important; }

.replies > div .sticker.sticker-color-redLight, .replies > li .sticker.sticker-color-redLight, .replies > span .sticker.sticker-color-redLight { border-color: #e11 !important; }

.replies > div .sticker.sticker-left, .replies > li .sticker.sticker-left, .replies > span .sticker.sticker-left { border-left: 20px solid transparent !important; left: -20px; }

.replies > div .sticker.sticker-right, .replies > li .sticker.sticker-right, .replies > span .sticker.sticker-right { border-right: 20px solid transparent !important; right: -20px; }

.notices { list-style: none; margin: 0; padding: 0; }

.notices > div, .notices > li, .notices > span, .notices > a { width: 100%; height: 90px; display: block; overflow: hidden; position: relative; margin-bottom: 10px; }

.notices > div .notice-header, .notices > li .notice-header, .notices > span .notice-header, .notices > a .notice-header, .notices > div .header, .notices > li .header, .notices > span .header, .notices > a .header { position: relative; background: transparent; font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; font-size: 12pt; margin-top: 5px; margin-left: 10px; }

.notices > div .notice-text, .notices > li .notice-text, .notices > span .notice-text, .notices > a .notice-text, .notices > div .text, .notices > li .text, .notices > span .text, .notices > a .text { position: relative; margin-right: 50px; margin-left: 10px; color: #fff; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 8pt; font-smooth: always; margin-top: -5px; line-height: 16px; }

.notices > div .notice-icon, .notices > li .notice-icon, .notices > span .notice-icon, .notices > a .notice-icon, .notices > div .icon, .notices > li .icon, .notices > span .icon, .notices > a .icon { position: absolute; right: 10px; bottom: 5px; }

.notices > div .notice-icon img, .notices > li .notice-icon img, .notices > span .notice-icon img, .notices > a .notice-icon img, .notices > div .icon img, .notices > li .icon img, .notices > span .icon img, .notices > a .icon img { width: 32px; height: 32px; }

.notices > div .notice-image, .notices > li .notice-image, .notices > span .notice-image, .notices > a .notice-image, .notices > div .image, .notices > li .image, .notices > span .image, .notices > a .image { max-height: 48px; width: 48px; height: 48px; margin: 20px 20px 20px 20px; float: left; }

.notices > div .notice-image img, .notices > li .notice-image img, .notices > span .notice-image img, .notices > a .notice-image img, .notices > div .image img, .notices > li .image img, .notices > span .image img, .notices > a .image img { width: 48px; height: 48px; }

.notices > div .close, .notices > li .close, .notices > span .close, .notices > a .close { z-index: 2; position: absolute; top: 5px; right: 10px; cursor: pointer; font-weight: bold; text-decoration: none; color: #fff !important; }

.notices > div .close::before, .notices > li .close::before, .notices > span .close::before, .notices > a .close::before { content: "\00d7"; color: #fff !important; }

.notices > div .image-large, .notices > li .image-large, .notices > span .image-large, .notices > a .image-large { width: 88px; height: 88px; margin: 1px 10px 1px 1px; overflow: hidden; float: left; }

.notices > div .image-large img, .notices > li .image-large img, .notices > span .image-large img, .notices > a .image-large img { width: 88px; height: 88px; }

.tile-group { margin: 0; margin-right: 80px; float: left; width: auto; height: auto; min-height: 1px; width: 802px; }

.tile { display: block; float: left; background-color: #525252; width: 150px; height: 150px; cursor: pointer; box-shadow: inset 0 0 1px #ffc; text-decoration: none; color: #fff; position: relative; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; margin: 0 10px 10px 0; overflow: hidden; }

.tile * { color: #fff; }

.tile .tile-content { width: 100%; height: 100%; padding: 0; padding-bottom: 30px; vertical-align: top; padding: 10px 15px; overflow: hidden; text-overflow: ellipsis; position: relative; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #000; color: #fff; line-height: 16px; }

.tile .tile-content:hover { color: rgba(0,0,0,0.8); }

.tile .tile-content:active { color: rgba(0,0,0,0.4); }

.tile .tile-content:hover { color: #fff; }

.tile .tile-content h1, .tile .tile-content h2, .tile .tile-content h3, .tile .tile-content h4, .tile .tile-content h5, .tile .tile-content h6 { font-size: 14pt; }

.tile .tile-content h1, .tile .tile-content h2, .tile .tile-content h3, .tile .tile-content h4, .tile .tile-content h5, .tile .tile-content h6, .tile .tile-content p { padding: 0; margin: 0; line-height: 24px; }

.tile .tile-content h1:hover, .tile .tile-content h2:hover, .tile .tile-content h3:hover, .tile .tile-content h4:hover, .tile .tile-content h5:hover, .tile .tile-content h6:hover, .tile .tile-content p:hover { color: #fff; }

.tile .tile-content p { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #000; color: #fff; line-height: 16px; overflow: hidden; text-overflow: ellipsis; }

.tile .tile-content p:active { color: rgba(0,0,0,0.4); }

.tile .tile-content p:hover { color: #fff; }

.tile.icon > .tile-content { padding: 0; }

.tile.icon > .tile-content > img { position: absolute; width: 64px; height: 64px; top: 50%; left: 50%; margin-left: -32px; margin-top: -32px; }

.tile.icon > .tile-content > i { position: absolute; width: 64px; height: 64px; top: 50%; left: 50%; margin-left: -32px; margin-top: -32px; font-size: 64px; }

.tile.image > .tile-content, .tile.image-slider > .tile-content { padding: 0; }

.tile.image > .tile-content > img, .tile.image-slider > .tile-content > img { width: 100%; height: auto; min-height: 100%; max-width: 100%; }

.tile.image-set > .tile-content { margin: 0; padding: 0; width: 25% !important; height: 50%; float: left; border: 1px #1e1e1e solid; }

.tile.image-set > .tile-content > img { min-width: 100%; width: 100%; height: auto; min-height: 100%; }

.tile.image-set .tile-content:first-child { width: 50% !important; float: left; height: 100%; }

.tile.double { width: 310px; }

.tile.triple { width: 470px; }

.tile.quadro { width: 630px; }

.tile.double-vertical { height: 310px; }

.tile.triple-vertical { height: 470px; }

.tile.quadro-vertical { height: 630px; }

.tile .brand, .tile .tile-status { position: absolute; bottom: 0; left: 0; right: 0; min-height: 30px; background-color: transparent;

  • zoom: 1;

}

.tile .brand:before, .tile .tile-status:before, .tile .brand:after, .tile .tile-status:after { display: table; content: ""; }

.tile .brand:after, .tile .tile-status:after { clear: both; }

.tile .brand > .badge, .tile .tile-status > .badge { position: absolute; bottom: 0; right: 0; right: 5px; margin-bottom: 0; color: #fff; width: 34px; height: 28px; text-align: center; font-family: 'Segoe UI Semibold','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; padding-top: 3px; }

.tile .brand > .badge.activity, .tile .tile-status > .badge.activity { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAGMSURBVDhPvZMtTwNBEIbv2mtScaICcQJRgSgJCQIEhqSiAlEHAlFRwU/ov0AgUEgUsrIkiJIgMOAQJFSQQAIJJBWIu95Hj2eGvXIpB3W8yWTn452Z3dld25pDmqZuFEWdcrm8jr6JK7Bt+wb9Ft85+vsXswBxHHdIfmFNi4TYG7InXAp6ss52kCTJIc6e6KzSVbrdYzrYDaSFXZU4uEQ8x3FW1ZpMJge5Tn3IdQ3kID5iw4zHTqIsUEP3TWCA7WhgDjRZg/eUFRCR3Fl3KYJjyfALIUU46jHcsSlQl8FdmQJnhrcQJFbJ6QZB0LDDMNyS4XBFo1Kp9Gw4/wi247GLHmvNuBaC47Y5gtzIQB1mBmMGdDSdTpfV+QdM8vfcsqkap6ClgQIQa+a4bXViPGRO5ILjuBqYAwk7yIfhXcNz9CljDFkkST6P4JGjnHA7d+gBxAY3tIve1Khljbi1beKvakHQp0uhfTrMjvOL9H3fX9FE8OM7yxAhdem4QWHZkSufSoTYaaVSkY9kYFmfXgyTciI3uacAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.alert, .tile .tile-status > .badge.alert { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAFeSURBVDhPpZMtT8RAEIbb7YoTJ04gkQgQuBNIEpB4LD8AwQ9AkCCQhGAvQSAuKHCIE0gEP+DEISAhQYK4pE0/eWa65a7lSvh4k8nsvDv77sxs67UhSZLNNE0LZ3uO/gLj/J+hAkVRWI1+geqMCuR5fkKZoyiKViX+DuQu094wy7KhEmEYrkAk0qt4Nk5R77GszQCuE8fxIXxY8ZJjgiBY8n3/UcTwlsQDNifGmF29AcBtITyGOyan47gXXFfW2g/q+yi+VeptJhVgR1KRHp4HZI+bzknQlhYcvpQZuHRF8xmnCDyLL8MZEI9o4YkW3h1VB+o73DJp3to08l7xsw9Lng5i1EiSSV/Pcbdwzfk8MLcNqjIyye1STnHD5joln7lYcGWtXaP8gYsFfeJyHvR9waExt3wKsV74L3Brn/geu3OUDqiL1T7nNoEK8mLi9RUoZYqlsv4pqtf459/oeR8seozS7mDHCwAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.available, .tile .tile-status > .badge.available { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKvSURBVHjahJA/bJR1HMY/31977x33r2LuClc1LYM9TSAUr5gqtkVJjAkSFxYHE3VgaWRw0cUwOagxMZLApoXFBIwuHVSoQYkVMBXUpqSkMW9jaS25plh7/3rv+3scTIwixs/8PHn+2Bk/SVtN2mqxacYOKw13KfNiXtlneihmDONXqs0VVs/VXP1UqJvnc8qBeZoWYWf9JHXVqWkj2EX55G76X86R4W40aDHNzMdzLBwJLLEWm6fTI+o0knvZ+dkgO/cDfGczTNpl5gjxePrpY0SPMKwKT1A5nCe7Y4ofDgQEv/Ghn2AqunZabUmR9Fb8gQoaUVIVFTSiokaV0qDu0T694Y+rGbWktnQ5+nHiuP+IjrFjR4cqevj9wBK8beO87t6jiyzbKJAiIEWSreQxjAm7QGyeAwzRzb39i/7WFbdV2bGs0nxvs7zjxtlOgRwZPP6v7R5PmhQPUOKEneFLd4UECfqs51WXU/opDL6wb/mdDfJkEfrXgUKk2UKbiM/5BoD76d7reujOANwgJH9H8p14PDnSzBGySZsSReecDIAIDxj/jxH/LcQtW7UJ0E8f69RwuP+0Ohwb1CnTS0CCW6zK3Wb9a4AnNcgWktRoYHdpYhgtWvypfRSARVv5yVXd2smGWuzTHo7qeRZZpk7zH00cRos2ITd5yT/HQY0gPKGW3u0YPvZ06HB77tO2hx5jN5HFTNk11lgHRIs2VW5Tp8kRf5g3eYUUSa5y/eKsfn7NTvlPaCjqelwDF3bx4ADAeXeJc1xijpCYmDJ9jKrCIe0H4IaF81/56VGDJTvtPwV1IFmhTO/4AOWDSQIAWmwiRIokADEx08xeXGD5hUjxQp0GnQCdOAKS1RnNP7tO7VDOMmO9bB8qUQRghVVCW7raUOPEvH45W7IidRoA/DEAmmk0pL+n6f4AAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.unavailable, .tile .tile-status > .badge.unavailable { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKASURBVHjalJK9axxXFMV/772ZzOysVqvRDgtaSSwpJYFwY3ATEpIm5KNLawgp3Ljz/5E2bu20CYQUBoMNNnaRMkUKqYiQtIgdCQ0TaVc7M29n3nspzC7GMYYcuMWFe7jnHI4YjUY453DOYYyh0+l8opT63vO8L8MwbAshqKqq0lo/c849rqrquXMOIcSbGY1GWGsxxny0urr6MI7jH5RSAFhrAZBSLvc8z3+dTqf3lFL/SCnxAIwxwdra2tP19fXPAC4vL8myjKIoAIiiiF6vR7/fJ0mS75RSH19dXX0hpbwWx8fHrKys/JwkyV1rLYeHh5yenuKc420lzjm2trbY3d3F8zzyPH8ynU6/ERcXF3fiOP7D930ODg44OjoiDMOl7AWstZRlyXA4ZH9/H2MM4/H4K+l53n3f98myjJOTE4Ig+A95kUMURZydnXF+fo5SiiiKHkjf9z9f+AaWst+HRfKL2yiKbssgCNrOOWaz2Xs/vwulFLPZjLquCcPwDcM5x//B2/dyPp9XC3/WWoQQHyQbY2i32/i+T1VVTtZ1/QogSZJlGz/02VpLkiQAlGX5l2ya5mHTNPT7fba3tynLctnAd8llWTIYDNjY2MBaS1EUP0qt9YvJZPI7wM7ODsPhEK01WmuapqFpGrTWVFXFYDBgb28PIQTX19ev67r+TYzHY7TW3W63+zKO41sAaZqSZRk3NzcAtNtter0em5ubAEwmk7/zPP9USjkWaZoyn89xziWdTudRt9v9etGFuq4B8H1/aSXP89dFUdx1zp065xBpmlLXNUIIjDG0Wq1vPc+7H4bhnVarhRCCsiwpiuJPY8xPRVH8EgQBxhistfw7ABpxTL93U9x/AAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .badge.away, .tile .tile-status > .badge.away { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAJ2SURBVHjajJI7iFVnFIW//d9zz52ZO2fG14gzJBgbp5JYKPh+NqKxsxWMRZoBCxu1sAuBKFaClj5KDUQhRXybCIqICjqNYjFDhtExN45e7/uc8y+L/yJGp3A1+2fDWv/ea23zlQvIp0gpRgfrWbZRNrhP0cAOopEyGGSvWmQz15zq59SeuC5LsAis0MJ85SLKG8jXY3pXnKb8/X6iBAB8KLhuzZtQf/gbrWc/WTGetSgnAg9qlCiv/pNk1RYAqz3A6jeg/SyoxMtReRNKNsLAhj24gWW0726H+B3+9Rmyd3fPp5KyXMpf/SqNL5KelEIdH5Ke9Ejj8+SnjyrLWkolZbX7f/jZk5h/e3WN7197j0I/NnMMN3MYoiXgBv6/g+rQmUJDR/Ajv4BP0eylnU5u/pgK/Vj9Ee6/411y8gm5a4b1Qfwt9uYUrnoTXBGLvzvoFCXbDLDaVcjfd38WX0JBRCnUroRW/M1qRzRSxgPt55+NPRc8FJJgbtaB4rBz+phRxtcj//hylr5s4YDScvDVT0KfCw7yGpRGIYohfS2H3v4NoL6tYL3BbWwOsoHawY3y1tDJpp46p8pp5U2UrEcLD0BnCtT4bBIXyJ0J/Pwf0eAu8ELtiROO5uQtazy9LMAvPoKGDoU00n/CSr4K2RTkFfyCMRj+OWg2Ht9RNv27+X/PId8cVN+62/SvWAngqtehdq17yjmURlHfZjRvdxi98fyFr/21GWfT5ivnkQehRfSOnqV35S4KpW4w7ZB/1NNNMYf6wzukk3ulbBI1iIJkBBZX1Bn/gby621wyRrx0DcXhQGzPYOnEY/nmKbVeXLTicNcn+DAArZ4503S5ZjkAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.busy, .tile .tile-status > .badge.busy { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKNSURBVHjajJI9a1RBGIWfGeLdmPXuKkR0Q0RTmFsFUxgQNcaPRonpbAW1sAlY2IhFfoCIVSDaaVImFhYWmkTxAwJBVgttNqTYQFAjAWPi7t3svXeOxeC3hQdeZpiZ887DmTFuchIlCUoSTLOJ6erqV7F4QYXCaTo68hgDHz82WFmZsbXauKrVWYUhBjCNBsZNTaF6HdVqAT09tzlw4BJhyD8Vx1Au36dSuWyC4LPJMlpwDur1HH19jzh48DiAefUK8+QJVCrgHHR3o2PHUH8/HD16jkKhi7m5UwTBF9zdu6RzcxOJpFRSduOG1N4u5XJ+3LlTam2Vtm+XGxlR2mgokZTOzz90o6PgpqcPpRsbP83GSKWSFEXS/v2+okjq7JRA7vp1pZLSZlPJ5OQZqx07hrVtG+b1a+zNm7B7N4ShR/8u56CtDfbswYyNYZ8+hS1bMPv2XbUKw5MGMNPTsLEBhQJIfwco+SZJAo8f+7XOzj5LR0cegIUFb/715j/lnKerVKDZhFLJWlnrN9OU/1aW/Zha8+FDA4Dublhfh+8N/yVr4etXiCIIAvj0SZa1tRcAOnECtm6FWg2M+dtsDGxu8uMsYJaX31q7unpbcYyOHEFXrsDyMtTrv5NY683VKu7iRTQ4CBKqVm/h7twhnZ9/kEhK41ju2jWpWJTa2qRdu3zl81I+r2x4WNnamv8H5fKLZHQU48bHURwXdfjwM3p6egHs7CzMzPi0swyiCA0MoKEhj76wsOiePx/AmPfGTUwgQFI7UXSP3t5BcjmPvrnp37+19Wf65fJLlpbOK02XqNdpAaClBYJgVe/enWV9fciE4TB79x6iVPLGlRVMtfpGcTymxcUpUyr5nIBvAwDWIWcndiwtQAAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.newMessage, .tile .tile-status > .badge.newMessage { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAC/SURBVDhP1ZE9DgIhFIQhobDYg1haWniMbSw9j0exsfMAeg9L7Sy2kPATnCFI2LgYtjJOMjx4vPkoED+X5OK934cQ+thpFOYvSqmdMMascVDOuQMcGn1GptNaL4W1dgBkMwOSw8jeBJszIKMwexFAN0A+wnQG0Lh4wv0EJIb5AO4fRX8MoDFAlZAyPJSztOSSfiYLAYeyxTcdURcIrqSUJ7iLA4UmAdQbgnqvhakqgEoQXQtTXwEtIuCa9n8pIV67VJf6AmhGmgAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.paused, .tile .tile-status > .badge.paused { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAArSURBVDhPY/j9+7fDnz9//mPBCQxQgE8NE1QN2WDUgFEDQGDUgIE3gIEBAArtNKc4HT7sAAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .badge.playing, .tile .tile-status > .badge.playing { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAEXSURBVDhPY4CBnz9/pvz+/dsFyiUaMEFpBiYmJhkgtf3v37/t////Z4GIEgZwA0CAkZGRBai5AmjIYSCtABXGC1AMQAIWf/78OQ/EEVA+ToDLAJBrBIDUcqBrZgNdwwMRxQQ4DYABoOYUoCGngYFsABVCAQQNgAINYCAf//XrVwGUDwfEGgDyEgfQkH5guGwGukoEKky8AUhA5sePH6DwAQOSDAC6YgIzM7MpJyfnHagQcQYAnfwGiD2BmguBhvyBCoMBMQbsYWFh0WVlZd0B5aMAnAYAbfzz79+/SqBmV6CtL6DCGACXAQ+ABliysbF1QPk4AYYBQI0rgH7VBWo+AxXCC+AGADV+AVKJQL9GAp0MYhMBGBgA8v5j1f90TA8AAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.error, .tile .tile-status > .badge.error { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAFiSURBVDhPjVM7TsNQELRjy8ISBQeIREtBEYnQUXCINFTkCCBxgNwAJI5AaejSpaCAEqRINBTcIQ1SbD9/mHmfZP3iSIw0ytt9O7O7thMGHpqmGVZVNQnD8AwcMde27RL8rOt6nqbpjy7sA4RTpdQKv20fcbcuy/IOZrGVbIHLpz7RHr52TJCYukuMeU+6WDBjdxej4UyLubMbm0KdBDyTzHWEyY01UEVRnA4Q8IEdaZVAFEW3yD/g+IzzFc6VuTFAHAPXO7vLKQi5q+suuOD+X15yx4ToEXON1QB3B6ZkC3Qd+q8Kaxzbo0TMCTLPefPAfPS8nTeOtnk1YEfMsf11pIm+y/P8BLusmaCZrevsLE1QO3F51FzopJyCQil2pAnFoLLxI7X6z8SxkVjgeMn4H/jGQz3Ht/BrY2MC85nrsI/sjNpDKzMTSODzHPELQ9EY1H9ndFqCHxC/JEnyrgs1guAPTvwreuY0IiIAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.attention, .tile .tile-status > .badge.attention { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAEbSURBVDhPtZI9bsJAEIVZ7ANQ5gApEomChjoNBUUOkSJFivSUQE3JEThCCo4BkotcIVKKNEi2vP7hveVZrMFgKPJJo915szOzf51/Jc/zhbV2Jfc+kiR5QrLNsqzEMJJ8O0hcM1kWlWUZKtQOOo69ZGdpmn4ofB12QsI3k1BoRtP8F7Gell0GnT6rrpJ4HOfzUiU1ww7o9HepAGI2juNHyeegw7Ja3FRA9iW5jv9slSl0WqD2rEYjF7Hy68E7gCPNORpjpk44sg2CYAg969JTxVoywYIXmlyfAS77jRPDZ8PZN5j3KfiEYeh2yG07wQN5P4g/d9H9Hf5ZMkHM/QO5NbCzh6IoJgbVI/iNBdrALnY8An9X+w9rpLPbA/sADga+JgSiAAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .name, .tile .tile-status > .name { position: absolute; bottom: 0; left: 0; margin-bottom: 5px; margin-left: 15px; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #fff; }

.tile .brand > .name:hover, .tile .tile-status > .name:hover { color: #fff; }

.tile .brand > .name > [class*=icon-], .tile .tile-status > .name > [class*=icon-] { font-size: 24px; }

.tile .brand > .icon, .tile .tile-status > .icon { margin: 5px 15px; width: 32px; height: 32px; }

.tile .brand > .icon > [class*=icon-], .tile .tile-status > .icon > [class*=icon-] { font-size: 32px; }

.tile .brand > .icon > img, .tile .tile-status > .icon > img { width: 100%; height: 100%; }

.tile .brand > img ~ .text, .tile .tile-status > img ~ .text { position: absolute; left: 60px; width: auto; }

.tile .brand > .text, .tile .tile-status > .text { position: relative; left: 8px; top: 5px; right: 50px; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #000; color: #fff; line-height: 14px; width: 60%; padding: 0; margin: 0; }

.tile .brand > .text:hover, .tile .tile-status > .text:hover { color: rgba(0,0,0,0.8); }

.tile .brand > .text:active, .tile .tile-status > .text:active { color: rgba(0,0,0,0.4); }

.tile .brand > .text:hover, .tile .tile-status > .text:hover { color: #fff; }

.tile:hover { outline: 3px #3a3a3a solid; }

.input-control > input[type=text]::-ms-clear, .input-control > input[type=email]::-ms-clear, .input-control > input[type=url]::-ms-clear, .input-control > input[type=phone]::-ms-clear, .input-control > input[type=number]::-ms-clear, .input-control > input[type=time]::-ms-clear { display: none; }

.input-control > input[type=password]::-ms-reveal { display: none; }

.input-control.text input[type=text]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=text]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=password]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=password]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=email]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=email]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=phone]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=phone]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=number]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=number]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=time]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=time]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=url]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=url]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=text]:not(:focus) ~ .helper, .input-control.password input[type=text]:not(:focus) ~ .helper, .input-control.text input[type=password]:not(:focus) ~ .helper, .input-control.password input[type=password]:not(:focus) ~ .helper, .input-control.text input[type=email]:not(:focus) ~ .helper, .input-control.password input[type=email]:not(:focus) ~ .helper, .input-control.text input[type=phone]:not(:focus) ~ .helper, .input-control.password input[type=phone]:not(:focus) ~ .helper, .input-control.text input[type=number]:not(:focus) ~ .helper, .input-control.password input[type=number]:not(:focus) ~ .helper, .input-control.text input[type=time]:not(:focus) ~ .helper, .input-control.password input[type=time]:not(:focus) ~ .helper, .input-control.text input[type=url]:not(:focus) ~ .helper, .input-control.password input[type=url]:not(:focus) ~ .helper { display: none; }

.input-control.text input[type=text]:focus ~ [class^="btn-"], .input-control.password input[type=text]:focus ~ [class^="btn-"], .input-control.text input[type=password]:focus ~ [class^="btn-"], .input-control.password input[type=password]:focus ~ [class^="btn-"], .input-control.text input[type=email]:focus ~ [class^="btn-"], .input-control.password input[type=email]:focus ~ [class^="btn-"], .input-control.text input[type=phone]:focus ~ [class^="btn-"], .input-control.password input[type=phone]:focus ~ [class^="btn-"], .input-control.text input[type=number]:focus ~ [class^="btn-"], .input-control.password input[type=number]:focus ~ [class^="btn-"], .input-control.text input[type=time]:focus ~ [class^="btn-"], .input-control.password input[type=time]:focus ~ [class^="btn-"], .input-control.text input[type=url]:focus ~ [class^="btn-"], .input-control.password input[type=url]:focus ~ [class^="btn-"], .input-control.text input[type=text]:focus ~ .helper, .input-control.password input[type=text]:focus ~ .helper, .input-control.text input[type=password]:focus ~ .helper, .input-control.password input[type=password]:focus ~ .helper, .input-control.text input[type=email]:focus ~ .helper, .input-control.password input[type=email]:focus ~ .helper, .input-control.text input[type=phone]:focus ~ .helper, .input-control.password input[type=phone]:focus ~ .helper, .input-control.text input[type=number]:focus ~ .helper, .input-control.password input[type=number]:focus ~ .helper, .input-control.text input[type=time]:focus ~ .helper, .input-control.password input[type=time]:focus ~ .helper, .input-control.text input[type=url]:focus ~ .helper, .input-control.password input[type=url]:focus ~ .helper { display: block; }

label { font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; margin-right: 10px; margin-bottom: 10px; }

fieldset { position: relative; margin-top: 30px; border: 2px #eaeaea solid; padding: 10px; }

fieldset legend { padding-left: 10px; padding-right: 10px; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; color: #cfcfcf; position: absolute; top: -25px; left: -10px; }

.image-collection { position: relative; margin-left: 0; list-style: none;

  • zoom: 1;

}

.image-collection:before, .image-collection:after { display: table; content: ""; }

.image-collection:after { clear: both; }

.image-collection > div, .image-collection > li { width: 220px; height: 121px; overflow: hidden; margin-right: 20px; margin-bottom: 20px; position: relative; box-shadow: inset 0 0 1px #ffc; float: left; background: #ccc url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAP5SURBVGhD7ZdBSBRRGIB319VW8OBhAwMhgwIPQgpGHYoMDeoYeAkSDBKSEIw8BCUd7FahgZDQxZtBFw9BRkIGezA0FAo0EBIyCCrwILjq6vb9M/8uM7szu+7qaAvzweP9/3tv3vz//978703Ax8fHx2cvBLW2sbW11R4MBp+o6sjOzs7zioqKIVUPjZDWNjC+iqouV2FMNfWh4+hAKRFMJpNhtkxvKBS6iC6RF2oo9aboyrKWw2CNLfypvLx8KLi9vT2IE73aUWqMB4n+b/ZzVBtKCgKfCCYSiaTqJcmBO0DUVlnxacoK+/gn395x2uoo52iL6LBdc5AOvMHIZ+FwOIahCW1LQ18EW67Q9wC12WzNj+cOYNgKVQcZY8psyc/GxsYtVmYQZ1JZ0RWvHYiVlZVdw5A/qhtgYAPtjWwhSR6zODfPmDWz10THvEbMmc69dGAJA5pShskWweABym2XyE5hS3ckEllUPbC+vn6SLTfDeNdT35OTGGMTnC8SecP4zc3NZvQ52vtcjBdacHiOsX2qByorK5eoOkzNGU9WACNHMKZbZCJei/FfckUxE57p4aI4rGoAGz9QtZiaHU8cwPhjGPxL5Fwvd4OViuN0U2o7cdhKdnprdGbgxRaSNJkyvpOqIOMFno+w91+oGkCexCnbR57C1QEmGWIpLxDNE9bCRJfoG9FhWdAXU1Ei2apiwfDseYpxsDFngjJpdGTg9j8wjLF32YcSzWVrkXxOXzeTv9LhNmj/pqLM06hiwfCs3JIbVBVdzpMsHB0g8u9UdIUJHcfggPEi6jBV2oBi4DBLP49Nf1W04egAL5e/rpy4jcEx42ZLnWCM7QArFOvzOHNERRtuW+iR5G5Vs2Bp26jumZodSZsqyjzTKhYFH2/6eeu8VtwciOLxDIb+IJN8txZpo/89xfFA4rmzKso88yoWDNFf4fn0CiCfU9HGvp8DvHiNyB3lhXHkKPMvIBfzw3STeUZFiMfj9cgLRmsGjiuwFzC2ilWS/C+yRLBL5AIZTxkvkPnuqJiFJyexfHwYcAoHVkXnVB2g7aHRmZ950vRldT51oZNVlKyWxb6vgMDLohj9UlW5WvTjwFWKYy4X6JPD6iljz6SMpy1C9MfcjBe8vE5L5ujnMHysqhhUzfa6gZGnkSXLSSL4yrjP1BOMnZVxAv1hgjCG2G62OOOpAwLRGyUzdVFn/Ua6gfE1anzee5QnW8gKxnRizAKBMj7sXDA2wvlzXzIX6q4ugZ6vgBUMlL09wZb5yKrI9xCnVNNei95K3cZK5f0PtnKgDnhBCK8d79mlQoglS9/fS5DFEGmtByHGSuw6S/wnzJIcrqvs4+Pj41MMgcA/8Fr5zKgSl7AAAAAASUVORK5CYII%3D) 50% no-repeat; display: table-cell; vertical-align: middle !important; text-align: center; }

.image-collection > div > img, .image-collection > li > img { width: 100%; height: auto; min-height: 100%; max-width: 100%; }

.image-collection > div > .overlay, .image-collection > li > .overlay { position: absolute; width: 100%; height: 55px; overflow: hidden; background-color: #1e1e1e; color: #fff; font-size: 8pt; text-align: left; line-height: 12px; padding: 5px 10px; opacity: .8; bottom: -55px; }

.image-collection > div:hover .overlay, .image-collection > li:hover .overlay { -webkit-transform: translate(0,-55px); -ms-transform: translate(0,-55px); -o-transform: translate(0,-55px); -moz-transform: translate(0,-55px); transform: translate(0,-55px); -webkit-transition: all .3s ease; -moz-transition: all .3s ease; -o-transition: all .3s ease; -ms-transition: all .3s ease; transition: all .3s easet; }

.image-collection.p16x9 > div { width: 220px; height: 121px; }

.image-collection.p4x3 > div { width: 220px; height: 165px; }

.image-container { position: relative; padding: 5px 5px 50px; background-color: #1e1e1e; width: 220px; margin-right: 20px; margin-bottom: 20px; }

.image-container img { width: 100%; height: auto; }

.image-container > .overlay { position: absolute; bottom: 0; left: 0; right: 0; height: 50px; font-size: 8pt; color: #fff; line-height: 14px; padding: 0 5px; overflow: hidden; text-overflow: ellipsis; }

.image-container.light { background-color: #ccc; }

.image-container.light > .overlay { color: #1e1e1e; }

.card { width: 75px; height: 105px; border: 1px #eaeaea solid; border-radius: 0; position: relative; float: left; display: block; margin-right: 10px; margin-bottom: 10px; cursor: pointer; background: #fff; font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; font-family: Tahoma,Arial,sans-serif; line-height: 18pt; }

.card:hover { box-shadow: 1px 1px 1px #ccc; }

.card .suit { padding: 0; font-size: 80px; position: absolute; right: 5px; bottom: 30px; }

.card .small-suit:after { top: 5px; left: 10px; position: absolute; }

.card .small-suit:before { top: 28px; left: 10px; position: absolute; }

.card .suit:after { position: relative; }

.red { color: red; }

.black { color: black; }

.card.two .small-suit:after { content: "2"; }

.card.three .small-suit:after { content: "3"; }

.card.four .small-suit:after { content: "4"; }

.card.five .small-suit:after { content: "5"; }

.card.six .small-suit:after { content: "6"; }

.card.seven .small-suit:after { content: "7"; }

.card.eight .small-suit:after { content: "8"; }

.card.nine .small-suit:after { content: "9"; }

.card.ten .small-suit:after { content: "10"; margin-left: -7px; }

.card.jack .small-suit:after { content: "J"; }

.card.dame .small-suit:after { content: "Q"; }

.card.king .small-suit:after { content: "K"; }

.card.ace .small-suit:after { content: "A"; }

.card.joker { background: #fff url(data:image/jpeg;base64,/9j/4QAYRXhpZgAASUkqAAgAAAAAAAAAAAAAAP/sABFEdWNreQABAAQAAABkAAD/7gAOQWRvYmUAZMAAAAAB/9sAhAABAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAgICAgICAgICAgIDAwMDAwMDAwMDAQEBAQEBAQIBAQICAgECAgMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwP/wAARCABqAEADAREAAhEBAxEB/8QAlAAAAgMBAAMAAAAAAAAAAAAAAAkHCAoGAgULAQABBAMBAQAAAAAAAAAAAAAABQYHCAEECQIDEAABBAIBAwQBAwUBAQAAAAAEAgMFBgEHCAAREhMUFQkhMUEKYSIjFhckJhEAAgEDAwMDAwMCBQUAAAAAAQIDEQQFABIGIRMHMSIUQTIIUWEjcRXwgZHhFsFSMxgJ/9oADAMBAAIRAxEAPwDfx0aNeOVJT4+Skp8leKe+cY8lZxnOEp7/AKqzjGfx1gsq0qQKmg/rooT6aqbsnnzwW01epvV+3+aHE/Veyqz8Zix692PyJ1FSLvAZmogGfh0zVUs1vjJ2LXKwUoKaNh9hGXxCmXkd23W1K+bzwx9JHVT+5A1v2+Lyd1H3bW3nkioTVY2YUHQmoBFAfU/TXOSP2EcTjKSPfdVbq1nyAr5NjlKniT0dsWj7HhArDAx8NLz8NMWWtT8hXoWYh4mxAEPBEktmYZNZXhrwX5Yr359/Jfgv4+2FhLyKC+yOWybSfHtbJEeQxw7O9NKzuiRRJ3EVSSXkdgI0ZVleJ88F8W8k55dXMFl2rWC0VDLJcbkVTISI1ChWdixB9FoKe4glQ00UTkJrXYlKi7vW5RwkSQdWGVDK9nmwQcmyyp4iMmo9ox1Ij7beEqS5ha2H2nmXWnHGn2VrkTxX5Q4t5g4Rac74jIzYu53K0bgLNBNGdssE6AtsljPqK0ZSrqSjqS3eX8TzHCc/Px7NoFvIT0Za7JEP2yRkhSyN9CQCCCrBWVlEhVq4R1mcMQGhbWBnMoay4rGclIb8Uvut4SnslDbisfjOfLwWjKsJUrKEyLps663o0aOjRo6NGq8724r6N5LkU5W7aUNfoum4sYrNXmiiyKdZIO2tRKbJVrvVFuqgrfV5p6vAKLCNYdaKZGUG96gBZ4hbT5JwnjvLL/GZHOwvNcYi8+VbUkkRVmCFVZ1RlEmwkOgcELIquBUaWcTyDK4SG6gxkgjS9g7Mp2qWMZYMQrMCUJpQlCCVJWtCdUK+ycf6idQaW1HrPnfpnj9J06XhbLo3jDqrGoICZvURHSNbga/M1PjmBV4Vmy6djBgAq/GOzcITX4uCIXDJIPCzkFeFfKXmNx9v3L7aFNdop1JALUFPT06saKDSpFRpU41iOV517iXA91o7aISTv3AqIm4KGcswDGp9qKHkajbENDTI3e+JWx+KG2H4D6yNj7UM4gcnpV7cxtUSPYrOqnAGaskYHbnDW8SkDVtiQd8p3IWp7VhCKVN2SbbkIbFNIW+gqZhWbIXVPzXluGYS2n8m5CSWzmkwN5gjuMYITJSwSxXCl7hF2WPxZppI1UyTJKQjsUSN5w4paZ25ijwV2FmlS7ivVZa7S1sslFekdYzMsojWQKVQj3EJIzxsjv8A9lt54uWReiNfVaAtt7tlyrTw8ITHWS3GEEylZbDkoOEr1OLHkZecnj0xSYxbThraWg3VYGfSShwep/4a8z5txDxTcYrhOPiv7vIZu4uVeWphCER26oiq8TNK7RFm3yJsoqbGdxS93/rD4t8p2UPkHzHnpuPcctsZcLAYpIFnnEcu7vN3Ipz8S0PyBN/HHU7yJYhFJtvp9dP2QbP3Tti76W3TrUagbYp1fE2EBEAwFrpKWa+x/qIZsFfahapYq0Q9nEXfAJARanVDyAB605YEyIl2Q6A+MfJPJ+SZi64vzbHpY8gtow47ausbpUKaq7yMrg9T76dabVPQVg/Kv8WvHfiriOK8qeEuRNyHxrkLr4khmlhmniuGjeWKRJbeCCKW3kWORWrFHJDIqL/MJHMLu6jsyeIlh4cyMe9QlQacZWo8xwhpgRCHH/Ekp5xh4sYdHjlHptKfX6ikZ83HMTd1rqiZ/bVjevWjR0aNHRo185P+UP8AY9zIov2awOiaZM3/AEtq7jjrKCmdTDGBhF0rb1i3dqyzQext+RMTYaeJE2TOKvsSa1gO4S5YQYR2CmlR5IBsjLDoQc3jYsxC1he7/hNtqFkeJmod3SSNkkWhAoUYVI93QalHhYtLSx+VEFbISOakoG2BSKIN1VO6m5gV/QdR00y/iB9l2q+SXE/j+rT9cPum6KBxY4ncetpkX3WdmgKbqnbsZK37WVsutyko6OiqD/zrYEsOubgF1+x5Jn2RMxcomqZHJMjoz5/xHh/Kre0wvIMdjsjYW6IoS8hS6MfoN1bmOZSxRQe45aQlep2u2538XTkeHW+ytu80KzySvEVkEaz7GBG0bx/43YLQqsYL7as7KBAHAhNSm/sE57XaQnq9f+RWp6lXBtF1GYthD4ZNZ2PJXWctMxWhbRNWO0SpERDB1aJbPXN5yxFy2BSTh25XD47Y4Zxaz4BhshBwLH2i5JEkfGWrskcUky24pEAXQj7ZACJEKqHq6qGkEn+YfIOT5hwvieGzV1cw4KCz+JkDbx+wJFezyxNKYwqN1aKYoYt0kgSdhLOA5efwT4k1+qcl9lcxdkpca39v+A1m1Z6qJKfJ1LVDMTqjUVZuNBrUgPKsw9mVI3jW+SVzL61dhghEBsM4ycuRmXC4NxejkuXVRyWW0SKQLQIg6MyrR5ASW6M29/T2uynVf835KyNxwKDxbiS0fD7fIyXhLNukuJirRxsx2LsjjjZgkQqCWLuSwQI6Ou04ZDSVGxkaGhp9xwNAeHC3MgPGyJjIr0jIN5Nefykhh1x9v0leeMtYz2StS3XqL9SV1nWdHRo1T3lTduTNHldRSmi61AzdCRNWF7eMhJhCnycHBtCxI1UeiwXJ0CQkwiJU8j5AYIbBCR2sF+/EbEWLIt/PTcghELYKOKT3jubz6LuQGg6E+wu3tO6qqoB3GiziIsLKJxl5ZI3ERMW0GjODXYSFbaXHtVyCqk+4U6rUrmFrjg3zi04xTObvF5vkbOQwVrO1hWdc0O8Wbbcj7CMhrlZF6LvtEVDXPXwM/K1CNhpg9uxRNbMkUAxsrIqbLZYX98hk7SyhBuVkkuSrFIokaSWTaKnYi9adVBZiI1ZlDstRpX4nichlMyljj7yzsLZ5I1kuL2dLe2iWSVIi8perOI+5vdII5rjsrLJHEyo9MmXE/jzp7WfLLZnCqs6Z5cSkIHBa52nxk1pzI1lF/wDe6Vr4Cp7wgL7IygVGL15mkWEzam4bPK1M+JjjpZET7pQbQE+7FzkdAvLs3nLIXuU45g7qbP5JClnZTGKGW6u47VujtNOsEKiOBQ0js0awxmRA0+0m3+VwXG+IcPt8ddcowuVms7iQ3l3i5pbiyiFxNAYBHI1mTPGyQSF7dfiXLTSPCytbGWOZtD/A3Y+hStw7K1VPwslyx9zsjdGw2bXZ3bXs6/bJj9cHyVdrEvWKPFSOJmiCQFjjoWuVKJKiYiIi7Bj0CRzk58awca8cfltl/IMHlvn7YfHjBqezjLd2uZ4rdutza2iQRXUTXV3CFd53mnknrDboYwWSFGPMvDeVtLfgl5NdxccyM8ayXYgBiQmRYzdSK80dwY7Yh32ou9WR2VG3AvcTiJy6zsZMyZJV5FG2dr+yTdX2hrPB8va26LMRdvt9SGhy7PJ1KptSMm5imvqLFSG0fClpdCLbaJazhd9OEc7sOYwzwLDcWmds+38q2mikikhMu/t1DrQhxG/2s4UqVLGlTWfyBwduE5f4lteQ5HDTANbXcSsizoUjkDdqQCRDtlQ+4FGBDRvIlGLytabBFvEUy7hOWzMMKcWjPpdlNtLQypWM4MKecz5LxnK1JbwrKs4TjOE+WX6DXTB1J3WdGjo0aoD9iPM2K4Y6aauL9JqW1ZSedlR86ssFks8HJWSqxoCcWeVjGK1qzajD8ZCESYDUgRNNQ8EOg5pt6RQUQEKWzebcsHEMV/cFhFxN7iIt0oZlQAuy9uCf7arUydqIbhulUlQbC/jd4Hfz/wA5HEpr6fFY7+NTerBazQxzzPsghl+Xksb7ptshjjtTeXkgik7NlKiSvEsXg99+nF7eU98JyrrEfx35EmXcugaydr9Mvt/rd5pN8uP/AMVARdpr1WnJqDmoh5IYU45KNgQkiSy3LBusILIi4hl4jyhw28sG5byFILS7s7eUd4IZ2SAhJZ1V4keVATEhkioA7Rxle4VG2YPOX4WeUPFGXl47xiWbL8fEYuJ1k2WbpJbpIDM0U0qxSxlGle3lid32vJEyhlLSLJ+m77RePO2Pti5K7A3XQqPr3kD9mC8XDjxsWyiSY10htXa8Zr+v+PvGGRNj5O40QKbv2pKQNOEnCPweZGzRC48xUgQ/XBBXTgc62d5NkG7cBw1hILaKaoMnyQAblFFCVUCSKMmq1dGUdzd7I18q+LLLxz4f4lMby+HkHN20uUvceY2S2jxsx2Yi4MhCCWaULdzind2WtzEHFuyv8h6u0X4vmrqndmt+U+varUbJQtsUa26bh9R7KtFoCmndd17X23dV3UbalWcp4kzNFXk0k+HxKAxgsaySHkqOeyh50vXwvJ76Rr6Pl8FrY5KOZVgEDtcJJAYUdWMwjBJ7xnB3RRBVKjYekkjY5zwnh9hDhx4myWRzuMuce8l697ax2EsF/wDJuI3hS1aWdI1+ELP3R3d4k8odlnG340FR9P3iBvz1o2IJQILXMpeNs7elrhExAtfbJOsQ+zbMI5ZLCXCQNfYNnr7FIFmXFkocdfWarKXikJy+6vcfbHywTXljEkUk1zJ3SFCtIySOFdyAC5ZG3oWqQr06dRpgc6xM+EzMWOmuheIuPspFdXLqnes4JHt1NSK2sjNavt6b4GAJAB09TQGIByr4Ki3cOFOsgtkIyWQ9hlLY6s4Q2O49kNlS31OZWphvHn/albjim8YbcopplH16+up969aNYwfv1/kRcyvr95OWjhlxu0hQqA8xrEWcY5F7XhbPdZm0DbMqMWutXvR1TJxUKFHO6ttTc2A6VMIvUJKzMf6D4bGADQydaaZkO1af1/x/v9P6aePH+PWmStjd3TvTfQKtB6etTQk1r9NtKepr0wwcjeeXNHl0/KK5Mcpt77oi5O6yGw01C87MtUprmCtso5LLekqbrD5NrXdDHCZnDBgA4SMjwo0F9QojTI3ZlOqZHJqSf9dPu2x2Ps6fGhjRgKVCjdT92PuP+Z1cDjrN7PrfC3aXLx3alXRMcfNn0eq6bgJmKXO7BxskyZoktFS3yUgcVFqq9ZjTSZAUM+ONbkXYx9hTqWBsDuVC8g2vGbvzfh/EMWIvza8jxl3dZGaOTs2Qs4Ypo3TYKPJPNKI4ZWhkha3WaKUCRpCVubxv8iPLt74NynFMhPjMvicPGI4Z76OSbKWUVy0NuEguRcRBYA0i9uOaG6U1KbUiijCT0J/z+H2jqflHE1vYsTRL5MpuurtnazKDq24Gl06RKzEx1Ov5oU3H1XaurpwwSFlz2lHvgGB+on3TCo9bxxG55Bgnl4vmru4ju8XOO8rFokcl6/KhXdUwXLK1zbvvYKX2ApcJcIlheUcw4r5v4fbc441hcLc+VMnjorO8eW2DytcxI1rtdFV2EUkJ7CMq1njRopxJDHboHH6S2Hq621CFfloLklDbF1hAWS2NuR+1d1CwAabSeMokk/W9T2gQCRFgyc23iIi8RhAMIythkIMVvCWETAZjcwrexrCba4QMtY4wQGFfu2hVND79o6mpqdc0rmzjxWRucJdLILyymkjYI8siK8bFGEZ7rb1JACkh6qKj0G7r/r52RsTS962dRdrWuwWGGmtmTmsdOWi8VcGlSF0CrN8l4QK3ORsoZbp6ej9gVSWrktDyKxqoRiQenAPZujC+5z8eL8gyM2bS1u7N7WZba0eR42klgfvKyvEC8EIElvPFMjIjTgQNa3G9TcCJEfk2Hsmws0hkEiETvCJdvei7Z3ULJIxPdXbTeFq3c9rKncOmziXsuaHsYUS24SZgjwFcbU+rOXncuJXlhIrGWOyHvFKGm+7nfKcZVnOf0nCMmtPpqBz6abzj84x+O39M9u+P6Z7Zzj8dfbWNUM58fW9xQ+xfT9y1nyE1RR5y0TFHmanr/dblShydv6ZkzHUSkLZtb3n0hbPCKhbOIMe/GtGtxc0204FJMFAkkju+HRXFD663rHIXWPmWW3YgBqla+0/TqPT0qK+or0180Tnv/Hz+yP65ZK5bUc1iByC466ylF2IPkBq6Pr13gG6xEuS9gGsW0NITjk3c6jGQlegMFWf5OIladHZcUM5LnMKw66ntFIpO4dAfX6H6/wBf26gdf2oTJFnyLG5JfjMzRXEg20PtNSKe1x0r+nUN6UFemuV2tsil8tOKobOnaNQdT2mScEHveo9YUovU+s1X2oOUIiLnI+CYs5dDkZOYfsE8wFIrbxLezKHHkC3ENDsiV0zmUvMH5YtMvyL4nxg0scDpBtljspbc1Ly7nZx8hTvjNArW5kAKSqsd9Px58J5fnf46+QZ8JHNc5WQYyGz7kyM8t5a5CCea3jDCMJ37eW3jjDOVkmkVfa67nohXiN/ceNl2qk6MuJy33KdbbcJKIjqst1mIpNQkrpatkVQSyJm2Nd7EpcVSzyIywRD41oi/a5+ONbddxhckYu1wHkKytc9kLZP7lbuaMGZZECtvETSxlDJC42l4GLQSsKSROBTUF+U+G5fwbz2+4hbXjvB2lVbgKIhOpURzHYSxiInEsaqWMoX0arHTZthcqv8AZN6O7umjgdXw22qlx8KxW2LBdqpFRE7fNBUXac2zPzwDkZMiV5NqS5hqaVhA5KjxCS1NBEFGj/HIXyXufnxqKu1F3gbasSAI2ABUhhUkmhDVHTdWmm5F4xkxPiWx5vG7m8e7a2cb/YU/nlUltyvG4QW6IoDRncahHX3WrlbxyJsl0p89Qdlaz0hXKm/RLhUH77e5j3fIq+z8/caXTtNaysNNr1nCrodxkIB8XGbqdXBLMJIAvjHrq0niZJ2Exvx7CTIQTwR3cVWq0ixqoiBdxLurtZgjbg2xQock9KBu8cznHoc4tvzC2ubrj88EkUqxxGYxrcoYBOjDaaQtNE4eMyO0hSNRuYka09Ov2nTu0o2Jt4GYmSkAgpEcXBYR7uImScMHFdKXCmSTDZj6wn23hXMpJbU3lDqG1Zx5STEGQgONpp6VBp+3Qkf6Ej9DquLep6g9fUdAf3AoKD9OmnlwMyNPxYsoJ6nokowrHqMPsZ75SlXdKCG21qQrCsZSrHkhWM90qUnsrO3r5iv19de46NZ0ozkNtC7TPMJnVV0fsVf0lCQTgw8bH2y166HunzGsZeyYsw9kq05VZ4s9i/4Ahw3RCXfZkhLQKpsh0vHXPbyz5PaT8t8L4x5/l77BeLY8dI6xx3k2Pt8lcT25MRurm3khkeAzdyCON5hC1xbGIo3dcSWE4rxqOPxDecmwVpb3/KWuBuLQJcy20UUihhHHIsihwn8rsse4Ryq5I7akYfOXGi6Jxr5OciKVq2uKrNFXahLVV4nwcWwAxP0+uTLUc04+SWYc1BDnMhqMIdWZI+3UWWt418p1a95WtZoOXriXnmns7dlRGlZ5CqTUudnccEuo7pCAlyq7UFFCDXY3/wCYPIDH+PfJ8swH90GVnZQirtrFZ20YNAQw2uAzVNQNzDrU66Hht9fUlv3YnH/YNvhZD/nktVuV4d+CYPAzm1VnbdMrGlqzT/dA2WItdY+chrVbJDMgI2RlpMU2z3HWWwS3YnxXijbYqe+KlY55hHGNxNYrddm7bWinvGcH0LAKeqhSec35reSoMpyyy4bbSJJPjrf5VxRIyyX2RuDdOguUZzNHHYQ4wdpyPj3LXce0P3RpwG6f45c1sDQFRjdQWRuXsNe1BrnWez6/bSJWtw+7AtR1evV+q26JlYkqRGq11GHp4OHod1T8MYsUV7BAJQfeT3eXcKy13k4+T8Xn7WdjIFHoVZOikdfaPZ6qRRvd1BbSN+PX5I+PuP8AGr7xF56xMuS8XZAs6TWoUXdlKXeUMpBSR0Mzh96P3I9qjbKiRxIxsH6+XNlzQvJHeNMr9M3pL0C3Yf0dT5OazourbR2ReS7bdZLYItZ23bY7aSr1Wa9X4QmuyDhVOCKHnJJyFMKm3H1ujH2+QvkW95Iim8ktey9uyxvCgevdC+6XpKmxJkVhG7xlzGSwbVceW/8AFMc0/HODSC+xltkZZYMqTdRT3MIVFgT40gt44NjrJN3TAbmkscBnKW4U91qqvrjNyF13dZzq7ZGmB4JLPP8AlUloWIA/GFsyzjyyXY9yJ9BbPbLa0Ix4rQjKMpw4o23sS5q1fXUZyRyQnZIKNp8VZEjw4QDEbj/zEMNF+Xm6v1XX2m1OO59VbmUqcVjurGO2PLv+MdbevkNe+6NGuJumuqTsEZhm31Wu2JwFspuMJnISNl34zB3t/eZj3JAYhQeSvaNeeW8pyrLaM/qlOcNbknB+Gcya2k5biMZlJLKXuW5u7aG4MEhpV4TKjmNjtWpShO1a12iipjs3msOsq4i7ubVZ12yCKV4xIv8A2uEYbh1PRqjqf11kU/kA8JZ6m1uzcldeOMkU7W9Zq5m1h5tTgWTl7Qt0frSvKqporZD7svGFxgeHwVtOM5DcdJWUO7hkcyr/AJD4ZnL7zlkLyG3mHFTgMbeyXbFjGL4XdzYi1RNgEhktoYpm2SE24hZpQBcwg9Gvwe8+xeL+L5bg6wQ3F5yZ57YICUkSO0tpbhpd4Dhdwu5l3Oq72WNU90e9Vs/Vhy5mK7eK3recmY02Ej4gpmoDHMuvTCX44gaXchRZERpxL0OiESaYyktGFjNh+ih1DTTTHUg+NuR5mxzv/FMoyvjJIpHtzsCsjK290JAANAXJ3FqkKVIBppa/MnxB44zPjMfkBwuO7t+aJkbS0yluJO7A8TQvEt4yHcYSWitoozGY4Wq4eNpmEr7EL3yQLntEyMbUoOJlzG6mGdZo9+VkBXDK+8Y0NIQwY8I3LTqDJeOENQvChkseBDLTbRCXXENS3yPNvj4ljiVlV94Mn27CEr7WI27vctGrQE0oxquuaWBx1rkskmPuluGaU0RY0PvIUvsLhlKmQIVTbUbqlmRVLa8Zqm2e669gYCBsE1RJStX3V5khLLOCSdLVrT27KZK3JgRVBtU0OuM3BUqbIx+WyCsL+MmktSgiHkmRze5dR3N1aiK2kaKUTpuboWKwzqZBVGp/IsZFOvtcqyqahXpgLyw4vl3lylpBkbR8VcRrES4jWW9xsiQSgzQh+5Yz3CSh1Ub5bfdDMyGOZqO8xTJaI33rotI5gIpVBh4sQhzD+Ry3Y+1WNwpPrqabUS6G2e0hSEr9RDfp/vnGFKIHuLKKAn9z/jpQaYeSdmlVTTaq9AK7RVmJoKmgJJPUk9epPrp4Gjz1SWt6+S4+6+7lhOHFPd/UTnLTLiG85z374Q04nt2yr8fv+2N8emkylDqW+s6NHRo1BG7uPWut6aj3ZqC2iHCV7fFcn4C8SEQQN8zh2dpgdFRPQ7k2HNw4E3BREYG8ApwN4Rk0Np9xhxXqeaOeP4wpfpDH23ycvcuGHUvKIIbZZAH3KGWGCFVAXbWMEqWLEuDBcmynHs5jeQWWx7zFTRyQK4OwiOZp+04RkZo5HZxIu9SyOy7gCKfNF07ruycTOfUtovbYqIq26h2JsOgz2WY+XbBlzo+CscJWZ+rpnoeGlCoG3YPGkIU5Y7Dh8YcO+ltOH8ZzX3J39l48yUnJs/FLNHj0kJEC9yaRyhj2xqXVaOCCA7KqjqxBFV6Kc95dNzbwDdYvCuiQZs48sHYxxRqlxHc1kI3gmNlZGFWZetSzeuoCu8kqQNpPUm3NXytzU5siTmdcF2hUDOTYkJbJI21xEIu7BzsiXJPQVylfTg40V1oEJyaj4KLYJWSZDxeJNs7m05nxoZ2zeWLGXKbmtrtkTtSo6qx71r3zbOrIzCeOSaMBu44oSRzkvsZf4vNLa3DxtcW4qJVKLtTt1BRp/jiRAOhhnKqSOu0Bw10CeZAWswffW+Gm5SGevDlBCi0QlukrNLSbrA51kmArSIGZV6zGV9uLn2A4+fPjUSigx/bnCNOggOr+Pa9t/j49v5bf44YuzOZR7QygvR4robXXdNHIHUlA4kYu52VyNlLZdxY2ivFl9y7do2EAJVHaMxk0disUc0XRNkoDlY+S5PSjm84LS141+NInR8OZZHjBCWiB5SMdmBKK+yGaIThTTaw0gZYU8yt0ZxaM4accxhK8rpjcg7eh9Af+tP2+mk28nimCFOp61H6en+/ppxHGJ41zVFfRIMrafQGxjGV4c75aR6oyWkqWnGMpYWMpOMJ/t/fGMd/zvJ9v7aT/AK6sN170aOjRpYv2XXS1xtRo2vYywD1Sl39i8L2FMPpKw2TEwgkAILCynt5uDwVUCMWEgqZDU8yk4YRAzjzY7xGF0P8AzZ51m8bc8K8T4/IyYnDcyzYtL+7jKJJHaLcWMMu2R/aqBLtmkrtB2pubZuR7AeCsLaSDNcve1W9yWGsu5bQsodWmaOd1Owq26SsKiMgFlqxUbgrLl8tGstbb45Eayt5r/vjq9p2rbSqmMM1P/ZBZtDdlrL0BYLjW61BFSUUHNB/MZELw2KxOKMQy0yK/kJuBeV8j4V+ObcZ5H4wGRPjfIXFm97bzXE1yVa3vwtxLFDK5UXMjWsiSlEo9SUCqItkqcduuVc3xOe4lyCWFL7ZIqEII0KvGskT0SgGwNEUO7dtJVixZ6uf+s3jDDf6ViJHy0/X1y9ydMA9iOwC3HWezTE45GrAU+6KoePDm8DJ/x/5vQyrwThSkp6mYHDWuGsvh2x3IZZJDWlayyNJQ0A+3cEWoJCKo9RqnuTyVxkrs3c5o5RVoPT2qAaD6BjViB0qzfrUyfu36850S3kj0mr1MDXDEhEYpSYAs4yzmx2fbMOQlyCNgVe2bqRTaWoRYki+2UPIkqIHwW2op/wBxYhYMnNkFZj3RWm5gNzO7MdikRehVQxQyUU1ehIPq8yT30SRyAL2wqqBXaFVAvTcW21oPZGIkBBJWRm3KzrRmmK9Wdaw0NLwrLpSBlNryQN6CsYU22lxxLf4wvu+jOW3M+ScpSlbf9ucZysqKLTSXqwUPDgQMcPFxjCRxBk+LaEpQnKv283MtoRhbmcYxjOe3fOMY69aNez6NGjo0aibbmmKPuaFDjLjEoOJhXTDq8egggMqMkCgnBcqwUGtt9YLq8tOPDqypl1bDSlpVltHaMvJnhzxt5hsbXH+RsYmRt7KYywHvXFvJE7ABtk1rLBMFbahdN+xiiMykohDn4zzLk3Dp5bnjd01tJMgVxtjkVwK03JKjoStTtbbuXc20jca54eXfF6s8adkaJhA34+Irc1E7JzWkBKJQVE5hHa0u4CLOlHiB1wEuDYI9SE4aznJCVuPrU6hLfXPj86+GnifGuOYDh9o39hPzVihBluJXupJ7aWoZ3e4mmMjgxb5C4d2WM0YhLGeBs2MvfZXJZqUf3Njb73osa9pIpI16JSNERFO4qi0FCzEmhYR9V65JVImcksFZQrL2XCpFlrEinyK88NloDJfBFJIV4rc8HiUZyjGG1LTn1MdOONnKHBWf98CDN/Fh+QFoVE/bXuhdpI2iTdShIpShpqrGQFoL6YWBJse8/brWvb3HYTUA120rUA/qNNsWhDicocQhxGe3dC04WnPbOFY7pVjOM9lYxnH9elzWnrz/AE/GP06NGjo0aOjRo6NGjo0ap5y10ENvljXA8pCoNiaDNTlwZkwSnlTw1kIim6rDRWIQaunEy1YMAsR8gapqREWOfEx+cinNqc9uzOT8PxfKsriLrLW8M0GKu2u4y1CwnRCkK7TG1UDObjeJY2Se2tqLKpbY4MNnrrCWV/DZOyzXtv8AHan29p2rKfu+4qDEvtNFldgyMq7pR0VpqM05V0QoaEIeVjCXMNOLy3hKHHO2cpQpLGcrTlPbHjnwwntjPbPbDxVdop9dIBJYlianU5detY0dGjR0aNHRo0dGjR0aNHRo0dGjR0aNHRo0dGjX/9k%3D) no-repeat 10px; }

.card.back { background-color: #b91d47; background-image: -webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent)); background-image: -webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent); background-image: -moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent); background-image: -ms-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent); background-image: -o-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent); background-image: linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent); }

.card.spades .small-suit:after { color: black; }

.card.spades .small-suit:before { content: "\2660"; color: black; }

.card.spades .suit:after { content: "\2660"; color: black; }

.card.clubs .small-suit:after { color: black; }

.card.clubs .small-suit:before { content: "\2663"; color: black; }

.card.clubs .suit:after { content: "\2663"; color: black; }

.card.diamonds .small-suit:after { color: red; }

.card.diamonds .small-suit:before { content: "\2666"; color: red; }

.card.diamonds .suit:after { content: "\2666"; color: red; }

.card.hearts .small-suit:after { color: red; }

.card.hearts .small-suit:before { content: "\2665"; color: red; }

.card.hearts .suit:after { content: "\2665"; color: red; }

code, pre { padding: 0 3px 2px; font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; font-size: 10pt; color: #525252; }

code { padding: 2px 4px; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; color: #d14; background-color: #f7f7f9; border: 1px #e1e1e8 solid; }

pre { display: block; padding: 10px; margin: 0; line-height: 14pt; word-break: break-all; word-wrap: break-word; white-space: pre; white-space: pre-wrap; background-color: #f5f5f5; border: 1px solid rgba(0,0,0,0.15); }

pre.prettyprint { margin-bottom: 10px; }

pre code { padding: 0; color: inherit; background-color: transparent; border: 0; }

.page-control { position: relative;

  • zoom: 1;

}

.page-control:before, .page-control:after { display: table; content: ""; }

.page-control:after { clear: both; }

.page-control > ul { margin-left: 0; list-style: none;

  • zoom: 1;

position: absolute; z-index: 5; width: 100%; background-color: rgba(217,217,217,0.16); height: 31px; }

.page-control > ul:before, .page-control > ul:after { display: table; content: ""; }

.page-control > ul:after { clear: both; }

.page-control > ul li:first-child { margin-left: 20px; }

.page-control > ul li { float: left; display: block; text-align: center; height: 100%; }

.page-control > ul li img { float: left; width: 16px; height: 16px; margin-right: 5px; margin-top: 3px; }

.page-control > ul li.active { border: 1px #ccc solid; border-bottom: 0; background-color: #fff; }

.page-control > ul li.active span, .page-control > ul li.active a { color: #2d89ef; }

.page-control > ul li span, .page-control > ul li a { text-decoration: none; display: block; float: left; padding: 5px 10px; color: #1e1e1e; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; cursor: pointer; outline: 0; }

.page-control.tabs-right > ul li { float: right !important; margin-left: 10px; }

.page-control .frames { margin-top: 30px; width: 100%; min-height: 50px; border: 1px #ccc solid; }

.page-control .frames .frame { width: 100%; min-height: 100%; height: auto; display: none; padding: 20px; }

.page-control .frames .frame.active { display: block; }

.page-control ul { display: block; overflow: visible; }

.page-control .menu-pull, .page-control .menu-pull-bar { display: none; }

.accordion { margin-left: 0; list-style: none;

  • zoom: 1;

margin-bottom: 10px; }

.accordion:before, .accordion:after { display: table; content: ""; }

.accordion:after { clear: both; }

.accordion > li { margin-bottom: 5px; display: block; }

.accordion > li > a { display: block; height: 32px; background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAALnSURBVEhLrZY/aNNREMeTXzPYksHBQdoMGUxbSkXSpK2gULcKCnas0MEODoIOgqWrRcHJujpEonQQh2LrVKVCgxWEtMVABMFCW0iTDg4iqNikiZ/vy2vMX2v/fOHy7t293929e/fuxe36B7q6urwtLS1DhUJh0O12+xH5ihrXFpTK5/Ovkc8sLy9/LYprUdeBDDc3N9+BHcdACgczjuN8wuC69MjkqAP5ZcZu5o/hJ+o5qnHQ29sbxtBL8Ri9Ho/H54yiAXp6es6yLgp7EkdXq9c32dEgHA4PE8ksC1/lcrkrKysrSatqiEwmkwoEAk+2t7eP8+1kW1vbj3Q6/cGq/0KRh0KhXzgZsaJ9g+8vQFl2pdQZmB0o5x6P550iX1paumc0BwC7WW9tbW0iZQ99Pt/U5ubmd0cKe6CubDZ7W2M9sMNr7K4gIsq7VlwDr9d7n1Stco4mUEfRM47rQBOJxDcJD4NYLJbD1ihORoLB4ClHdU5qUntVy36ArY8MCzgadvA0CM0UVUcKVeOghx8/9NYKS1DOLWtAEOcsq4t2plpP1E8tu4sk34y7ObQ1mFFu4YJVGOgwLftfoPoqLm1/f79/Z2dnTSnyMM8VxUcPRwesNNl5CTieKCdE5ee0UEdfATqBD/mWok9BHUZaBlJWUevKOR8MiWeMVeurwZpOBe+o5TIpXe2jAiV6CQdzSpG23q1eVFQdHjpggr6I7WlHPRxG/XxqYGDgmF1zKFA9UWzO68KZ0qK3nEDwBScRHI6ZVQcEtm4yPIJOY+uz6aZ0wZ/08QQOJumG79UVJd8vMK6DfYGdW7wlbyQrPTg8Eqs4+Q37TC23vb19cWNjI1/U7g1Fbo1HMP7AimufTD0WVMBzFq6qK9rG1RD2xkZZfx66gfGIVRnUOBD6+vp86ud8MMx0EZqFkjxKJnX2EnWqFBlVLfOMY8q59OWo62AXpp/TcjGgjqumaP62wJu/LcznoOnGu3S5/gDwHX69fcclgQAAAABJRU5ErkJggg%3D%3D) 5px no-repeat; background-color: rgba(217,217,217,0.16); padding-left: 36px; padding-top: 5px; font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: .01em; line-height: 14pt; font-smooth: always; }

.accordion > li > div { border: 1px #ccc dotted; padding: 10px; margin-top: 5px; display: none; }

.accordion > li.active > a { background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAKlSURBVEhLtZY/aNNREMeTXzOYkMGxJBkymDSGDua/QyFuERTULYJLBwdBB8HiXBSc7OxQCdJBHIqpUyodClYU8geFFBwCbSB/BJ0kKuavn3t5rX+S2D+JX7jce3fvd3fv3r17MZv+Ab/fb7fZbJd7vV7CbDa7Ebn6GtNHqNLtdteRp/P5/Oe+eBBDHYhhq9V6h+FdDFRwkDYMYxuDu6JHJo5mkF+EzzJ/xHhxmKMBB5FIJIyh5zLG6PVsNptRihEIBoNnWZdiOI2jq3+vn9JcIRwOJ4lkjYUv2u32pUKhUNSqkajX6xWPx/O42Wye5Nslp9P5tVarvdXqX5DIQ6HQd5xc06Ijg+/PQS12JalTUDuQnFssllcSeS6Xu6c0xwC72XU4HFOk7KHL5VqpVqtfDFHoAzW1Wq3bwseB3W6/T6pKnKMK1Kwr5hNerxx0oIcF6T6Dgyx02pA6JzWVSRkXYOsdbJOgkwbbSUDpvmqikGpMGPy48bSthZNEkcDdZspyh8E8t3BTKxSQ9/TwUKD6/ri0sVjM3el0diRFFubtvvg/gEjfjHO5RoELNwfV5R5UoBklnSDIjA9WMajVdSb7V3tSoHAuUEAZqSIp0VnpRX3V+JADJujz2F41pIczkH6+Eo/HT+g1Y4HqSWFzQy6c6kUYX4RNNxqNYze6PXCwN7E3By3IXHVTuuA3+vh7hEt0w9fSFUV+VGDcR+TPsHOLt+SlyPYfHB6JEk5+MHwiLdfr9W6Vy+VuX3swJHJtfBnjD7R48MmUx4IKeMrCEnxeN66R0Dc2xXpJyw2ML2uVwtBHPxqNuqSf80GS6Ra0BhV5lFTqeE5d6HxSinCplg34AgXzQfS/Y6iDPQQCgVMYSWJAOq4brv62MFZ/W5hnoNXRuzSZfgLYkUQRTJGc4wAAAABJRU5ErkJggg%3D%3D); background-color: #d9d9d9; }

.accordion > li.active > div { display: block; }

.accordion.dark > li > a { background-color: #464646; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAIzSURBVEhLtZYhSENRFIb3HgaDwWA0LAgaBBcMggu2DTQYFwwG44JBsE6MBpOwIhO0iahYJgoqBoNhFjEqaDAIBsOCsvn99509mXub080f/t33/nPuOfedd+7d82ItUK1W++AslykYh4PSwTN8gsee5x3AF6dGIDKBAjMsMS4zKpCC3DI+QNmVaBjOwFGYx77SKlGISqUyDh+NaZObAp8JeAdff/THIQPLsMAq+03+Efj2MmfN5i6aXA8MWrkc5kz6NUg0xfx3qNJ9AUMfokpSMOnPIFaOOG+w1hCh+MjYtCzY5mENOZMbgK2HWKVwsQhavUrT8gXh11YCAXuCeCrVkM+N+vzJ9/1iYO4ctOsNwznM+PxoEx3AbuMQpjwe45KMm3Ar0APwZPN26cD9JD4Ldq2NpwAhIuZPwW21571uTA+B9ivYtBBIcekqUQ/8cOo/QCW6YtzgJe8EUgCS13UK92OUQQ2h63OuL5zBwP13/yTcVYl24arpTYFz220qEHMBXqtEx7B+a3cH07Do82hq0VGyjTu5C+AJ9d+RJvaeEugMz8NtDL1y6BTE0TFxSmxtOCcM8AQ6z9ec0AGIkYXvxBwxKQBiGpYxNOyJdqGgxNBJ6jZkAzAsQWXPQe2PtsE8rVzB102KBg4z5lgiScLkpsAnju8Z1OkZvfLvwHEQFqCO8ROYJZDOFm1/MYmmPt83nyO0+pobWn62MHGIIQPdZwtd4f6lCFb7bCmqFcNuaUAs9glLFQdwvFGvGQAAAABJRU5ErkJggg%3D%3D); color: #fff; }

.accordion.dark > li.active > a { background-color: #1e1e1e; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAHpSURBVEhLtZavT8JRFMXBGQgEg5FAYNNgIBAMBhpsEowEIpFgYLMYMBsMFht/gRNHgRn8EzDoCBY2CAQ3g4GAAz/ncUW+ym++nu3swnn3nfu47/se32BgDobDYRie8DEFozAiHXRhB9aDwWAFvjl1CqYWkDGhSDwjykgmL8QW1LgK7cEMPIA3jF/MKzTGYDBIwLYxbfJMkHMIm/B9YT4JWdiDZVa5Y/JCkBtizqXNPTXZCwa0ciXkTFoZFEoyvw/Vuh8wEEZUS8omrQ28Svh8wO8HYiy2iUu3ZRbw2MarMV6srV6tWbihywLPOH5qVUy9z8FXG/MNeD7A8y0+6xBVnOov7mFKBaJ2iHwFns+EqApot90JnQR9XAk2bRItikRUYBt+OukfoAIdFqCLzAOqrwSbNokIvl1XAOri8hWY7xM6KlCH3qPtD45hTZV2eV51KBIjfXOo5fj1iHEn8OUaNhFCTtgQeD3Cqn11FfUrdJ9fmrQ28CjAPp7agx8gpqF+VtKklSFTPHST5k3ygoEiVPUS1PlYGszTymV+ZdJ0kJCxxAZFRps0B+RoQ9VzPSjTV/4bJEZgGeoa161YwCgpM+MRWh7eWU4Vzdtzw9zXFibGCFnoXls4sO5fCrPv15Ya2i18kv4XgcAXTr+7IYi7bgIAAAAASUVORK5CYII%3D); }

.listview { margin-left: 0; list-style: none;

  • zoom: 1;

}

.listview li { margin-bottom: 10px; border: 4px transparent solid; padding: 10px; width: 300px; position: relative; display: block; cursor: pointer;

  • zoom: 1;

}

.listview li .icon { width: 48px; height: 48px; font-size: 40px; float: left; }

.listview li .icon img { width: 100%; height: 100%; }

.listview li .icon i { margin-top: 10px; }

.listview li .data { margin-left: 55px; }

.listview li .data h4 { margin: 0; padding: 0 0 2px 0; }

.listview li .data p { margin: 0; font-size: 9pt; }

.listview li:hover { outline: 3px #ccc solid; }

.listview li:active { outline: 3px #3e3e3e solid; }

.listview li:before, .listview li:after { display: table; content: ""; }

.listview li:after { clear: both; }

.listview.image li { width: 380px; }

.listview.image li .icon { width: 100px; height: 100px; border: 1px #ccc solid; }

.listview.image li .data { margin-left: 110px; }

.listview.image li .data h4 { margin-bottom: 4px; }

.listview.image li .data p { line-height: 16px; font-size: 10pt; margin-bottom: 5px; }

.listview.image li .data .progress-bar { margin-bottom: 10px; }

.listview.iconic li .icon { width: 32px; height: 32px; border: 1px #ccc solid; }

.listview.iconic li .data { margin-left: 40px; }

.listview.fluid li { float: left; margin-right: 10px; }

.listview li div.badge { position: absolute; left: -4px; top: -4px; background-color: #2d89ef; padding: 5px; margin: 0 !important; text-align: center; display: block; font-size: 9pt; color: #fff; }

.listview li div.badge.strech { padding: 0 5px; }

.listview li div.badge.right { right: -4px; left: auto; }

.listview li div.badge.bottom { top: auto; bottom: -4px; }

.listview > li.selected { border: 4px #2d89ef solid; }

.listview > li.selected:after { width: 0; height: 0; border-top: 40px solid #2d89ef; border-left: 40px solid transparent; position: absolute; display: block; right: 0; content: ""; top: 0; z-index: 1001; }

.listview > li.selected:before { position: absolute; content: "\e08a"; color: #fff; right: 4px; top: 0; font-family: iconFont; z-index: 1002; display: block; }

.listview:before, .listview:after { display: table; content: ""; }

.listview:after { clear: both; }

.dialog { position: absolute; top: 40%; left: 40%; min-width: 150px; min-height: 155px; z-index: 1000; box-shadow: 0 5px 10px rgba(0,0,0,0.2); }

.dialog .header { font-family: 'Segoe UI Light','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: .01em; line-height: 24pt; font-smooth: always; width: auto; height: 35px; padding: 0 35px 5px 5px; font-size: 18px; white-space: nowrap; overflow: hidden; background-color: #2d89ef; color: #fff; border: 1px solid #2d89ef; border-bottom: 0 none; }

.dialog .header div { position: absolute; right: -5px; top: 5px; }

.dialog .header button { font-family: 'Segoe UI','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; font-size: 14px; display: inline-block; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-raduis: 0; cursor: pointer; width: auto;

  • zoom: 1;

min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; width: 24px !important; height: 24px !important; min-height: 24px; min-width: 24px; }

.dialog .header button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.dialog .header button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.dialog .header button.mini { min-width: 22px; width: 22px; }

.dialog .header button.big { min-width: 48px; width: 48px; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.dialog .header button [class^="icon-"].icon-large, .dialog .header button [class*=" icon-"].icon-large { line-height: .9em; }

.dialog .header button.big [class^="icon-"], .dialog .header button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { margin-right: 5px; }

.dialog .header button [class^="icon-"].right, .dialog .header button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.dialog .header button:before, .dialog .header button:after { display: table; content: ""; }

.dialog .header button:after { clear: both; }

.dialog .header button.standart { min-width: 90px; min-height: 32px; }

.dialog .header button:active, .dialog .header button.default:active { top: 1px; left: 1px; }

.dialog .header button:disabled, .dialog .header button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.dialog .header button.default { background-color: #008287; color: #fff; }

.dialog .header button:focus { outline: 0; border: 1px #353535 dotted; }

.dialog .header button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0 !important; }

.dialog .header button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.dialog .header button img { width: 16px; height: 16px; top: 8px; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { font-size: 11px; }

.dialog .content { min-height: 85px; padding: 20px; background-color: #fff; border-left: 1px solid rgba(0,0,0,0.2); border-right: 1px solid rgba(0,0,0,0.2); font-family: 'Segoe UI Semilight','Open Sans',Verdana,Arial,Helvetica,sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: .02em; line-height: 20px; font-smooth: always; }

.dialog .action { position: relative; bottom: 0; width: auto; height: 40px; font-size: 18px; text-align: center; white-space: nowrap; overflow: hidden; background-color: #fff; border-left: 1px solid rgba(0,0,0,0.2); border-right: 1px solid rgba(0,0,0,0.2); border-bottom: 1px solid rgba(0,0,0,0.2); }

  1. dialogOverlay {

width: 100%; height: 100%; position: fixed; top: 0; left: 0; background-color: rgba(235,235,235,0.5); z-index: 1; }

.calendar { background-color: #fff !important; }

.calendar table { border: 1px #ccc solid; width: 100%; border-collapse: collapse; margin: 0; }

.calendar table tr { height: 1px; }

.calendar tr:empty { display: none; }

.calendar td, .calendar th { padding: 4px; width: 14.285% !important; font-size: 10pt; border: 1px #ccc solid !important; text-align: center; }

.calendar td { cursor: pointer; position: relative; height: 100%; }

.calendar td span { font-size: 8px !important; line-height: 10px; position: absolute; top: 0; right: 0; padding: 1px 3px; background-color: #b91d47 !important; color: #fff !important; }

.calendar .out { background: #ececf0; cursor: default; }

.calendar .empty-day { border: 0 !important; display: none; }

.calendar .weekdays td { background-color: #eff4ff !important; font-weight: bold !important; }

.calendar .current-day { background-color: #00a300 !important; color: #fff !important; }

.calendar .event { background-color: #2d89ef !important; color: #fff !important; }

.datepicker { position: relative; } /*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • /

/*! normalize.css 2012-03-11T12:53 UTC - http://github.com/necolas/normalize.css */ /* ============================================================================= HTML5 display definitions ========================================================================== */ /*

  • Corrects block display not defined in IE6/7/8/9 & FF3
  • /

article, aside, details, figcaption, figure, footer, header, hgroup, nav, section, summary { display: block; } /*

  • Corrects inline-block display not defined in IE6/7/8/9 & FF3
  • /

audio, canvas, video { display: inline-block;

  • display: inline;
  • zoom: 1;

} /*

  • Prevents modern browsers from displaying 'audio' without controls
  • Remove excess height in iOS5 devices
  • /

audio:not([controls]) { display: none; height: 0; } /*

  • Addresses styling for 'hidden' attribute not present in IE7/8/9, FF3, S4
  • Known issue: no IE6 support
  • /

[hidden] { display: none; } /* ============================================================================= Base ========================================================================== */ /*

  • 1. Corrects text resizing oddly in IE6/7 when body font-size is set using em units
  • http://clagnut.com/blog/348/#c790
  • 2. Prevents iOS text size adjust after orientation change, without disabling user zoom
  • www.456bereastreet.com/archive/201012/controlling_text_size_in_safari_for_ios_without_disabling_user_zoom/
  • /

html { font-size: 100%; /* 1 */ -webkit-text-size-adjust: 100%; -ms-text-size-adjust: 100%; /* 2 */ } /*

  • Addresses font-family inconsistency between 'textarea' and other form elements.
  • /

html, button, input, select, textarea { font-family: sans-serif; } /*

  • Addresses margins handled incorrectly in IE6/7
  • /

body { margin: 0; } /* ============================================================================= Links ========================================================================== */ /*

  • Addresses outline displayed oddly in Chrome
  • /

a:focus { outline: thin dotted; } /*

  • Improves readability when focused and also mouse hovered in all browsers
  • people.opera.com/patrickl/experiments/keyboard/test
  • /

a:hover, a:active { outline: 0; } /* ============================================================================= Typography ========================================================================== */ /*

  • Addresses font sizes and margins set differently in IE6/7
  • Addresses font sizes within 'section' and 'article' in FF4+, Chrome, S5
  • /

h1 { font-size: 2em; margin: 0.67em 0; }

h2 { font-size: 1.5em; margin: 0.83em 0; }

h3 { font-size: 1.17em; margin: 1em 0; }

h4 { font-size: 1em; margin: 1.33em 0; }

h5 { font-size: 0.83em; margin: 1.67em 0; }

h6 { font-size: 0.75em; margin: 2.33em 0; } /*

  • Addresses styling not present in IE7/8/9, S5, Chrome
  • /

abbr[title] { border-bottom: 1px dotted; } /*

  • Addresses style set to 'bolder' in FF3+, S4/5, Chrome
  • /

b, strong { font-weight: bold; }

blockquote { margin: 1em 40px; } /*

  • Addresses styling not present in S5, Chrome
  • /

dfn { font-style: italic; } /*

  • Addresses styling not present in IE6/7/8/9
  • /

mark { background: #ff0; color: #000; } /*

  • Addresses margins set differently in IE6/7
  • /

p, pre { margin: 1em 0; } /*

  • Corrects font family set oddly in IE6, S4/5, Chrome
  • en.wikipedia.org/wiki/User:Davidgothberg/Test59
  • /

pre, code, kbd, samp { font-family: monospace, serif; _font-family: 'courier new', monospace; font-size: 1em; } /*

  • Improves readability of pre-formatted text in all browsers
  • /

pre { white-space: pre; white-space: pre-wrap; word-wrap: break-word; } /*

  • 1. Addresses CSS quotes not supported in IE6/7
  • 2. Addresses quote property not supported in S4
  • /

/* 1 */ q { quotes: none; } /* 2 */ q:before, q:after { content: ''; content: none; }

small { font-size: 75%; } /*

  • Prevents sub and sup affecting line-height in all browsers
  • gist.github.com/413930
  • /

sub, sup { font-size: 75%; line-height: 0; position: relative; vertical-align: baseline; }

sup { top: -0.5em; }

sub { bottom: -0.25em; } /* ============================================================================= Lists ========================================================================== */ /*

  • Addresses margins set differently in IE6/7
  • /

dl, menu, ol, ul { margin: 1em 0; }

dd { margin: 0 0 0 40px; } /*

  • Addresses paddings set differently in IE6/7
  • /

menu, ol, ul { padding: 0 0 0 40px; } /*

  • Corrects list images handled incorrectly in IE7
  • /

nav ul, nav ol { list-style: none; list-style-image: none; } /* ============================================================================= Embedded content ========================================================================== */ /*

  • 1. Removes border when inside 'a' element in IE6/7/8/9, FF3
  • 2. Improves image quality when scaled in IE7
  • code.flickr.com/blog/2008/11/12/on-ui-quality-the-little-things-client-side-image-resizing/
  • /

img { border: 0; /* 1 */ -ms-interpolation-mode: bicubic; /* 2 */ } /*

  • Corrects overflow displayed oddly in IE9
  • /

svg:not(:root) { overflow: hidden; } /* ============================================================================= Figures ========================================================================== */ /*

  • Addresses margin not present in IE6/7/8/9, S5, O11
  • /

figure { margin: 0; } /* ============================================================================= Forms ========================================================================== */ /*

  • Corrects margin displayed oddly in IE6/7
  • /

form { margin: 0; } /*

  • Define consistent border, margin, and padding
  • /

fieldset { border: 1px solid #c0c0c0; margin: 0 2px; padding: 0.35em 0.625em 0.75em; } /*

  • 1. Corrects color not being inherited in IE6/7/8/9
  • 2. Corrects text not wrapping in FF3
  • 3. Corrects alignment displayed oddly in IE6/7
  • /

legend { border: 0; /* 1 */ padding: 0; white-space: normal; /* 2 */

  • margin-left: -7px;

/* 3 */ } /*

  • 1. Corrects font size not being inherited in all browsers
  • 2. Addresses margins set differently in IE6/7, FF3+, S5, Chrome
  • 3. Improves appearance and consistency in all browsers
  • /

button, input, select, textarea { font-size: 100%; /* 1 */ margin: 0; /* 2 */ vertical-align: baseline;

  • vertical-align: middle;

/* 3 */ } /*

  • Addresses FF3/4 setting line-height on 'input' using !important in the UA stylesheet
  • /

button, input { line-height: normal; /* 1 */ } /*

  • 1. Improves usability and consistency of cursor style between image-type 'input' and others
  • 2. Corrects inability to style clickable 'input' types in iOS
  • 3. Removes inner spacing in IE7 without affecting normal text inputs
  • Known issue: inner spacing remains in IE6
  • /

button, input[type="button"], input[type="reset"], input[type="submit"] { cursor: pointer; /* 1 */ -webkit-appearance: button; /* 2 */

  • overflow: visible;

/* 3 */ } /*

  • Re-set default cursor for disabled elements
  • /

button[disabled], input[disabled] { cursor: default; } /*

  • 1. Addresses box sizing set to content-box in IE8/9
  • 2. Removes excess padding in IE8/9
  • 3. Removes excess padding in IE7

Known issue: excess padding remains in IE6

  • /

input[type="checkbox"], input[type="radio"] { box-sizing: border-box; /* 1 */ padding: 0; /* 2 */

  • height: 13px;
  • width: 13px;

/* 3 */ } /*

  • 1. Addresses appearance set to searchfield in S5, Chrome
  • 2. Addresses box-sizing set to border-box in S5, Chrome (include -moz to future-proof)
  • /

input[type="search"] { -webkit-appearance: textfield; /* 1 */ -moz-box-sizing: content-box; -webkit-box-sizing: content-box; /* 2 */ box-sizing: content-box; } /*

  • Removes inner padding and search cancel button in S5, Chrome on OS X
  • /

input[type="search"]::-webkit-search-decoration, input[type="search"]::-webkit-search-cancel-button { -webkit-appearance: none; } /*

  • Removes inner padding and border in FF3+
  • www.sitepen.com/blog/2008/05/14/the-devils-in-the-details-fixing-dojos-toolbar-buttons/
  • /

button::-moz-focus-inner, input::-moz-focus-inner { border: 0; padding: 0; } /*

  • 1. Removes default vertical scrollbar in IE6/7/8/9
  • 2. Improves readability and alignment in all browsers
  • /

textarea { overflow: auto; /* 1 */ vertical-align: top; /* 2 */ } /* ============================================================================= Tables ========================================================================== */ /*

  • Remove most spacing between table cells
  • /

table { border-collapse: collapse; border-spacing: 0; border-color: none; background-color: none; }

@font-face { font-family: "PT Serif Caption"; font-style: normal; font-weight: 400; src: local("PT Serif Caption"), local("PTSerif-Caption"), url(https://themes.googleusercontent.com/static/fonts/ptserifcaption/v4/7xkFOeTxxO1GMC1suOUYWWhBabBbEjGd1iRmpyoZukE.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 700; src: local("Open Sans Bold"), local("OpenSans-Bold"), url(https://themes.googleusercontent.com/static/fonts/opensans/v6/k3k702ZOKiLJc3WVjuplzJ1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 300; src: local("Open Sans Light"), local("OpenSans-Light"), url(https://themes.googleusercontent.com/static/fonts/opensans/v6/DXI1ORHCpsQm3Vp6mXoaTZ1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 800; src: local("Open Sans Extrabold"), local("OpenSans-Extrabold"), url(https://themes.googleusercontent.com/static/fonts/opensans/v6/EInbV5DfGHOiMmvb1Xr-hp1r3JsPcQLi8jytr04NNhU.woff) format('woff'); }

@font-face { font-family: "Open Sans"; font-style: normal; font-weight: 400; src: local("Open Sans"), local("OpenSans"), url(https://themes.googleusercontent.com/static/fonts/opensans/v6/K88pR3goAWT7BTt32Z01mz8E0i7KZn-EPnyo3HZu7kw.woff) format('woff'); }

.text-rest-state { color: #000000; }

.text-rest2-state { color: rgba(0, 0, 0, 0.6); }

.text-hover-state { color: rgba(0, 0, 0, 0.8); }

.text-pressed-state { color: rgba(0, 0, 0, 0.4); }

  1. font .header {

font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 42pt; letter-spacing: 0.00em; line-height: 44pt; font-smooth: always; }

  1. font .subheader,
  2. font .subheader-secondary {

font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; }

  1. font .subheader-smaller,
  2. font .subheader-secondary-smaller {

font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; letter-spacing: 0.01em; line-height: 18pt; font-size: 16pt; font-smooth: always; }

  1. font .small-subheader,
  2. font .small-subheader-secondary {

font-family: 'Segoe UI Semibold', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; }

  1. font .navigation {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; }

  1. font .body,
  2. font .body-secondary,
  3. font .normal {

font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; }

  1. font .link {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; font-smooth: always; line-height: 13pt; }

  1. font .tertiary,
  2. font .tertiary-secondary {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; }

  1. font .control {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; }

  1. font .small {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 8pt; font-smooth: always; line-height: 10pt; }

  1. font .long-text {

font-family: 'PT Serif Caption', sans-serif, serif !important; font-weight: 300; font-size: 10pt; letter-spacing: 0.02em; line-height: 12pt; font-smooth: always; }

  1. font .long-text-smaller {

font-family: 'PT Serif Caption', sans-serif, serif !important; font-weight: 300; font-size: 10pt; letter-spacing: 0.02em; line-height: 12pt; font-smooth: always; font-size: 9pt; line-height: 11pt; }

  1. font .long-text-lead {

font-family: 'PT Serif Caption', sans-serif, serif !important; font-weight: 300; font-size: 10pt; letter-spacing: 0.02em; line-height: 12pt; font-smooth: always; font-size: 20pt; line-height: 22pt; }

  1. state .header,
  2. state .subheader,
  3. state .small-subheader,
  4. state .navigation,
  5. state .body,
  6. state .tertiary {

color: #000000; }

  1. state .subheader-secondary,
  2. state .subheader-secondary-smaller,
  3. state .small-subheader,
  4. state .small-subheader-secondary,
  5. state .body-secondary,
  6. state .tertiary-secondary {

color: rgba(0, 0, 0, 0.6); }

  1. state .link {

color: #2e92cf; }

  1. state .link:hover {

color: rgba(45, 173, 237, 0.8); }

  1. state .link:active {

color: rgba(45, 173, 237, 0.6); }

a, .link { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; font-smooth: always; line-height: 13pt; color: #2e92cf; text-decoration: none; }

a:hover, .link:hover { color: rgba(45, 173, 237, 0.8); }

a:active, .link:active { color: rgba(45, 173, 237, 0.6); }

h1, h2, h3, h4, h5, h6 { margin: 0 0 10px 0; padding: 0; }

h1 { font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 42pt; letter-spacing: 0.00em; line-height: 44pt; font-smooth: always; color: #000000; }

h2 { font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; color: #000000; }

h3 { font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; color: rgba(0, 0, 0, 1); font-size: 16pt; line-height: 24px; }

h4 { font-family: 'Segoe UI Semibold', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: #000000; color: rgba(0, 0, 0, 1); }

h5 { font-family: 'Segoe UI Semibold', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: rgba(0, 0, 0, 1); font-size: 90%; }

h6 { font-family: 'Segoe UI Semibold', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: rgba(0, 0, 0, 1); font-size: 80%; }

body, p, div { font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; }

p.long-text { font-family: 'PT Serif Caption', sans-serif, serif !important; font-weight: 300; font-size: 10pt; letter-spacing: 0.02em; line-height: 12pt; font-smooth: always; }

p { margin: 0 0 10px; }

p.indent:first-letter { padding-left: 25px; }

.lead { font-size: 120%; line-height: 26px; }

.tertiary-info-text, .tertiary-text { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #000000; }

.tertiary-info-secondary-text, .tertiary-secondary-text { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: rgba(0, 0, 0, 0.6); }

abbr.initialism { font-size: 90%; text-transform: uppercase !important; }

abbr[title] { cursor: help !important; }

address { display: block; margin-bottom: 20px; font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; line-height: 20px; font-style: normal; }

blockquote { margin: 0; padding: 5px 20px; border-left: 4px #ccc solid; display: block; background-color: rgba(204, 204, 204, 0.1); }

blockquote p { margin-bottom: 0; }

blockquote small:before { content: '\2014'; color: rgba(0, 0, 0, 0.4); margin-right: 5px; }

blockquote.place-right { float: none !important; text-align: right; border: 0; border-right: 4px #ccc solid; }

blockquote.place-right small { text-align: right; }

blockquote.place-right small:before { content: ""; }

blockquote.place-right small:after { content: '\2014'; color: rgba(0, 0, 0, 0.4); margin-left: 5px; }

ul, ol { padding: 0; margin: 0 0 10px 0px; display: block; }

ul:nth-child(1) { margin-left: 25px; }

ul ul, ul ol, ol ol, ol ul { margin-bottom: 0 !important; }

ul { list-style-position: inside; list-style-type: none; }

ul ul { list-style-type: none; margin-left: 10px; }

ul, ol { list-style-position: inside; }

ul li, ol li { display: list-item; font-size: 14px; line-height: 20px; }

ol { list-style-type: decimal; }

ul.unstyled, ol.unstyled, .unstyled { margin-left: 0; list-style: none; }

.inline-tag, .label { display: inline-block; line-height: inherit; font-size: .75em; font-weight: bold; padding: 2px 4px; background-color: #d5e7ec !important; color: #4d4d4d; vertical-align: 3%; }

.inline-tag.success, .label.success { background-color: #00a300 !important; color: #ffffff !important; }

.inline-tag.warning, .label.warning { background-color: #e3a21a !important; color: #ffffff !important; }

.inline-tag.important, .label.important, .inline-tag.error, .label.error { background-color: #b91d47 !important; color: #ffffff !important; }

.inline-tag.info, .label.info { background-color: #2d89ef !important; color: #ffffff !important; }

.inline-tag.inverse, .label.inverse { background-color: #1d1d1d !important; color: #ffffff !important; }

.place-left { float: left !important; margin-right: 10px; }

.place-right { float: right !important; margin-left: 10px; }

.scroll-y, .scroll-vertical { overflow-y: scroll; }

.scroll-x, .scroll-horizontal { overflow-x: scroll; }

.pos-rel { position: relative; }

.pos-abs { position: absolute; }

.pos-fix { position: fixed; }

.text-left { text-align: left; }

.text-right { text-align: right; }

.text-center { text-align: center; }

.text-justify { text-align: justify; }

.top-left { position: absolute; top: 0; left: 0; }

.top-right { position: absolute; top: 0; right: 0; }

.bottom-right { position: absolute; bottom: 0; right: 0; }

.bottom-left { position: absolute; bottom: 0; left: 0; }

.no-overflow { overflow: hidden; }

.no-display { display: none; }

.no-margin { margin: 0; }

.no-padding { padding: 0; }

.no-border { border: 0; }

.no-border-all { border: 0; }

.no-border-all * { border: 0; }

.as-block { display: block; float: none !important; }

.as-inline-block { display: inline-block; }

.nlm { margin-left: 0 !important; }

.nrm { margin-right: 0 !important; }

.clearfix {

  • zoom: 1;

}

.clearfix:before, .clearfix:after { display: table; content: ""; }

.clearfix:after { clear: both; }

.padding5 { padding: 5px; }

.padding10 { padding: 10px; }

.padding15 { padding: 15px; }

.padding20 { padding: 20px; }

.padding30 { padding: 30px; }

.padding40 { padding: 40px; }

.padding80 { padding: 80px; }

.selected { border: 4px #2d89ef solid; }

.selected:after { width: 0; height: 0; border-top: 40px solid #2d89ef; border-left: 40px solid transparent; position: absolute; display: block; right: 0; content: "."; top: 0; z-index: 1001; }

.selected:before { position: absolute; content: "\e08a"; color: #fff; right: 4px; font-family: iconFont; z-index: 1002; }

.border { border: 1px #ccc solid; }

@font-face { font-family: "iconFont"; src: url('../fonts/iconFont.eot'); src: url('../fonts/iconFont.eot?#iefix') format('embedded-opentype'), url('../fonts/iconFont.svg#iconFont') format('svg'), url('../fonts/iconFont.woff') format('woff'), url('../fonts/iconFont.ttf') format('truetype'); font-weight: normal; font-style: normal; }

[class^="icon-"], [class*=" icon-"] { font-family: "iconFont"; font-weight: normal; font-style: normal; text-decoration: inherit; -webkit-font-smoothing: antialiased; display: inline-block; width: auto; height: auto; line-height: normal; vertical-align: baseline; background-image: none; background-position: 0% 0%; background-repeat: repeat; margin-top: 0; position: relative; }

[class^="icon-"]:before, [class*=" icon-"]:before { text-decoration: inherit; display: inline-block; speak: none; }

a [class^="icon-"], a [class*=" icon-"] { display: inline-block; }

.icon-large:before { vertical-align: -10%; font-size: 1.3333333333333333em; }

a [class^="icon-"], button [class^="icon-"], .button [class^="icon-"], .page-control > ul > li [class^="icon-"], a [class*=" icon-"], button [class*=" icon-"], .button [class*=" icon-"], .page-control > ul > li [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

a [class^="icon-"].icon-large, button [class^="icon-"].icon-large, .button [class^="icon-"].icon-large, .page-control > ul > li [class^="icon-"].icon-large, a [class*=" icon-"].icon-large, button [class*=" icon-"].icon-large, .button [class*=" icon-"].icon-large, .page-control > ul > li [class*=" icon-"].icon-large { line-height: .9em; }

a.big [class^="icon-"], button.big [class^="icon-"], .button.big [class^="icon-"], .page-control > ul > li.big [class^="icon-"], a.big [class*=" icon-"], button.big [class*=" icon-"], .button.big [class*=" icon-"], .page-control > ul > li.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

li [class^="icon-"], li [class*=" icon-"] { display: inline-block; width: 1.2em; text-align: center; }

li [class^="icon-"].icon-large, li [class*=" icon-"].icon-large { width: 1.5625em; }

ol.icons { list-style-type: none; }

ol.icons li { line-height: 24px; }

ol.icons li [class^="icon-"], ol.icons li [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; }

.icon-muted { color: #eeeeee; }

.icon-border { border: solid 1px #eeeeee; padding: .2em .25em .15em; }

.icon-2x { font-size: 2em; }

.icon-2x.icon-border { border-width: 2px; }

.icon-3x { font-size: 3em; }

.icon-3x.icon-border { border-width: 3px; }

.icon-4x { font-size: 4em; }

.icon-4x.icon-border { border-width: 4px; }

a [class^="icon-"], button [class^="icon-"], .button [class^="icon-"], .page-control > ul > li [class^="icon-"], a [class*=" icon-"], button [class*=" icon-"], .button [class*=" icon-"], .page-control > ul > li [class*=" icon-"] { margin-right: 5px; }

a [class^="icon-"].right, button [class^="icon-"].right, .button [class^="icon-"].right, .page-control > ul > li [class^="icon-"].right, a [class*=" icon-"].right, button [class*=" icon-"].right, .button [class*=" icon-"].right, .page-control > ul > li [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar [class^="icon-"], .toolbar [class*=" icon-"] { margin: 0 !important; }

.image-button [class^="icon-"], .image-button [class*=" icon-"] { position: absolute; right: 0; margin-left: 32px; padding: 5px; height: 100%; top: 0px; box-sizing: border-box; border: 1px transparent solid; z-index: 2; margin: 0; font-size: 16px; }

.shortcut > .icon [class^="icon-"], .shortcut > .icon [class*=" icon-"] { font-size: 32px; line-height: 32px; height: 32px; margin: 10px 0 0 0 !important; }

.icon-home:before { content: "\e000"; }

.icon-newspaper:before { content: "\e001"; }

.icon-pencil:before { content: "\e002"; }

.icon-droplet:before { content: "\e003"; }

.icon-pictures:before { content: "\e004"; }

.icon-camera:before { content: "\e005"; }

.icon-music:before { content: "\e006"; }

.icon-film:before { content: "\e007"; }

.icon-camera-2:before { content: "\e008"; }

.icon-spades:before { content: "\e009"; }

.icon-clubs:before { content: "\e00a"; }

.icon-diamonds:before { content: "\e00b"; }

.icon-broadcast:before { content: "\e00c"; }

.icon-mic:before { content: "\e00d"; }

.icon-book:before { content: "\e00e"; }

.icon-file:before { content: "\e00f"; }

.icon-new:before { content: "\e010"; }

.icon-copy:before { content: "\e011"; }

.icon-folder:before { content: "\e012"; }

.icon-folder-2:before { content: "\e013"; }

.icon-tag:before { content: "\e014"; }

.icon-cart:before { content: "\e015"; }

.icon-basket:before { content: "\e016"; }

.icon-calculate:before { content: "\e017"; }

.icon-support:before { content: "\e018"; }

.icon-phone:before { content: "\e019"; }

.icon-mail:before { content: "\e01a"; }

.icon-location:before { content: "\e01b"; }

.icon-compass:before { content: "\e01c"; }

.icon-history:before { content: "\e01d"; }

.icon-clock:before { content: "\e01e"; }

.icon-bell:before { content: "\e01f"; }

.icon-calendar:before { content: "\e020"; }

.icon-printer:before { content: "\e021"; }

.icon-mouse:before { content: "\e022"; }

.icon-screen:before { content: "\e023"; }

.icon-laptop:before { content: "\e024";

}

.icon-mobile:before { content: "\e025"; }

.icon-cabinet:before { content: "\e026"; }

.icon-drawer:before { content: "\e027"; }

.icon-drawer-2:before { content: "\e028"; }

.icon-box:before { content: "\e029"; }

.icon-box-add:before { content: "\e02a"; }

.icon-box-remove:before { content: "\e02b"; }

.icon-download:before { content: "\e02c"; }

.icon-upload:before { content: "\e02d"; }

.icon-database:before { content: "\e02e"; }

.icon-flip:before { content: "\e02f"; }

.icon-flip-2:before { content: "\e030"; }

.icon-undo:before { content: "\e031"; }

.icon-redo:before { content: "\e032"; }

.icon-forward:before { content: "\e033"; }

.icon-reply:before { content: "\e034"; }

.icon-reply-2:before { content: "\e035"; }

.icon-comments:before { content: "\e036"; }

.icon-comments-2:before { content: "\e037"; }

.icon-comments-3:before { content: "\e038"; }

.icon-comments-4:before { content: "\e039"; }

.icon-comments-5:before { content: "\e03a"; }

.icon-user:before { content: "\e03b"; }

.icon-user-2:before { content: "\e03c"; }

.icon-user-3:before { content: "\e03d"; }

.icon-busy:before { content: "\e03e"; }

.icon-loading:before { content: "\e03f"; }

.icon-loading-2:before { content: "\e040"; }

.icon-search:before { content: "\e041"; }

.icon-zoom-in:before { content: "\e042"; }

.icon-zoom-out:before { content: "\e043"; }

.icon-key:before { content: "\e044"; }

.icon-key-2:before { content: "\e045"; }

.icon-locked:before { content: "\e046"; }

.icon-unlocked:before { content: "\e047"; }

.icon-wrench:before { content: "\e048"; }

.icon-equalizer:before { content: "\e049"; }

.icon-cog:before { content: "\e04a"; }

.icon-pie:before { content: "\e04b"; }

.icon-bars:before { content: "\e04c"; }

.icon-stats-up:before { content: "\e04d"; }

.icon-gift:before { content: "\e04e"; }

.icon-trophy:before { content: "\e04f"; }

.icon-diamond:before { content: "\e050"; }

.icon-coffee:before { content: "\e051"; }

.icon-rocket:before { content: "\e052"; }

.icon-meter-slow:before { content: "\e053"; }

.icon-meter-medium:before { content: "\e054"; }

.icon-meter-fast:before { content: "\e055"; }

.icon-dashboard:before { content: "\e056"; }

.icon-fire:before { content: "\e057"; }

.icon-lab:before { content: "\e058"; }

.icon-remove:before { content: "\e059"; }

.icon-briefcase:before { content: "\e05a"; }

.icon-briefcase-2:before { content: "\e05b"; }

.icon-cars:before { content: "\e05c"; }

.icon-bus:before { content: "\e05d"; }

.icon-cube:before { content: "\e05e"; }

.icon-cube-2:before { content: "\e05f"; }

.icon-puzzle:before { content: "\e060"; }

.icon-glasses:before { content: "\e061"; }

.icon-glasses-2:before { content: "\e062"; }

.icon-accessibility:before { content: "\e063"; }

.icon-accessibility-2:before { content: "\e064"; }

.icon-target:before { content: "\e065"; }

.icon-target-2:before { content: "\e066"; }

.icon-lightning:before { content: "\e067"; }

.icon-power:before { content: "\e068"; }

.icon-power-2:before { content: "\e069"; }

.icon-clipboard:before { content: "\e06a"; }

.icon-clipboard-2:before { content: "\e06b"; }

.icon-playlist:before { content: "\e06c"; }

.icon-grid-view:before { content: "\e06d"; }

.icon-tree-view:before { content: "\e06e"; }

.icon-cloud:before { content: "\e06f"; }

.icon-cloud-2:before { content: "\e070"; }

.icon-download-2:before { content: "\e071"; }

.icon-upload-2:before { content: "\e072"; }

.icon-upload-3:before { content: "\e073"; }

.icon-link:before { content: "\e074"; }

.icon-link-2:before { content: "\e075"; }

.icon-flag:before { content: "\e076"; }

.icon-flag-2:before { content: "\e077"; }

.icon-attachment:before { content: "\e078"; }

.icon-eye:before { content: "\e079"; }

.icon-bookmark:before { content: "\e07a"; }

.icon-bookmark-2:before { content: "\e07b"; }

.icon-star:before { content: "\e07c"; }

.icon-star-2:before { content: "\e07d"; }

.icon-star-3:before { content: "\e07e"; }

.icon-heart:before { content: "\e07f"; }

.icon-heart-2:before { content: "\e080"; }

.icon-thumbs-up:before { content: "\e081"; }

.icon-thumbs-down:before { content: "\e082"; }

.icon-plus:before { content: "\e083"; }

.icon-minus:before { content: "\e084"; }

.icon-help:before { content: "\e085"; }

.icon-help-2:before { content: "\e086"; }

.icon-blocked:before { content: "\e087"; }

.icon-cancel:before { content: "\e088"; }

.icon-cancel-2:before { content: "\e089"; }

.icon-checkmark:before { content: "\e08a"; }

.icon-minus-2:before { content: "\e08b"; }

.icon-plus-2:before { content: "\e08c"; }

.icon-enter:before { content: "\e08d"; }

.icon-exit:before { content: "\e08e"; }

.icon-loop:before { content: "\e08f"; }

.icon-arrow-up-left:before { content: "\e090"; }

.icon-arrow-up:before { content: "\e091"; }

.icon-arrow-up-right:before { content: "\e092"; }

.icon-arrow-right:before { content: "\e093"; }

.icon-arrow-down-right:before { content: "\e094"; }

.icon-arrow-down:before { content: "\e095"; }

.icon-arrow-down-left:before { content: "\e096"; }

.icon-arrow-left:before { content: "\e097"; }

.icon-arrow-up-2:before { content: "\e098"; }

.icon-arrow-right-2:before { content: "\e099"; }

.icon-arrow-down-2:before { content: "\e09a"; }

.icon-arrow-left-2:before { content: "\e09b"; }

.icon-arrow-up-3:before { content: "\e09c"; }

.icon-arrow-right-3:before { content: "\e09d"; }

.icon-arrow-down-3:before { content: "\e09e"; }

.icon-arrow-left-3:before { content: "\e09f"; }

.icon-menu:before { content: "\e0a0"; }

.icon-enter-2:before { content: "\e0a1"; }

.icon-backspace:before { content: "\e0a2"; }

.icon-backspace-2:before { content: "\e0a3"; }

.icon-tab:before { content: "\e0a4"; }

.icon-tab-2:before { content: "\e0a5"; }

.icon-checkbox:before { content: "\e0a6"; }

.icon-checkbox-unchecked:before { content: "\e0a7"; }

.icon-checkbox-partial:before { content: "\e0a8"; }

.icon-radio-checked:before { content: "\e0a9"; }

.icon-radio-unchecked:before { content: "\e0aa"; }

.icon-font:before { content: "\e0ab"; }

.icon-paragraph-left:before { content: "\e0ac"; }

.icon-paragraph-center:before { content: "\e0ad"; }

.icon-paragraph-right:before { content: "\e0ae"; }

.icon-paragraph-justify:before { content: "\e0af"; }

.icon-left-to-right:before { content: "\e0b0"; }

.icon-right-to-left:before { content: "\e0b1"; }

.icon-share:before { content: "\e0b2"; }

.icon-new-tab:before { content: "\e0b3"; }

.icon-new-tab-2:before { content: "\e0b4"; }

.icon-embed:before { content: "\e0b5"; }

.icon-code:before { content: "\e0b6"; }

.icon-bluetooth:before { content: "\e0b7"; }

.icon-share-2:before { content: "\e0b8"; }

.icon-share-3:before { content: "\e0b9"; }

.icon-mail-2:before { content: "\e0ba"; }

.icon-google:before { content: "\e0bb"; }

.icon-google-plus:before { content: "\e0bc"; }

.icon-google-drive:before { content: "\e0bd"; }

.icon-facebook:before { content: "\e0be"; }

.icon-instagram:before { content: "\e0bf"; }

.icon-twitter:before { content: "\e0c0"; }

.icon-feed:before { content: "\e0c1"; }

.icon-youtube:before { content: "\e0c2"; }

.icon-vimeo:before { content: "\e0c3"; }

.icon-flickr:before { content: "\e0c4"; }

.icon-picassa:before { content: "\e0c5"; }

.icon-dribbble:before { content: "\e0c6"; }

.icon-deviantart:before { content: "\e0c7"; }

.icon-github:before { content: "\e0c8"; }

.icon-github-2:before { content: "\e0c9"; }

.icon-github-3:before { content: "\e0ca"; }

.icon-github-4:before { content: "\e0cb"; }

.icon-github-5:before { content: "\e0cc"; }

.icon-git:before { content: "\e0cd"; }

.icon-github-6:before { content: "\e0ce"; }

.icon-wordpress:before { content: "\e0cf"; }

.icon-joomla:before { content: "\e0d0"; }

.icon-blogger:before { content: "\e0d1"; }

.icon-tumblr:before { content: "\e0d2"; }

.icon-yahoo:before { content: "\e0d3"; }

.icon-amazon:before { content: "\e0d4"; }

.icon-tux:before { content: "\e0d5"; }

.icon-apple:before { content: "\e0d6"; }

.icon-finder:before { content: "\e0d7"; }

.icon-android:before { content: "\e0d8"; }

.icon-windows:before { content: "\e0d9"; }

.icon-soundcloud:before { content: "\e0da"; }

.icon-skype:before { content: "\e0db"; }

.icon-reddit:before { content: "\e0dc"; }

.icon-linkedin:before { content: "\e0dd"; }

.icon-lastfm:before { content: "\e0de"; }

.icon-delicious:before { content: "\e0df"; }

.icon-stumbleupon:before { content: "\e0e0"; }

.icon-pinterest:before { content: "\e0e1"; }

.icon-xing:before { content: "\e0e2"; }

.icon-flattr:before { content: "\e0e3"; }

.icon-foursquare:before { content: "\e0e4"; }

.icon-paypal:before { content: "\e0e5"; }

.icon-yelp:before { content: "\e0e6"; }

.icon-libreoffice:before { content: "\e0e7"; }

.icon-file-pdf:before { content: "\e0e8"; }

.icon-file-openoffice:before { content: "\e0e9"; }

.icon-file-word:before { content: "\e0ea"; }

.icon-file-excel:before { content: "\e0eb"; }

.icon-file-powerpoint:before { content: "\e0ec"; }

.icon-file-zip:before { content: "\e0ed"; }

.icon-file-xml:before { content: "\e0ee"; }

.icon-file-css:before { content: "\e0ef"; }

.icon-html5:before { content: "\e0f0"; }

.icon-html5-2:before { content: "\e0f1"; }

.icon-css3:before { content: "\e0f2"; }

.icon-chrome:before { content: "\e0f3"; }

.icon-firefox:before { content: "\e0f4"; }

.icon-IE:before { content: "\e0f5"; }

.icon-opera:before { content: "\e0f6"; }

.icon-safari:before { content: "\e0f7"; }

.icon-IcoMoon:before { content: "\e0f8"; }

.icon-sunrise:before { content: "\e0f9"; }

.icon-sun:before { content: "\e0fa"; }

.icon-moon:before { content: "\e0fb"; }

.icon-sun-2:before { content: "\e0fc"; }

.icon-windy:before { content: "\e0fd"; }

.icon-wind:before { content: "\e0fe"; }

.icon-snowflake:before { content: "\e0ff"; }

.icon-cloudy:before { content: "\e100"; }

.icon-cloud-3:before { content: "\e101"; }

.icon-weather:before { content: "\e102"; }

.icon-weather-2:before { content: "\e103"; }

.icon-weather-3:before { content: "\e104"; }

.icon-lines:before { content: "\e105"; }

.icon-cloud-4:before { content: "\e106"; }

.icon-lightning-2:before { content: "\e107"; }

.icon-lightning-3:before { content: "\e108"; }

.icon-rainy:before { content: "\e109"; }

.icon-rainy-2:before { content: "\e10a"; }

.icon-windy-2:before { content: "\e10b"; }

.icon-windy-3:before { content: "\e10c"; }

.icon-snowy:before { content: "\e10d"; }

.icon-snowy-2:before { content: "\e10e"; }

.icon-snowy-3:before { content: "\e10f"; }

.icon-weather-4:before { content: "\e110"; }

.icon-cloudy-2:before { content: "\e111"; }

.icon-cloud-5:before { content: "\e112"; }

.icon-lightning-4:before { content: "\e113"; }

.icon-sun-3:before { content: "\e114"; }

.icon-moon-2:before { content: "\e115"; }

.icon-cloudy-3:before { content: "\e116"; }

.icon-cloud-6:before { content: "\e117"; }

.icon-cloud-7:before { content: "\e118"; }

.icon-lightning-5:before { content: "\e119"; }

.icon-rainy-3:before { content: "\e11a"; }

.icon-rainy-4:before { content: "\e11b"; }

.icon-windy-4:before { content: "\e11c"; }

.icon-windy-5:before { content: "\e11d"; }

.icon-snowy-4:before { content: "\e11e"; }

.icon-snowy-5:before { content: "\e11f"; }

.icon-weather-5:before { content: "\e120"; }

.icon-cloudy-4:before { content: "\e121"; }

.icon-lightning-6:before { content: "\e122"; }

.icon-thermometer:before { content: "\e123"; }

.icon-compass-2:before { content: "\e124"; }

.icon-none:before { content: "\e125"; }

.icon-Celsius:before { content: "\e126"; }

.icon-Fahrenheit:before { content: "\e127"; }

.icon-forrst:before { content: "\e128"; }

.icon-headphones:before { content: "\e129"; }

.icon-bug:before { content: "\e12a"; }

.icon-cart-2:before { content: "\e12b"; }

.icon-earth:before { content: "\e12c"; }

.icon-battery:before { content: "\e12d"; }

.icon-list:before { content: "\e12e"; }

.icon-grid:before { content: "\e12f"; }

.icon-alarm:before { content: "\e130"; }

.icon-location-2:before { content: "\e131"; }

.icon-pointer:before { content: "\e132"; }

.icon-diary:before { content: "\e133"; }

.icon-eye-2:before { content: "\e134"; }

.icon-console:before { content: "\e135"; }

.icon-location-3:before { content: "\e136"; }

.icon-move:before { content: "\e137"; }

.icon-gift-2:before { content: "\e138"; }

.icon-monitor:before { content: "\e139"; }

.icon-mobile-2:before { content: "\e13a"; }

.icon-switch:before { content: "\e13b"; }

.icon-star-4:before { content: "\e13c"; }

.icon-address-book:before { content: "\e13d"; }

.icon-shit:before { content: "\e13e"; }

.icon-cone:before { content: "\e13f"; }

.icon-credit-card:before { content: "\e140"; }

.icon-type:before { content: "\e141"; }

.icon-volume:before { content: "\e142"; }

.icon-volume-2:before { content: "\e143"; }

.icon-locked-2:before { content: "\e144"; }

.icon-warning:before { content: "\e145"; }

.icon-info:before { content: "\e146"; }

.icon-filter:before { content: "\e147"; }

.icon-bookmark-3:before { content: "\e148"; }

.icon-bookmark-4:before { content: "\e149"; }

.icon-stats:before { content: "\e14a"; }

.icon-compass-3:before { content: "\e14b"; }

.icon-keyboard:before { content: "\e14c"; }

.icon-award-fill:before { content: "\e14d"; }

.icon-award-stroke:before { content: "\e14e"; }

.icon-beaker-alt:before { content: "\e14f"; }

.icon-beaker:before { content: "\e150"; }

.icon-move-vertical:before { content: "\e151"; }

.icon-move-horizontal:before { content: "\e153"; }

.icon-steering-wheel:before { content: "\e152"; }

.icon-volume-3:before { content: "\e154"; }

.icon-volume-mute:before { content: "\e155"; }

.icon-play:before { content: "\e156"; }

.icon-pause:before { content: "\e157"; }

.icon-stop:before { content: "\e158"; }

.icon-eject:before { content: "\e159"; }

.icon-first:before { content: "\e15a"; }

.icon-last:before { content: "\e15b"; }

.icon-play-alt:before { content: "\e15c"; }

.icon-battery-empty:before { content: "\e15d"; }

.icon-battery-half:before { content: "\e15e"; }

.icon-battery-full:before { content: "\e15f"; }

.icon-battery-charging:before { content: "\e160"; }

.icon-left-quote:before { content: "\e161"; }

.icon-right-quote:before { content: "\e162"; }

.icon-left-quote-alt:before { content: "\e163"; }

.icon-right-quote-alt:before { content: "\e164"; }

.icon-smiley:before { content: "\e165"; }

.icon-umbrella:before { content: "\e166"; }

.icon-info-2:before { content: "\e167"; }

.icon-chart-alt:before { content: "\e168"; }

.icon-save:before { content: "\e169"; }

.fg-color-blue { color: #2d89ef !important; }

.fg-color-blueLight { color: #eff4ff !important; }

.fg-color-blueDark { color: #2b5797 !important; }

.fg-color-green { color: #00a300 !important; }

.fg-color-greenLight { color: #99b433 !important; }

.fg-color-greenDark { color: #1e7145 !important; }

.fg-color-red { color: #b91d47 !important; }

.fg-color-yellow { color: #ffc40d !important; }

.fg-color-orange { color: #e3a21a !important; }

.fg-color-orangeDark { color: #da532c !important; }

.fg-color-pink { color: #9f00a7 !important; }

.fg-color-pinkDark { color: #7e3878 !important; }

.fg-color-purple { color: #603cba !important; }

.fg-color-darken { color: #1d1d1d !important; }

.fg-color-lighten { color: #d5e7ec !important; }

.fg-color-white { color: #ffffff !important; }

.fg-color-grayDark { color: #525252 !important; }

.fg-color-magenta { color: #ff0097 !important; }

.fg-color-teal { color: #00aba9 !important; }

.fg-color-redLight { color: #ee1111 !important; }

.bg-color-blue { background-color: #2d89ef !important; }

.bg-color-blueLight { background-color: #eff4ff !important; }

.bg-color-blueDark { background-color: #2b5797 !important; }

.bg-color-green { background-color: #00a300 !important; }

.bg-color-greenLight { background-color: #99b433 !important; }

.bg-color-greenDark { background-color: #1e7145 !important; }

.bg-color-red { background-color: #b91d47 !important; }

.bg-color-yellow { background-color: #ffc40d !important; }

.bg-color-orange { background-color: #e3a21a !important; }

.bg-color-orangeDark { background-color: #da532c !important; }

.bg-color-pink { background-color: #9f00a7 !important; }

.bg-color-pinkDark { background-color: #7e3878 !important; }

.bg-color-purple { background-color: #603cba !important; }

.bg-color-darken { background-color: #1d1d1d !important; }

.bg-color-lighten { background-color: #d5e7ec !important; }

.bg-color-white { background-color: #ffffff !important; }

.bg-color-grayDark { background-color: #525252 !important; }

.bg-color-magenta { background-color: #ff0097 !important; }

.bg-color-teal { background-color: #00aba9 !important; }

.bg-color-redLight { background-color: #ee1111 !important; }

[class*=border-color] { border: 2px solid; }

.border-color-blue { border-color: #2d89ef !important; }

.border-color-blueLight { border-color: #eff4ff !important; }

.border-color-blueDark { border-color: #2b5797 !important; }

.border-color-green { border-color: #00a300 !important; }

.border-color-greenLight { border-color: #99b433 !important; }

.border-color-greenDark { border-color: #1e7145 !important; }

.border-color-red { border-color: #b91d47 !important; }

.border-color-yellow { border-color: #ffc40d !important; }

.border-color-orange { border-color: #e3a21a !important; }

.border-color-orangeDark { border-color: #da532c !important; }

.border-color-pink { border-color: #9f00a7 !important; }

.border-color-pinkDark { border-color: #7e3878 !important; }

.border-color-purple { border-color: #603cba !important; }

.border-color-darken { border-color: #1d1d1d !important; }

.border-color-lighten { border-color: #d5e7ec !important; }

.border-color-white { border-color: #ffffff !important; }

.border-color-grayDark { border-color: #525252 !important; }

.border-color-magenta { border-color: #ff0097 !important; }

.border-color-teal { border-color: #00aba9 !important; }

.border-color-redLight { border-color: #ee1111 !important; }

  • hover[class=outline-color] {

outline: 3px solid; }

.outline-color-blue { outline-color: #2d89ef !important; }

.outline-color-blueLight { outline-color: #eff4ff !important; }

.outline-color-blueDark { outline-color: #2b5797 !important; }

.outline-color-green { outline-color: #00a300 !important; }

.outline-color-greenLight { outline-color: #99b433 !important; }

.outline-color-greenDark { outline-color: #1e7145 !important; }

.outline-color-red { outline-color: #b91d47 !important; }

.outline-color-yellow { outline-color: #ffc40d !important; }

.outline-color-orange { outline-color: #e3a21a !important; }

.outline-color-orangeDark { outline-color: #da532c !important; }

.outline-color-pink { outline-color: #9f00a7 !important; }

.outline-color-pinkDark { outline-color: #7e3878 !important; }

.outline-color-purple { outline-color: #603cba !important; }

.outline-color-darken { outline-color: #1d1d1d !important; }

.outline-color-lighten { outline-color: #d5e7ec !important; }

.outline-color-white { outline-color: #ffffff !important; }

.outline-color-grayDark { outline-color: #525252 !important; }

.outline-color-magenta { outline-color: #ff0097 !important; }

.outline-color-teal { outline-color: #00aba9 !important; }

.outline-color-redLight { outline-color: #ee1111 !important; }

.item-margin { margin: 0 10px 10px 0; }

.column-margin { margin: 0 20px 10px 0; }

.group-margin { margin: 0 80px 10px 0; }

.brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; }

.short-brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 150px; height: 150px; }

.medium-brick { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 310px; height: 150px; }

.square { display: block; float: left; margin-right: 10px; height: 20px; width: 20px; }

  • ,
    after,
    before {

-webkit-box-sizing: border-box; -moz-box-sizing: border-box; box-sizing: border-box; }

.one-column { -moz-columns: 1; -webkit-columns: 1; columns: 1; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.two-columns { -moz-columns: 2; -webkit-columns: 2; columns: 2; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.three-columns { -moz-columns: 3; -webkit-columns: 3; columns: 3; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.four-columns { -moz-columns: 4; -webkit-columns: 4; columns: 4; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

.five-columns { -moz-columns: 5; -webkit-columns: 5; columns: 5; -moz-column-gap: 20px; -webkit-column-gap: 20px; column-gap: 20px; }

  1. bodyContent {

position: relative; height: 100%; min-height: 100%; width: 100%;

  • zoom: 1;

}

  1. bodyContent:before, #bodyContent:after {

display: table; content: ""; }

.page:after { clear: both; }

  1. bodyContent .page-header {

width: 100%; position: relative; display: block; }

  1. bodyContent .page-header .page-header-content {

height: 100px; min-height: 100px; width: 100%; position: relative; display: block; }

  1. bodyContent .page-header .page-header-content h1,
  2. bodyContent .page-header .page-header-content h2,
  3. bodyContent .page-header .page-header-content h3,
  4. bodyContent .page-header .page-header-content h4,
  5. bodyContent .page-header .page-header-content h5 {

position: absolute; margin: 0; padding: 0; left: 20px; bottom: 0; }

  1. bodyContent .page-header .page-header-content h1 small {

font-size: 12pt; margin-left: 5px; }

  1. bodyContent .page-header .page-header-content h1.sub-menu {

cursor: pointer; }

  1. bodyContent .page-header .page-header-content h1.sub-menu:after {

position: absolute; content: "\3009"; display: inline-block; font-size: 10pt; bottom: -5px; right: -15px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); }

  1. bodyContent .page-header .page-header-content > .page-back {

position: absolute; top: 34px; left: 30px; }

  1. bodyContent .page-header .page-header-content .user-login {

float: right; margin: 55px 44px 0 0; cursor: pointer; }

  1. bodyContent .page-header .page-header-content .user-login .avatar {

float: right; border: 1px #ccc solid; width: 40px; height: 40px; }

  1. bodyContent .page-header .page-header-content .user-login .avatar img,
  2. bodyContent .page-header .page-header-content .user-login .avatar [class^="icon-"],
  3. bodyContent .page-header .page-header-content .user-login .avatar [class*=" icon-"] {

width: 100%; height: 100%; }

  1. bodyContent .page-header .page-header-content .user-login .avatar [class^="icon-"],
  2. bodyContent .page-header .page-header-content .user-login .avatar [class*=" icon-"] {

margin-top: 2px; font-size: 30px; line-height: 30px; display: block; }

  1. bodyContent .page-header .page-header-content .user-login .name {

float: left; margin: -5px 10px 0; text-align: right; }

  1. bodyContent .page-header .page-header-content .user-login .name .first-name {

font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; display: block; margin: 0; }

  1. bodyContent .page-header .page-header-content .user-login .name .last-name {

font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; display: block; margin: 0; }

  1. bodyContent .page-region {

display: block; }

  1. bodyContent .page-region .page-region-content {

padding-top: 10px; padding-left: 0; padding-right: 0; padding-bottom: 20px; display: block; height: 100%; position: relative; }

.page.secondary .page-header .page-header-content h1, .page.secondary .page-header .page-header-content h2, .page.secondary .page-header .page-header-content h3, .page.secondary .page-header .page-header-content h4, .page.secondary .page-header .page-header-content h5 { position: absolute; margin: 0; padding: 0; left: 120px; bottom: 0; }

.page.secondary .page-region .page-region-content { padding-left: 120px; }

.page.snapped { width: 33.33%; height: 100%; float: left; border-right: 1px #ccc solid; }

.page.fill { width: 66.66%; height: 100%; float: right; border-left: 1px #ccc solid; }

.page.snapped #bodyContent .page-header .page-header-content h1, .page.snapped #bodyContent .page-header .page-header-content h2, .page.snapped #bodyContent .page-header .page-header-content h3, .page.snapped #bodyContent .page-header .page-header-content h4, .page.snapped #bodyContent .page-header .page-header-content h5 { margin-left: 20px; }

.page.snapped #bodyContent .page-region .page-region-content { padding-left: 20px; }

.page.fixed-header .page-header { position: fixed; top: 0; left: 0; right: 0; z-index: 10000; }

.page.fixed-header .page-region { padding-top: 140px; }

.page.with-sidebar .page-region { margin-left: 220px; width: auto;

  • zoom: 1;

}

.page.with-sidebar .page-region .page-region-content { padding-left: 20px; }

.page.with-sidebar .page-region:before, .page.with-sidebar .page-region:after { display: table; content: ""; }

.page.with-sidebar .page-region:after { clear: both; }

.app-bar { position: fixed; bottom: 0; left: 0; right: 0; min-height: 100px; background-color: #1d1d1d !important; }

.charms { position: fixed; right: 0; top: 0; bottom: 0; height: 100%; min-width: 200px; width: auto; }

.charms.place-left { left: 0; right: auto; }

.message-dialog { position: fixed; left: 0; right: 0; height: auto; min-height: 100px; top: 30%; padding: 10px 10px 0; }

.error-bar, .warning-bar, .info-bar { position: fixed; top: 0; left: 0; right: 0; padding: 10px 20px; color: #fff; min-height: 100px; }

.error-bar { background-color: #b91d47 !important; }

.warning-bar { background-color: #ffc40d !important; }

.info-bar { background-color: #2d89ef !important; }

.toolbar {

  • zoom: 1;

}

.toolbar a, .toolbar button { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; font-size: 14px; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-radius: 0; display: inline-block; vertical-align: middle; cursor: pointer; padding: 4px 10px; outline: none; min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; margin-right: 0px; }

.toolbar a.mini, .toolbar button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.toolbar a.big, .toolbar button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar a.mini, .toolbar button.mini { min-width: 22px; width: 22px; }

.toolbar a.big, .toolbar button.big { min-width: 48px; width: 48px; }

.toolbar a [class^="icon-"], .toolbar button [class^="icon-"], .toolbar a [class*=" icon-"], .toolbar button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.toolbar a [class^="icon-"].icon-large, .toolbar button [class^="icon-"].icon-large, .toolbar a [class*=" icon-"].icon-large, .toolbar button [class*=" icon-"].icon-large { line-height: .9em; }

.toolbar a.big [class^="icon-"], .toolbar button.big [class^="icon-"], .toolbar a.big [class*=" icon-"], .toolbar button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.toolbar a [class^="icon-"], .toolbar button [class^="icon-"], .toolbar a [class*=" icon-"], .toolbar button [class*=" icon-"] { margin-right: 5px; }

.toolbar a [class^="icon-"].right, .toolbar button [class^="icon-"].right, .toolbar a [class*=" icon-"].right, .toolbar button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar a.standart, .toolbar button.standart { min-width: 90px; min-height: 32px; }

.toolbar a:active, .toolbar button:active, .toolbar a.default:active, .toolbar button.default:active { top: 1px; left: 1px; }

.toolbar a:disabled, .toolbar button:disabled, .toolbar a.disabled, .toolbar button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.toolbar a.default, .toolbar button.default { background-color: #008287; color: #fff; }

.toolbar a:hover, .toolbar button:hover, .toolbar a.default:hover, .toolbar button.default:hover { color: inherit; }

.toolbar a:focus, .toolbar button:focus { outline: 0; border: 1px #353535 dotted; }

.toolbar a.mini, .toolbar button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.toolbar a.big, .toolbar button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar a img, .toolbar button img { width: 16px; height: 16px; position: absolute; top: 8px; left: 8px; }

.toolbar a { padding: 5px 0; }

.toolbar:before, .toolbar:after { display: table; content: ""; }

.toolbar:after { clear: both; }

.toolbar .toolbar-group { margin-right: 20px; margin-bottom: 10px; float: left; }

.toolbar-vertical { width: 33px; float: left; margin-right: 10px;

  • zoom: 1;

}

.toolbar-vertical a, .toolbar-vertical button { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; font-size: 14px; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-radius: 0; display: inline-block; vertical-align: middle; cursor: pointer; padding: 4px 10px; outline: none; min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; margin-bottom: 5px; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-width: 22px; width: 22px; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-width: 48px; width: 48px; }

.toolbar-vertical a [class^="icon-"], .toolbar-vertical button [class^="icon-"], .toolbar-vertical a [class*=" icon-"], .toolbar-vertical button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.toolbar-vertical a [class^="icon-"].icon-large, .toolbar-vertical button [class^="icon-"].icon-large, .toolbar-vertical a [class*=" icon-"].icon-large, .toolbar-vertical button [class*=" icon-"].icon-large { line-height: .9em; }

.toolbar-vertical a.big [class^="icon-"], .toolbar-vertical button.big [class^="icon-"], .toolbar-vertical a.big [class*=" icon-"], .toolbar-vertical button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.toolbar-vertical a [class^="icon-"], .toolbar-vertical button [class^="icon-"], .toolbar-vertical a [class*=" icon-"], .toolbar-vertical button [class*=" icon-"] { margin-right: 5px; }

.toolbar-vertical a [class^="icon-"].right, .toolbar-vertical button [class^="icon-"].right, .toolbar-vertical a [class*=" icon-"].right, .toolbar-vertical button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.toolbar-vertical a.standart, .toolbar-vertical button.standart { min-width: 90px; min-height: 32px; }

.toolbar-vertical a:active, .toolbar-vertical button:active, .toolbar-vertical a.default:active, .toolbar-vertical button.default:active { top: 1px; left: 1px; }

.toolbar-vertical a:disabled, .toolbar-vertical button:disabled, .toolbar-vertical a.disabled, .toolbar-vertical button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.toolbar-vertical a.default, .toolbar-vertical button.default { background-color: #008287; color: #fff; }

.toolbar-vertical a:hover, .toolbar-vertical button:hover, .toolbar-vertical a.default:hover, .toolbar-vertical button.default:hover { color: inherit; }

.toolbar-vertical a:focus, .toolbar-vertical button:focus { outline: 0; border: 1px #353535 dotted; }

.toolbar-vertical a.mini, .toolbar-vertical button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.toolbar-vertical a.big, .toolbar-vertical button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.toolbar-vertical a img, .toolbar-vertical button img { width: 16px; height: 16px; position: absolute; top: 8px; left: 8px; }

.toolbar-vertical a { padding: 5px 0; }

.toolbar-vertical:before, .toolbar-vertical:after { display: table; content: ""; }

.toolbar-vertical:after { clear: both; }

.toolbar-vertical .toolbar-group { margin-bottom: 20px; }

.image-button { position: relative; border: 0; padding-right: 45px; }

.image-button img, .image-button:active img { position: absolute; right: 0; margin-left: 32px; padding: 5px; height: 100%; top: 0px; margin-left: 0px; box-sizing: border-box; border: 1px transparent solid; z-index: 2; }

.button-set a, .button-set button { margin-right: 0; text-align: center; }

.button-set a img, .button-set button img { background-color: transparent; }

.button-set a { padding: 5px 0; }

.button-set button.active { background-color: #008287; color: #fff; }

.shortcuts { margin-bottom: 10px; }

.shortcut { width: 92px; height: 92px; display: inline-block; margin: 0 10px 10px 0; vertical-align: top; text-decoration: none; background: #F3F3F3; text-align: center; cursor: pointer; border: 0; border-bottom: 2px transparent solid; position: relative; }

.shortcut:hover { border-color: red; }

.shortcut:active { background: #F3F3F3; top: 1px; left: 1px; }

.shortcut > .icon { margin-top: .25em; margin-bottom: .25em; font-size: 32px; color: #888; display: block; float: none; }

.shortcut > .label { display: block; font-weight: 400; color: #666; background: transparent !important; }

.shortcut > .badge { position: absolute; right: 0; top: 0; background-color: #2d89ef; padding: 5px; margin: 0 !important; text-align: center; display: block; font-size: 9pt; color: #fff; line-height: 11pt; }

a.shortcut { padding: 12px 0; }

a.shortcut .label { font-size: 9pt; }

.pagination { width: auto; margin-bottom: 10px; }

.pagination > ul {

margin-left: 0; list-style: none; margin: 0; }

.pagination > ul li { display: inline-block; margin-right: 1px; position: relative; }

.pagination > ul li a { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; font-size: 14px; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-radius: 0; display: inline-block; padding: 4px 10px; outline: none; min-height: 32px; width: 32px; padding: 0; position: relative; display: block; float: left; font-size: 10pt; padding: 5px; min-width: 32px; height: 32px; text-align: center; vertical-align: middle; cursor: pointer; margin-right: 1px; }

.pagination > ul li a.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.pagination > ul li a.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.pagination > ul li a.mini { min-width: 22px; width: 22px; }

.pagination > ul li a.big { min-width: 48px; width: 48px; }

.pagination > ul li a [class^="icon-"], .pagination > ul li a [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.pagination > ul li a [class^="icon-"].icon-large, .pagination > ul li a [class*=" icon-"].icon-large { line-height: .9em; }

.pagination > ul li a.big [class^="icon-"], .pagination > ul li a.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.pagination > ul li a [class^="icon-"], .pagination > ul li a [class*=" icon-"] { margin-right: 5px; }

.pagination > ul li a [class^="icon-"].right, .pagination > ul li a [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.pagination > ul li a.standart { min-width: 90px; min-height: 32px; }

.pagination > ul li a:active, .pagination > ul li a.default:active { top: 1px; left: 1px; }

.pagination > ul li a:disabled, .pagination > ul li a.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.pagination > ul li a.default { background-color: #008287; color: #fff; }

.pagination > ul li a:hover, .pagination > ul li a.default:hover { color: inherit; }

.pagination > ul li a:focus { outline: 0; border: 1px #353535 dotted; }

.pagination > ul li a.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.pagination > ul li a.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.pagination > ul li a img { width: 16px; height: 16px; position: absolute; top: 8px; left: 8px; }

.pagination > ul li a:hover { background-color: #1d1d1d; color: #ffffff; }

.pagination > ul li a:active { top: 1px; left: 1px; }

.pagination > ul li.first a, .pagination > ul li.prev a, .pagination > ul li.next a, .pagination > ul li.last a { font-size: 20pt; }

.pagination > ul li.first a:before, .pagination > ul li.prev a:before, .pagination > ul li.next a:before, .pagination > ul li.last a:before { position: absolute; left: 50%; top: 0; margin-left: -7px; content: "\25C4"; font-size: 1.5em; }

.pagination > ul li.first a:before { content: "\AB"; margin-left: -10px; }

.pagination > ul li.prev a:before { content: "\2039"; }

.pagination > ul li.next a:before { content: "\203A"; }

.pagination > ul li.last a:before { content: "\BB"; margin-left: -10px; }

.pagination > ul li.active a { background-color: #008287; color: #ffffff; }

.pagination > ul li.disabled a, .pagination > ul li.spaces a { background-color: #f2f2f2; color: #1e1e1e; cursor: not-allowed; }

.pagination > ul li.disabled a:active, .pagination > ul li.spaces a:active { top: 0; left: 0; }

.pagination > ul li.disabled a { color: #1e1e1e; }

.pagination > ul li.spaces a { background-color: #ffffff; cursor: default; }

table { width: 100%; border-collapse: separate; margin: 0 0 20px; }

table thead tr th, table thead tr td { display: table-cell; vertical-align: bottom; padding-bottom: 5px; padding-top: 10px; padding-left: 5px; border-bottom: 1px #ddd solid; border-right: 1px #ddd solid; border-left: 1px transparent solid; border-top: 1px transparent solid; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: rgba(0, 0, 0, 0.6); text-align: left; }

table thead tr th.right, table thead tr td.right { text-align: right; padding-right: 10px; }

table thead tr th.last, table thead tr td.last { border-right: 1px transparent solid; }

table thead tr th:last-child, table thead tr td:last-child { border-right: 1px transparent solid; }

table tbody tr { border: 1px #fff solid; }

table tbody tr td { font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; padding: 3px 10px; border-right: 1px #ddd solid; border-bottom: 1px #ddd solid; border-left: 1px transparent solid; border-top: 1px transparent solid; box-sizing: border-box; }

table tbody tr td.right { text-align: right; }

table tbody tr td.center { text-align: center; }

table tbody tr td.last { border-right: 1px transparent solid; }

table tbody tr td:last-child { border-right: 1px transparent solid; }

table tbody tr.success { background-color: #00a300 !important; }

table tbody tr.error { background-color: #b91d47 !important; }

table tbody tr.warning { background-color: #e3a21a !important; }

table tbody tr.info { background-color: #2d89ef !important; }

table tbody tr.info td, table tbody tr.warning td, table tbody tr.error td, table tbody tr.success td { color: #ffffff !important; }

table tbody tr.selected-row { background-color: rgba(28, 183, 236, 0.1) !important; }

table tbody tr.selected-row td:first-child { border-left: 1px #1c98cc solid; }

table tbody tr.selected-row td:last-child { border-right: 1px #1c98cc solid; }

table tbody tr.selected-row td { border-top: 1px #1c98cc solid; border-bottom: 1px #1c98cc solid; }

table.striped tbody tr:nth-child(odd) { background-color: #f9f9f9; }

table.hovered { border-collapse: separate !important; }

table.hovered thead tr th:hover, table.hovered thead tr td:hover { border: 1px #1c98cc solid; background: rgba(28, 183, 236, 0.1); }

table.hovered tbody tr:hover { background-color: rgba(28, 183, 236, 0.1); }

table.hovered tbody tr:hover td:first-child { border-left: 1px #1c98cc solid; }

table.hovered tbody tr:hover td:last-child { border-right: 1px #1c98cc solid; }

table.hovered tbody tr:hover td { border-top: 1px #1c98cc solid; border-bottom: 1px #1c98cc solid; }

table.bordered { border-collapse: separate !important; border: 1px #ccc solid !important; }

table.bordered tbody tr:last-child td { border-bottom: 0; }

.oh, .ot, .tt { float: left; margin: 0 2% 2% 0; width: 48%; }

.ot { width: 31%; }

.tt { width: 65%; }

.cl { clear: both; }

.item-padding { margin-right: 20px; margin-bottom: 5px; }

.column-padding { margin: 0 10px; }

.group-padding { margin: 0 40px; }

.span1 { width: 60px; }

.span2 { width: 140px; }

.span3 { width: 220px; }

.span4 { width: 300px; }

.span5 { width: 380px; }

.span6 { width: 460px; }

.span7 { width: 540px; }

.span8 { width: 620px; }

.span9 { width: 700px; }

.span10 { width: 780px; }

.span11 { width: 860px; }

.span12 { width: 940px; }

.offset1 { margin-left: 80px; }

.offset2 { margin-left: 160px; }

.offset3 { margin-left: 240px; }

.offset4 { margin-left: 320px; }

.offset5 { margin-left: 400px; }

.offset6 { margin-left: 480px; }

.offset7 { margin-left: 560px; }

.offset8 { margin-left: 640px; }

.offset9 { margin-left: 720px; }

.offset10 { margin-left: 800px; }

.offset11 { margin-left: 880px; }

.offset12 { margin-left: 960px; }

[class*="span"] { float: none; min-height: 1px; margin-right: 20px; margin-bottom: 5px;

  • zoom: 1;

}

[class*="span"]:before, [class*="span"]:after { display: table; content: ""; }

[class*="span"]:after { clear: both; }

[class*="span"]:last-child { margin-right: 0; }

[class*="span"] > img { max-width: 100%; height: auto; }

.grid { margin: 0 0 20px; display: block; height: auto; width: 100%;

  • zoom: 1;

}

.grid.no-margin { margin: 0; }

.grid.margin-row { margin-bottom: 5px; }

.grid .grid { margin-top: 2.5px; margin-bottom: 2.5px; }

.grid .group { margin-right: 80px; float: left; width: auto; height: auto; min-height: 1px; }

.grid .row { width: 100%;

  • zoom: 1;

}

.grid .row:before, .grid .row:after { display: table; content: ""; }

.grid .row:after { clear: both; }

.grid .row [class*="span"] { float: left; }

.grid.element-border [class*="span"] { border: 1px #ccc dotted; }

.grid:before, .grid:after { display: table; content: ""; }

.grid:after { clear: both; }

.grid > .row::before, .grid > .row::after { content: normal; }

td[class*="span"], th[class*="span"] { display: table-cell !important; float: none !important; padding: 0 !important; }

.hero-unit { position: relative; margin: 0 0 10px; padding: 20px; background-color: #f1f1f1; width: 100%;

  • zoom: 1;

}

.hero-unit:before, .hero-unit:after { display: table; content: ""; }

.hero-unit:after { clear: both; }

.dropdown-menu { position: absolute; background-color: #fff; margin-left: 0; list-style: none; top: 100%; z-index: 11010; float: left; border: 1px solid rgba(0, 0, 0, 0.2); box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2); min-width: 160px; padding-bottom: 5px; padding-top: 5px; padding-left: 0; display: none; }

.dropdown-menu.place-right { right: 0; left: auto; }

.dropdown-menu a { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: #000000; display: block; width: 100%; padding: 3px 20px; white-space: nowrap; font-size: 14px; cursor: pointer; }

.dropdown-menu a:hover { color: rgba(0, 0, 0, 0.8); }

.dropdown-menu a:active { color: rgba(0, 0, 0, 0.4); }

.dropdown-menu a:hover { background-color: #2d89ef !important; color: #ffffff !important; }

.dropdown-menu li { display: list-item; line-height: 20px; }

.dropdown-menu .divider { height: 1px; margin: 9px 1px; overflow: hidden; background-color: #e5e5e5; }

.dropdown-menu.open { display: block !important; }

.nav-bar { background-color: #2d89ef; width: 100%; display: block; margin: 0; padding: 0; z-index: 1000;

  • zoom: 1;

}

.nav-bar .nav-bar-inner {

  • zoom: 1;

}

.nav-bar .nav-bar-inner .element, .nav-bar .nav-bar-inner a .element { position: relative; margin: 5px; line-height: 20px; height: 20px; float: left; display: inline-block; padding: 0; font-weight: normal; font-size: 10pt; color: #fff; }

.nav-bar .nav-bar-inner .element.brand, .nav-bar .nav-bar-inner a .element.brand { font-size: 1.15em; }

.nav-bar .nav-bar-inner .element img, .nav-bar .nav-bar-inner a .element img { height: 100%; }

.nav-bar .nav-bar-inner .element a, .nav-bar .nav-bar-inner a .element a { line-height: 20px; height: 20px; font-size: 10pt; }

.nav-bar .nav-bar-inner .element [class^="icon-"]:before, .nav-bar .nav-bar-inner a .element [class^="icon-"]:before, .nav-bar .nav-bar-inner .element [class*=" icon-"]:before, .nav-bar .nav-bar-inner a .element [class*=" icon-"]:before { display: inline-block; margin: 0; padding: 0; display: block; float: left; margin: 0 5px; }

.nav-bar .nav-bar-inner > ul.menu { margin-left: 0; list-style: none; padding: 0; margin: 0; }

.nav-bar .nav-bar-inner > ul.menu > li { display: block; float: left; margin-right: 5px; position: relative; padding: 5px 15px 5px 5px; }

.nav-bar .nav-bar-inner > ul.menu > li a { display: block; float: left; color: #ffffff; font-size: 10pt; }

.nav-bar .nav-bar-inner > ul.menu > li ul.dropdown-menu { z-index: 1001; border: 0; left: 0px; }

.nav-bar .nav-bar-inner > ul.menu > li ul.dropdown-menu li a { display: block; float: none; color: #1e1e1e; padding: 3px 20px; }

.nav-bar .nav-bar-inner > ul.menu.open { display: block !important; }

.nav-bar .nav-bar-inner > .divider, .nav-bar .nav-bar-inner > ul.menu > li.divider { position: relative; margin: 5px; line-height: 20px; height: 20px; float: left; display: inline-block; padding: 0; font-weight: normal; font-size: 10pt; color: #fff; width: 1px; border-right: 1px #e6e6e6 solid; }

.nav-bar .nav-bar-inner > .divider.brand, .nav-bar .nav-bar-inner > ul.menu > li.divider.brand { font-size: 1.15em; }

.nav-bar .nav-bar-inner > .divider img, .nav-bar .nav-bar-inner > ul.menu > li.divider img { height: 100%; }

.nav-bar .nav-bar-inner > .divider a, .nav-bar .nav-bar-inner > ul.menu > li.divider a { line-height: 20px; height: 20px; font-size: 10pt; }

.nav-bar .nav-bar-inner > .divider [class^="icon-"]:before, .nav-bar .nav-bar-inner > ul.menu > li.divider [class^="icon-"]:before, .nav-bar .nav-bar-inner > .divider [class*=" icon-"]:before, .nav-bar .nav-bar-inner > ul.menu > li.divider [class*=" icon-"]:before { display: inline-block; margin: 0; padding: 0; display: block; float: left; margin: 0 5px; }

.nav-bar .nav-bar-inner [data-role=dropdown] { margin-right: 20px !important; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a { cursor: pointer; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a:before { position: absolute; content: "\203A"; display: block; font-size: 1.4em; left: 100%; margin-left: -10px; top: 8px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); }

.nav-bar .nav-bar-inner .pull-menu { display: none; float: right; color: #fff; cursor: pointer; font: 1.8em sans-serif; margin-right: 0px; position: relative; height: 20px; width: 20px; line-height: 20px; }

.nav-bar .nav-bar-inner .pull-menu:before { content: "\2261"; position: absolute; font-size: 20pt; top: 5px; left: 0; }

.nav-bar .nav-bar-inner:before, .nav-bar .nav-bar-inner:after { display: table; content: ""; }

.nav-bar .nav-bar-inner:after { clear: both; }

.nav-bar.bg-color-blue .nav-bar-inner .menu li a:hover { background-color: #2d89ef !important; }

.nav-bar.bg-color-blueLight .nav-bar-inner .menu li a:hover { background-color: #eff4ff !important; }

.nav-bar.bg-color-blueDark .nav-bar-inner .menu li a:hover { background-color: #2b5797 !important; }

.nav-bar.bg-color-green .nav-bar-inner .menu li a:hover { background-color: #00a300 !important; }

.nav-bar.bg-color-greenLight .nav-bar-inner .menu li a:hover { background-color: #99b433 !important; }

.nav-bar.bg-color-greenDark .nav-bar-inner .menu li a:hover { background-color: #1e7145 !important; }

.nav-bar.bg-color-red .nav-bar-inner .menu li a:hover { background-color: #b91d47 !important; }

.nav-bar.bg-color-yellow .nav-bar-inner .menu li a:hover { background-color: #ffc40d !important; }

.nav-bar.bg-color-orange .nav-bar-inner .menu li a:hover { background-color: #e3a21a !important; }

.nav-bar.bg-color-orangeDark .nav-bar-inner .menu li a:hover { background-color: #da532c !important; }

.nav-bar.bg-color-pink .nav-bar-inner .menu li a:hover { background-color: #9f00a7 !important; }

.nav-bar.bg-color-pinkDark .nav-bar-inner .menu li a:hover { background-color: #7e3878 !important; }

.nav-bar.bg-color-purple .nav-bar-inner .menu li a:hover { background-color: #603cba !important; }

.nav-bar.bg-color-darken .nav-bar-inner .menu li a:hover { background-color: #1d1d1d !important; }

.nav-bar.bg-color-lighten .nav-bar-inner .menu li a:hover { background-color: #d5e7ec !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li:hover { background-color: #e6e6e6 !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li a:hover { background-color: #e6e6e6 !important; }

.nav-bar.bg-color-white .nav-bar-inner .menu li a { color: #1d1d1d !important; }

.nav-bar.bg-color-white .nav-bar-inner .element { color: #1d1d1d !important; }

.nav-bar.bg-color-white .nav-bar-inner .pull-menu { color: #1d1d1d !important; }

.nav-bar.bg-color-grayDark .nav-bar-inner .menu li a:hover { background-color: #525252 !important; }

.nav-bar.bg-color-magenta .nav-bar-inner .menu li a:hover { background-color: #ff0097 !important; }

.nav-bar.bg-color-teal .nav-bar-inner .menu li a:hover { background-color: #00aba9 !important; }

.nav-bar.bg-color-redLight .nav-bar-inner .menu li a:hover { background-color: #ee1111 !important; }

.nav-bar:before, .nav-bar:after { display: table; content: ""; }

.nav-bar:after { clear: both; }

.nav-bar.fixed-top, .nav-bar.fixed-bottom { position: fixed; z-index: 10000; left: 0; }

.nav-bar.fixed-top { top: 0; bottom: auto; }

.nav-bar.fixed-bottom { bottom: 0; top: auto; }

.nav-bar .nav-bar-inner.container { width: 940px; margin: auto; }

.side-nav ul { margin: 0; padding: 0; list-style: none; margin-bottom: 20px; }

.side-nav ul .title { color: #4f4f4f; font-family: Segoe UI, Arial, Verdana, Tahoma, sans-serif; font-size: 12pt; margin: 0 0 5px 0; border-bottom: 1px #ccc solid; }

.side-nav ul > li > a { display: block; padding: 3px 10px 3px 0; position: relative; color: #014E85; padding-left: 3px; font-size: 10pt; }

.side-nav ul.close > li { display: none; }

.side-nav ul.close > li[class^=title] { display: list-item; }

.page-sidebar { display: block; width: 213px; float: left; min-height: 100% !important; height: auto; background-color: #EBEBEB; padding-top: 10px; padding-bottom: 10px; margin-top: 10px; margin-left: 7px; }

.page-sidebar a { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; color: #000000; display: block; width: 100%; padding: 5px 20px 5px 10px; white-space: nowrap; font-size: 14px; cursor: pointer; }

.page-sidebar a:hover { color: rgba(0, 0, 0, 0.8); }

.page-sidebar a:active { color: rgba(0, 0, 0, 0.4); }

.page-sidebar a:hover { background-color: #2d89ef !important; color: #ffffff !important; }

.page-sidebar li { display: list-item; line-height: 20px; position: relative; }

.page-sidebar > ul > li > a { font-size: 1.1em; }

.page-sidebar > ul > li a.lead, .page-sidebar > ul > li.lead a, .page-sidebar > ul > li.lead { font-weight: bold; }

.page-sidebar > ul > li.sticker:before { content: "."; position: absolute; width: 7px; height: 28px; left: -7px; text-indent: -9999px; border-top-left-radius: 10px; border-bottom-left-radius: 10px; background-color: #ebebeb; }

.page-sidebar > ul > li.sticker.sticker-color-blue:before { background-color: #2d89ef; }

.page-sidebar > ul > li.sticker.sticker-color-blueLight:before { background-color: #eff4ff; }

.page-sidebar > ul > li.sticker.sticker-color-blueDark:before { background-color: #2b5797; }

.page-sidebar > ul > li.sticker.sticker-color-green:before { background-color: #00a300 !important; }

.page-sidebar > ul > li.sticker.sticker-color-greenLight:before { background-color: #99b433 !important; }

.page-sidebar > ul > li.sticker.sticker-color-greenDark:before { background-color: #1e7145 !important; }

.page-sidebar > ul > li.sticker.sticker-color-red:before { background-color: #b91d47 !important; }

.page-sidebar > ul > li.sticker.sticker-color-yellow:before { background-color: #ffc40d !important; }

.page-sidebar > ul > li.sticker.sticker-color-orange:before { background-color: #e3a21a !important; }

.page-sidebar > ul > li.sticker.sticker-color-orangeDark:before { background-color: #da532c !important; }

.page-sidebar > ul > li.sticker.sticker-color-pink:before { background-color: #9f00a7 !important; }

.page-sidebar > ul > li.sticker.sticker-color-pinkDark:before { background-color: #7e3878 !important; }

.page-sidebar > ul > li.sticker.sticker-color-purple:before { background-color: #603cba !important; }

.page-sidebar > ul > li.sticker.sticker-color-darken:before { background-color: #1d1d1d !important; }

.page-sidebar > ul > li.sticker.sticker-color-white:before { background-color: #ffffff !important; }

.page-sidebar > ul > li.sticker.sticker-color-grayDark:before { background-color: #525252 !important; }

.page-sidebar .divider { height: 1px; margin: 9px 1px; overflow: hidden; background-color: #e5e5e5; }

.page-sidebar ul { margin-left: 0; list-style: none; background-color: #EBEBEB; }

.page-sidebar ul.sub-menu { padding-top: 5px; padding-bottom: 5px; }

.page-sidebar ul.sub-menu a { padding: 5px 20px 5px 25px; }

.page-sidebar ul.sub-menu.light { background-color: #f9f9f9 !important; }

.page-sidebar .sidebar-dropdown-menu { display: none; }

.page-sidebar .sidebar-dropdown-menu.open { display: block; }

.page-sidebar > ul > li.dropdown { position: relative; }

.page-sidebar > ul > li.dropdown:after { content: ""; display: block; position: absolute; top: 6px; left: 100%; margin-left: -20px; width: 16px; height: 16px; background: no-repeat; background-position: 0 -1586px; z-index: 200; }

.page-sidebar > ul > li.dropdown.active:after { background-position: 0 -676px; }

.replies { margin-left: 0; list-style: none; }

.replies > div, .replies > li, .replies > span { position: relative; margin: 0 10px 10px 0; display: block; float: none !important; width: 310px; height: 150px; font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; height: auto; min-height: 70px; padding: 10px; }

.replies > div .avatar, .replies > li .avatar, .replies > span .avatar { width: 50px; height: 50px; overflow: hidden; display: table-cell; vertical-align: middle !important; background: #6e6e6e; box-shadow-bottom: inset 0px 0px 3px #fff; }

.replies > div .avatar img, .replies > li .avatar img, .replies > span .avatar img { width: 100%; height: 100%; display: inline-block !important; vertical-align: middle !important; }

.replies > div .reply, .replies > li .reply, .replies > span .reply { margin-left: 60px; margin-top: -50px; }

.replies > div .reply .date, .replies > li .reply .date, .replies > span .reply .date { float: right; font-size: 55%; color: #ffffff; }

.replies > div .reply .author, .replies > li .reply .author, .replies > span .reply .author { color: #ffffff; }

.replies > div .reply .text, .replies > li .reply .text, .replies > span .reply .text { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #000000; color: #ffffff; line-height: 16px; }

.replies > div .reply .text:hover, .replies > li .reply .text:hover, .replies > span .reply .text:hover { color: rgba(0, 0, 0, 0.8); }

.replies > div .reply .text:active, .replies > li .reply .text:active, .replies > span .reply .text:active { color: rgba(0, 0, 0, 0.4); }

.replies > div .reply .text:hover, .replies > li .reply .text:hover, .replies > span .reply .text:hover { color: #ffffff; }

.replies > div .sticker, .replies > li .sticker, .replies > span .sticker { width: 0; height: 0; border-top: 10px solid #ffffff; position: absolute; display: block; z-index: 1000; }

.replies > div .sticker.sticker-color-blue, .replies > li .sticker.sticker-color-blue, .replies > span .sticker.sticker-color-blue { border-color: #2d89ef !important; }

.replies > div .sticker.sticker-color-blueLight, .replies > li .sticker.sticker-color-blueLight, .replies > span .sticker.sticker-color-blueLight { border-color: #eff4ff !important; }

.replies > div .sticker.sticker-color-blueDark, .replies > li .sticker.sticker-color-blueDark, .replies > span .sticker.sticker-color-blueDark { border-color: #2b5797 !important; }

.replies > div .sticker.sticker-color-green, .replies > li .sticker.sticker-color-green, .replies > span .sticker.sticker-color-green { border-color: #00a300 !important; }

.replies > div .sticker.sticker-color-greenLight, .replies > li .sticker.sticker-color-greenLight, .replies > span .sticker.sticker-color-greenLight { border-color: #99b433 !important; }

.replies > div .sticker.sticker-color-greenDark, .replies > li .sticker.sticker-color-greenDark, .replies > span .sticker.sticker-color-greenDark { border-color: #1e7145 !important; }

.replies > div .sticker.sticker-color-red, .replies > li .sticker.sticker-color-red, .replies > span .sticker.sticker-color-red { border-color: #b91d47 !important; }

.replies > div .sticker.sticker-color-yellow, .replies > li .sticker.sticker-color-yellow, .replies > span .sticker.sticker-color-yellow { border-color: #ffc40d !important; }

.replies > div .sticker.sticker-color-orange, .replies > li .sticker.sticker-color-orange, .replies > span .sticker.sticker-color-orange { border-color: #e3a21a !important; }

.replies > div .sticker.sticker-color-orangeDark, .replies > li .sticker.sticker-color-orangeDark, .replies > span .sticker.sticker-color-orangeDark { border-color: #da532c !important; }

.replies > div .sticker.sticker-color-pink, .replies > li .sticker.sticker-color-pink, .replies > span .sticker.sticker-color-pink { border-color: #9f00a7 !important; }

.replies > div .sticker.sticker-color-pinkDark, .replies > li .sticker.sticker-color-pinkDark, .replies > span .sticker.sticker-color-pinkDark { border-color: #7e3878 !important; }

.replies > div .sticker.sticker-color-purple, .replies > li .sticker.sticker-color-purple, .replies > span .sticker.sticker-color-purple { border-color: #603cba !important; }

.replies > div .sticker.sticker-color-darken, .replies > li .sticker.sticker-color-darken, .replies > span .sticker.sticker-color-darken { border-color: #1d1d1d !important; }

.replies > div .sticker.sticker-color-white, .replies > li .sticker.sticker-color-white, .replies > span .sticker.sticker-color-white { border-color: #ffffff !important; }

.replies > div .sticker.sticker-color-lighten, .replies > li .sticker.sticker-color-lighten, .replies > span .sticker.sticker-color-lighten { border-color: #d5e7ec !important; }

.replies > div .sticker.sticker-color-grayDark, .replies > li .sticker.sticker-color-grayDark, .replies > span .sticker.sticker-color-grayDark { border-color: #525252 !important; }

.replies > div .sticker.sticker-color-magenta, .replies > li .sticker.sticker-color-magenta, .replies > span .sticker.sticker-color-magenta { border-color: #ff0097 !important; }

.replies > div .sticker.sticker-color-teal, .replies > li .sticker.sticker-color-teal, .replies > span .sticker.sticker-color-teal { border-color: #00aba9 !important; }

.replies > div .sticker.sticker-color-redLight, .replies > li .sticker.sticker-color-redLight, .replies > span .sticker.sticker-color-redLight { border-color: #ee1111 !important; }

.replies > div .sticker.sticker-left, .replies > li .sticker.sticker-left, .replies > span .sticker.sticker-left { border-left: 20px solid transparent !important; left: -20px; }

.replies > div .sticker.sticker-right, .replies > li .sticker.sticker-right, .replies > span .sticker.sticker-right { border-right: 20px solid transparent !important; right: -20px; }

.notices { list-style: none; margin: 0; padding: 0; }

.notices > div, .notices > li, .notices > span, .notices > a { width: 100%; height: 90px; display: block; overflow: hidden; position: relative; margin-bottom: 10px; }

.notices > div .notice-header, .notices > li .notice-header, .notices > span .notice-header, .notices > a .notice-header, .notices > div .header, .notices > li .header, .notices > span .header, .notices > a .header { position: relative; background: transparent; font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; font-size: 12pt; margin-top: 5px; margin-left: 10px; }

.notices > div .notice-text, .notices > li .notice-text, .notices > span .notice-text, .notices > a .notice-text, .notices > div .text, .notices > li .text, .notices > span .text, .notices > a .text { position: relative; margin-right: 50px; margin-left: 10px; color: #fff; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 8pt; font-smooth: always; line-height: 10pt; margin-top: -5px; line-height: 16px; }

.notices > div .notice-icon, .notices > li .notice-icon, .notices > span .notice-icon, .notices > a .notice-icon, .notices > div .icon, .notices > li .icon, .notices > span .icon, .notices > a .icon { position: absolute; right: 10px; bottom: 5px; }

.notices > div .notice-icon img, .notices > li .notice-icon img, .notices > span .notice-icon img, .notices > a .notice-icon img, .notices > div .icon img, .notices > li .icon img, .notices > span .icon img, .notices > a .icon img { width: 32px; height: 32px; }

.notices > div .notice-image, .notices > li .notice-image, .notices > span .notice-image, .notices > a .notice-image, .notices > div .image, .notices > li .image, .notices > span .image, .notices > a .image { max-height: 48px; width: 48px; height: 48px; margin: 20px 20px 20px 20px; float: left; }

.notices > div .notice-image img, .notices > li .notice-image img, .notices > span .notice-image img, .notices > a .notice-image img, .notices > div .image img, .notices > li .image img, .notices > span .image img, .notices > a .image img { width: 48px; height: 48px; }

.notices > div .close, .notices > li .close, .notices > span .close, .notices > a .close { z-index: 2; position: absolute; top: 5px; right: 10px; cursor: pointer; font-weight: bold; text-decoration: none; color: #fff !important; }

.notices > div .close::before, .notices > li .close::before, .notices > span .close::before, .notices > a .close::before { content: "\00d7"; color: #fff !important; }

.notices > div .image-large, .notices > li .image-large, .notices > span .image-large, .notices > a .image-large { width: 88px; height: 88px; margin: 1px 10px 1px 1px; overflow: hidden; float: left; }

.notices > div .image-large img, .notices > li .image-large img, .notices > span .image-large img, .notices > a .image-large img { width: 88px; height: 88px; }

.tile-group { margin: 0; margin-right: 80px; float: left; width: auto; height: auto; min-height: 1px; width: 802px; }

.tile { display: block; float: left; background-color: #525252; width: 150px; height: 150px; cursor: pointer; box-shadow: inset 0px 0px 1px #FFFFCC; text-decoration: none; color: #ffffff; position: relative; font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; margin: 0 10px 10px 0; overflow: hidden; }

.tile .offset1tile { margin-left: 160px; }

.tile .upset1tile { margin-top: -160px; }

.tile .offset1tile { margin-left: 320px; }

.tile .upset1tile { margin-top: -320px; }

.tile * { color: #ffffff; }

.tile .tile-content { width: 100%; height: 100%; padding: 0; padding-bottom: 30px; vertical-align: top; padding: 10px 15px; overflow: hidden; text-overflow: ellipsis; position: relative; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #000000; color: #ffffff; line-height: 16px; }

.tile .tile-content:hover { color: rgba(0, 0, 0, 0.8); }

.tile .tile-content:active { color: rgba(0, 0, 0, 0.4); }

.tile .tile-content:hover { color: #ffffff; }

.tile .tile-content h1, .tile .tile-content h2, .tile .tile-content h3, .tile .tile-content h4, .tile .tile-content h5, .tile .tile-content h6 { font-size: 14pt; }

.tile .tile-content h1, .tile .tile-content h2, .tile .tile-content h3, .tile .tile-content h4, .tile .tile-content h5, .tile .tile-content h6, .tile .tile-content p { padding: 0; margin: 0; line-height: 24px; }

.tile .tile-content p { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #000000; color: #ffffff; line-height: 16px; overflow: hidden; text-overflow: ellipsis; }

.tile .tile-content p:active { color: rgba(0, 0, 0, 0.4); }

.tile.icon > .tile-content { padding: 0; }

.tile.icon > .tile-content > img { position: absolute; width: 64px; height: 64px; top: 50%; left: 50%; margin-left: -32px; margin-top: -32px; }

.tile.icon > .tile-content > i { position: absolute; width: 64px; height: 64px; top: 30%; left: 50%; margin-left: -32px; font-size: 64px; -webkit-margin-before: -6px; }

.tile.image > .tile-content, .tile.image-slider > .tile-content { padding: 0; }

.tile.image > .tile-content > img, .tile.image-slider > .tile-content > img { width: 100%; height: auto; min-height: 100%; max-width: 100%; }

.tile.image-set > .tile-content { margin: 0; padding: 0; width: 25% !important; height: 50%; float: left; border: 1px #1e1e1e solid; }

.tile.image-set > .tile-content > img { min-width: 100%; width: 100%; height: auto; min-height: 100%; }

.tile.image-set .tile-content:first-child { width: 50% !important; float: left; height: 100%; }

.tile.double { width: 310px; }

.tile.triple { width: 470px; }

.tile.quadro { width: 630px; }

.tile.double-vertical { height: 310px; }

.tile.triple-vertical { height: 470px; }

.tile.quadro-vertical { height: 630px; }

.tile .brand, .tile .tile-status { position: absolute; bottom: 0; left: 0; right: 0; min-height: 30px; background-color: transparent;

  • zoom: 1;

}

.tile .brand:before, .tile .tile-status:before, .tile .brand:after, .tile .tile-status:after { display: table; content: ""; }

.tile .brand:after, .tile .tile-status:after { clear: both; }

.tile .brand > .badge, .tile .tile-status > .badge { position: absolute; bottom: 0; right: 0; right: 5px; margin-bottom: 0; color: #ffffff; width: 34px; height: 28px; text-align: center; font-family: 'Segoe UI Semibold', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 600; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; padding-top: 3px; }

.tile .brand > .badge.activity, .tile .tile-status > .badge.activity { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAGMSURBVDhPvZMtTwNBEIbv2mtScaICcQJRgSgJCQIEhqSiAlEHAlFRwU/ov0AgUEgUsrIkiJIgMOAQJFSQQAIJJBWIu95Hj2eGvXIpB3W8yWTn452Z3dld25pDmqZuFEWdcrm8jr6JK7Bt+wb9Ft85+vsXswBxHHdIfmFNi4TYG7InXAp6ss52kCTJIc6e6KzSVbrdYzrYDaSFXZU4uEQ8x3FW1ZpMJge5Tn3IdQ3kID5iw4zHTqIsUEP3TWCA7WhgDjRZg/eUFRCR3Fl3KYJjyfALIUU46jHcsSlQl8FdmQJnhrcQJFbJ6QZB0LDDMNyS4XBFo1Kp9Gw4/wi247GLHmvNuBaC47Y5gtzIQB1mBmMGdDSdTpfV+QdM8vfcsqkap6ClgQIQa+a4bXViPGRO5ILjuBqYAwk7yIfhXcNz9CljDFkkST6P4JGjnHA7d+gBxAY3tIve1Khljbi1beKvakHQp0uhfTrMjvOL9H3fX9FE8OM7yxAhdem4QWHZkSufSoTYaaVSkY9kYFmfXgyTciI3uacAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.alert, .tile .tile-status > .badge.alert { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAFeSURBVDhPpZMtT8RAEIbb7YoTJ04gkQgQuBNIEpB4LD8AwQ9AkCCQhGAvQSAuKHCIE0gEP+DEISAhQYK4pE0/eWa65a7lSvh4k8nsvDv77sxs67UhSZLNNE0LZ3uO/gLj/J+hAkVRWI1+geqMCuR5fkKZoyiKViX+DuQu094wy7KhEmEYrkAk0qt4Nk5R77GszQCuE8fxIXxY8ZJjgiBY8n3/UcTwlsQDNifGmF29AcBtITyGOyan47gXXFfW2g/q+yi+VeptJhVgR1KRHp4HZI+bzknQlhYcvpQZuHRF8xmnCDyLL8MZEI9o4YkW3h1VB+o73DJp3to08l7xsw9Lng5i1EiSSV/Pcbdwzfk8MLcNqjIyye1STnHD5joln7lYcGWtXaP8gYsFfeJyHvR9waExt3wKsV74L3Brn/geu3OUDqiL1T7nNoEK8mLi9RUoZYqlsv4pqtf459/oeR8seozS7mDHCwAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.available, .tile .tile-status > .badge.available { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKvSURBVHjahJA/bJR1HMY/31977x33r2LuClc1LYM9TSAUr5gqtkVJjAkSFxYHE3VgaWRw0cUwOagxMZLApoXFBIwuHVSoQYkVMBXUpqSkMW9jaS25plh7/3rv+3scTIwixs/8PHn+2Bk/SVtN2mqxacYOKw13KfNiXtlneihmDONXqs0VVs/VXP1UqJvnc8qBeZoWYWf9JHXVqWkj2EX55G76X86R4W40aDHNzMdzLBwJLLEWm6fTI+o0knvZ+dkgO/cDfGczTNpl5gjxePrpY0SPMKwKT1A5nCe7Y4ofDgQEv/Ghn2AqunZabUmR9Fb8gQoaUVIVFTSiokaV0qDu0T694Y+rGbWktnQ5+nHiuP+IjrFjR4cqevj9wBK8beO87t6jiyzbKJAiIEWSreQxjAm7QGyeAwzRzb39i/7WFbdV2bGs0nxvs7zjxtlOgRwZPP6v7R5PmhQPUOKEneFLd4UECfqs51WXU/opDL6wb/mdDfJkEfrXgUKk2UKbiM/5BoD76d7reujOANwgJH9H8p14PDnSzBGySZsSReecDIAIDxj/jxH/LcQtW7UJ0E8f69RwuP+0Ohwb1CnTS0CCW6zK3Wb9a4AnNcgWktRoYHdpYhgtWvypfRSARVv5yVXd2smGWuzTHo7qeRZZpk7zH00cRos2ITd5yT/HQY0gPKGW3u0YPvZ06HB77tO2hx5jN5HFTNk11lgHRIs2VW5Tp8kRf5g3eYUUSa5y/eKsfn7NTvlPaCjqelwDF3bx4ADAeXeJc1xijpCYmDJ9jKrCIe0H4IaF81/56VGDJTvtPwV1IFmhTO/4AOWDSQIAWmwiRIokADEx08xeXGD5hUjxQp0GnQCdOAKS1RnNP7tO7VDOMmO9bB8qUQRghVVCW7raUOPEvH45W7IidRoA/DEAmmk0pL+n6f4AAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.unavailable, .tile .tile-status > .badge.unavailable { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKASURBVHjalJK9axxXFMV/772ZzOysVqvRDgtaSSwpJYFwY3ATEpIm5KNLawgp3Ljz/5E2bu20CYQUBoMNNnaRMkUKqYiQtIgdCQ0TaVc7M29n3nspzC7GMYYcuMWFe7jnHI4YjUY453DOYYyh0+l8opT63vO8L8MwbAshqKqq0lo/c849rqrquXMOIcSbGY1GWGsxxny0urr6MI7jH5RSAFhrAZBSLvc8z3+dTqf3lFL/SCnxAIwxwdra2tP19fXPAC4vL8myjKIoAIiiiF6vR7/fJ0mS75RSH19dXX0hpbwWx8fHrKys/JwkyV1rLYeHh5yenuKc420lzjm2trbY3d3F8zzyPH8ynU6/ERcXF3fiOP7D930ODg44OjoiDMOl7AWstZRlyXA4ZH9/H2MM4/H4K+l53n3f98myjJOTE4Ig+A95kUMURZydnXF+fo5SiiiKHkjf9z9f+AaWst+HRfKL2yiKbssgCNrOOWaz2Xs/vwulFLPZjLquCcPwDcM5x//B2/dyPp9XC3/WWoQQHyQbY2i32/i+T1VVTtZ1/QogSZJlGz/02VpLkiQAlGX5l2ya5mHTNPT7fba3tynLctnAd8llWTIYDNjY2MBaS1EUP0qt9YvJZPI7wM7ODsPhEK01WmuapqFpGrTWVFXFYDBgb28PIQTX19ev67r+TYzHY7TW3W63+zKO41sAaZqSZRk3NzcAtNtter0em5ubAEwmk7/zPP9USjkWaZoyn89xziWdTudRt9v9etGFuq4B8H1/aSXP89dFUdx1zp065xBpmlLXNUIIjDG0Wq1vPc+7H4bhnVarhRCCsiwpiuJPY8xPRVH8EgQBxhistfw7ABpxTL93U9x/AAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .badge.away, .tile .tile-status > .badge.away { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAJ2SURBVHjajJI7iFVnFIW//d9zz52ZO2fG14gzJBgbp5JYKPh+NqKxsxWMRZoBCxu1sAuBKFaClj5KDUQhRXybCIqICjqNYjFDhtExN45e7/uc8y+L/yJGp3A1+2fDWv/ea23zlQvIp0gpRgfrWbZRNrhP0cAOopEyGGSvWmQz15zq59SeuC5LsAis0MJ85SLKG8jXY3pXnKb8/X6iBAB8KLhuzZtQf/gbrWc/WTGetSgnAg9qlCiv/pNk1RYAqz3A6jeg/SyoxMtReRNKNsLAhj24gWW0726H+B3+9Rmyd3fPp5KyXMpf/SqNL5KelEIdH5Ke9Ejj8+SnjyrLWkolZbX7f/jZk5h/e3WN7197j0I/NnMMN3MYoiXgBv6/g+rQmUJDR/Ajv4BP0eylnU5u/pgK/Vj9Ee6/411y8gm5a4b1Qfwt9uYUrnoTXBGLvzvoFCXbDLDaVcjfd38WX0JBRCnUroRW/M1qRzRSxgPt55+NPRc8FJJgbtaB4rBz+phRxtcj//hylr5s4YDScvDVT0KfCw7yGpRGIYohfS2H3v4NoL6tYL3BbWwOsoHawY3y1tDJpp46p8pp5U2UrEcLD0BnCtT4bBIXyJ0J/Pwf0eAu8ELtiROO5uQtazy9LMAvPoKGDoU00n/CSr4K2RTkFfyCMRj+OWg2Ht9RNv27+X/PId8cVN+62/SvWAngqtehdq17yjmURlHfZjRvdxi98fyFr/21GWfT5ivnkQehRfSOnqV35S4KpW4w7ZB/1NNNMYf6wzukk3ulbBI1iIJkBBZX1Bn/gby621wyRrx0DcXhQGzPYOnEY/nmKbVeXLTicNcn+DAArZ4503S5ZjkAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.busy, .tile .tile-status > .badge.busy { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAACXBIWXMAAA7DAAAOwwHHb6hkAAAAIGNIUk0AAHolAACAgwAA+f8AAIDoAABSCAABFVgAADqXAAAXb9daH5AAAAKNSURBVHjajJI9a1RBGIWfGeLdmPXuKkR0Q0RTmFsFUxgQNcaPRonpbAW1sAlY2IhFfoCIVSDaaVImFhYWmkTxAwJBVgttNqTYQFAjAWPi7t3svXeOxeC3hQdeZpiZ887DmTFuchIlCUoSTLOJ6erqV7F4QYXCaTo68hgDHz82WFmZsbXauKrVWYUhBjCNBsZNTaF6HdVqAT09tzlw4BJhyD8Vx1Au36dSuWyC4LPJMlpwDur1HH19jzh48DiAefUK8+QJVCrgHHR3o2PHUH8/HD16jkKhi7m5UwTBF9zdu6RzcxOJpFRSduOG1N4u5XJ+3LlTam2Vtm+XGxlR2mgokZTOzz90o6PgpqcPpRsbP83GSKWSFEXS/v2+okjq7JRA7vp1pZLSZlPJ5OQZqx07hrVtG+b1a+zNm7B7N4ShR/8u56CtDfbswYyNYZ8+hS1bMPv2XbUKw5MGMNPTsLEBhQJIfwco+SZJAo8f+7XOzj5LR0cegIUFb/715j/lnKerVKDZhFLJWlnrN9OU/1aW/Zha8+FDA4Dublhfh+8N/yVr4etXiCIIAvj0SZa1tRcAOnECtm6FWg2M+dtsDGxu8uMsYJaX31q7unpbcYyOHEFXrsDyMtTrv5NY683VKu7iRTQ4CBKqVm/h7twhnZ9/kEhK41ju2jWpWJTa2qRdu3zl81I+r2x4WNnamv8H5fKLZHQU48bHURwXdfjwM3p6egHs7CzMzPi0swyiCA0MoKEhj76wsOiePx/AmPfGTUwgQFI7UXSP3t5BcjmPvrnp37+19Wf65fJLlpbOK02XqNdpAaClBYJgVe/enWV9fciE4TB79x6iVPLGlRVMtfpGcTymxcUpUyr5nIBvAwDWIWcndiwtQAAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.newMessage, .tile .tile-status > .badge.newMessage { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAC/SURBVDhP1ZE9DgIhFIQhobDYg1haWniMbSw9j0exsfMAeg9L7Sy2kPATnCFI2LgYtjJOMjx4vPkoED+X5OK934cQ+thpFOYvSqmdMMascVDOuQMcGn1GptNaL4W1dgBkMwOSw8jeBJszIKMwexFAN0A+wnQG0Lh4wv0EJIb5AO4fRX8MoDFAlZAyPJSztOSSfiYLAYeyxTcdURcIrqSUJ7iLA4UmAdQbgnqvhakqgEoQXQtTXwEtIuCa9n8pIV67VJf6AmhGmgAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.tile .brand > .badge.paused, .tile .tile-status > .badge.paused { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAArSURBVDhPY/j9+7fDnz9//mPBCQxQgE8NE1QN2WDUgFEDQGDUgIE3gIEBAArtNKc4HT7sAAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .badge.playing, .tile .tile-status > .badge.playing { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAEXSURBVDhPY4CBnz9/pvz+/dsFyiUaMEFpBiYmJhkgtf3v37/t////Z4GIEgZwA0CAkZGRBai5AmjIYSCtABXGC1AMQAIWf/78OQ/EEVA+ToDLAJBrBIDUcqBrZgNdwwMRxQQ4DYABoOYUoCGngYFsABVCAQQNgAINYCAf//XrVwGUDwfEGgDyEgfQkH5guGwGukoEKky8AUhA5sePH6DwAQOSDAC6YgIzM7MpJyfnHagQcQYAnfwGiD2BmguBhvyBCoMBMQbsYWFh0WVlZd0B5aMAnAYAbfzz79+/SqBmV6CtL6DCGACXAQ+ABliysbF1QPk4AYYBQI0rgH7VBWo+AxXCC+AGADV+AVKJQL9GAp0MYhMBGBgA8v5j1f90TA8AAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.error, .tile .tile-status > .badge.error { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAFiSURBVDhPjVM7TsNQELRjy8ISBQeIREtBEYnQUXCINFTkCCBxgNwAJI5AaejSpaCAEqRINBTcIQ1SbD9/mHmfZP3iSIw0ytt9O7O7thMGHpqmGVZVNQnD8AwcMde27RL8rOt6nqbpjy7sA4RTpdQKv20fcbcuy/IOZrGVbIHLpz7RHr52TJCYukuMeU+6WDBjdxej4UyLubMbm0KdBDyTzHWEyY01UEVRnA4Q8IEdaZVAFEW3yD/g+IzzFc6VuTFAHAPXO7vLKQi5q+suuOD+X15yx4ToEXON1QB3B6ZkC3Qd+q8Kaxzbo0TMCTLPefPAfPS8nTeOtnk1YEfMsf11pIm+y/P8BLusmaCZrevsLE1QO3F51FzopJyCQil2pAnFoLLxI7X6z8SxkVjgeMn4H/jGQz3Ht/BrY2MC85nrsI/sjNpDKzMTSODzHPELQ9EY1H9ndFqCHxC/JEnyrgs1guAPTvwreuY0IiIAAAAASUVORK5CYII%3D) 50% no-repeat; }

.tile .brand > .badge.attention, .tile .tile-status > .badge.attention { background: #2d89ef url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAYAAAAf8/9hAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAEbSURBVDhPtZI9bsJAEIVZ7ANQ5gApEomChjoNBUUOkSJFivSUQE3JEThCCo4BkotcIVKKNEi2vP7hveVZrMFgKPJJo915szOzf51/Jc/zhbV2Jfc+kiR5QrLNsqzEMJJ8O0hcM1kWlWUZKtQOOo69ZGdpmn4ofB12QsI3k1BoRtP8F7Gell0GnT6rrpJ4HOfzUiU1ww7o9HepAGI2juNHyeegw7Ja3FRA9iW5jv9slSl0WqD2rEYjF7Hy68E7gCPNORpjpk44sg2CYAg969JTxVoywYIXmlyfAS77jRPDZ8PZN5j3KfiEYeh2yG07wQN5P4g/d9H9Hf5ZMkHM/QO5NbCzh6IoJgbVI/iNBdrALnY8An9X+w9rpLPbA/sADga+JgSiAAAAAElFTkSuQmCC) 50% no-repeat; }

.tile .brand > .name, .tile .tile-status > .name { position: absolute; bottom: 0; left: 0; margin-bottom: 5px; margin-left: 15px; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #ffffff; }

.tile .brand > .name:hover, .tile .tile-status > .name:hover { color: #ffffff; }

.tile .brand > .name > [class*=icon-], .tile .tile-status > .name > [class*=icon-] { font-size: 24px; }

.tile .brand > .icon, .tile .tile-status > .icon { margin: 5px 15px; width: 32px; height: 32px; }

.tile .brand > .icon > [class*=icon-], .tile .tile-status > .icon > [class*=icon-] { font-size: 32px; }

.tile .brand > .icon > img, .tile .tile-status > .icon > img { width: 100%; height: 100%; }

.tile .brand > img ~ .text, .tile .tile-status > img ~ .text { position: absolute; left: 60px; width: auto; }

.tile .brand > .text, .tile .tile-status > .text { position: relative; left: 8px; top: 5px; right: 50px; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #000000; color: #ffffff; line-height: 14px; width: 60%; padding: 0; margin: 0; }

.tile .brand > .text:hover, .tile .tile-status > .text:hover { color: rgba(0, 0, 0, 0.8); }

.tile .brand > .text:active, .tile .tile-status > .text:active { color: rgba(0, 0, 0, 0.4); }

.tile .brand > .text:hover, .tile .tile-status > .text:hover { color: #ffffff; }

.tile:hover { outline: 3px #3a3a3a solid; }

.input-control.checkbox { display: inline-block; margin-right: 10px; margin-bottom: 10px; cursor: pointer; }

.input-control.checkbox > input[type=checkbox] { position: absolute; opacity: 0; }

.input-control.checkbox .helper { padding-left: 23px; position: relative; }

.input-control.checkbox .helper:before { position: absolute; display: block; height: 20px; width: 20px; content: ""; text-indent: -9999px; border: 2px #d9d9d9 solid; z-index: 1; opacity: 1; top: 0; left: 0; }

.input-control.checkbox input[type="checkbox"]:checked ~ .helper:after { position: absolute; display: block; content: "\e08a"; font-size: 10pt; heigth: 14px; width: 14px; line-height: 14px; z-index: 2; top: 50%; margin-top: -6px; left: 0; margin-left: 4px; font-family: iconFont; }

.input-control.checkbox input[type="checkbox"]:not(:checked) ~ .helper:after { display: none; }

.input-control.checkbox input[type="checkbox"]:disabled ~ .helper:before { cursor: default; background: #e6e6e6; }

.input-control.checkbox input[type=checkbox]:disabled ~ .helper:after { color: #8a8a8a; }

.input-control.checkbox input[type=checkbox]:focus ~ .helper:before { border-color: #919191; }

.input-control.checkbox:hover input[type=checkbox]:not(:disabled) ~ .helper:before { border-color: #919191; }

.input-control.checkbox:active input[type=checkbox]:not(:disabled) ~ .helper:before { border-color: #1e1e1e; }

.input-control.intermediate input[type="checkbox"] ~ .helper:after { position: absolute !important; display: block !important; content: "" !important; color: #1a1a1a !important; z-index: 2 !important; font-size: 16px !important; font-weight: bold !important; left: 5px !important; margin-left: 0 !important; top: 50% !important; margin-top: -5px !important; background-color: #1a1a1a !important; width: 10px !important; height: 10px !important; }

.input-control.intermediate input[type="checkbox"]:disabled ~ .helper:after { background-color: #9a9a9a !important; }

.input-control.radio { display: inline-block; margin-right: 10px; margin-bottom: 10px; cursor: pointer; }

.input-control.radio > input[type=radio] { position: absolute; opacity: 0; }

.input-control.radio .helper { padding-left: 23px; position: relative; }

.input-control.radio .helper:before { position: absolute; display: block; height: 20px; width: 20px; content: ""; text-indent: -9999px; border: 2px #d9d9d9 solid; z-index: 1; opacity: 1; top: 0; left: 0; border-radius: 100%; }

.input-control.radio input[type="radio"]:checked ~ .helper:after { position: absolute; display: block; content: ""; color: #1a1a1a; z-index: 2; font-size: 16px; font-weight: bold; left: 5px; margin-left: 0; top: 50%; margin-top: -5px; background-color: #1a1a1a; width: 10px; height: 10px; border-radius: 100%; }

.input-control.radio input[type="radio"]:disabled ~ .helper:before { cursor: default; background: #e6e6e6; }

.input-control.radio input[type="radio"]:disabled ~ .helper:after { background-color: #8a8a8a; }

.input-control.radio input[type="radio"]:focus ~ .helper:before { border-color: #919191; }

.input-control.radio:hover input:not(:disabled) ~ .helper:before { border-color: #919191; }

.input-control.radio:active input:not(:disabled) ~ .helper:before { border-color: #1e1e1e; }

.input-control.switch { display: inline-block; margin-right: 10px; margin-bottom: 10px; cursor: pointer; position: relative; }

.input-control.switch > input[type=checkbox] { position: absolute; opacity: 0; }

.input-control.switch .helper { padding-left: 52px; position: relative; }

.input-control.switch .helper:before { position: absolute; left: 0; top: 2px; display: block; content: ""; width: 43px; height: 16px; outline: 2px #a6a6a6 solid; border: 1px #fff solid; cursor: pointer; background: #008287; margin-left: 2px; z-index: 1; }

.input-control.switch input[type="checkbox"] ~ .helper:after { position: absolute; left: 36px; top: 2px; display: block; content: ""; width: 9px; height: 16px; outline: 2px #333 solid; border: 1px #333 solid; cursor: pointer; background: #333; z-index: 2; }

.input-control.switch input[type="checkbox"]:not(:checked) ~ .helper:after { left: 2px !important; }

.input-control.switch input[type="checkbox"]:not(:checked) ~ .helper:before { background: #a6a6a6 !important; }

.input-control.switch input[type="checkbox"]:disabled ~ .helper:after { background: #a6a6a6 !important; outline: 2px #a6a6a6 solid !important; border: 1px #a6a6a6 solid !important; }

.input-control.switch input[type="checkbox"]:focus ~ .helper:before { outline: 2px #747474 solid !important; }

.input-control.switch input[type="checkbox"]:disabled ~ .helper:before { cursor: default !important; background: #e0e0e0 !important; outline: 2px #ccc solid !important; }

.input-control > input[type=text], .input-control > input[type=email], .input-control > input[type=url], .input-control > input[type=phone], .input-control > input[type=password], .input-control > input[type=number], .input-control > input[type=time], .input-control > select, .input-control > textarea { border: 1px #bababa solid; width: 100%; padding: 4px 6px 6px 5px; background-color: #fff; outline: 0; margin-right: 32px; min-height: 32px; position: relative; }

.input-control > input[type=text].with-helper, .input-control > input[type=email].with-helper, .input-control > input[type=url].with-helper, .input-control > input[type=phone].with-helper, .input-control > input[type=password].with-helper, .input-control > input[type=number].with-helper, .input-control > input[type=time].with-helper, .input-control > select.with-helper, .input-control > textarea.with-helper { padding: 4px 32px 6px 5px; }

.input-control > input[type=text]:disabled, .input-control > input[type=email]:disabled, .input-control > input[type=url]:disabled, .input-control > input[type=phone]:disabled, .input-control > input[type=password]:disabled, .input-control > input[type=number]:disabled, .input-control > input[type=time]:disabled, .input-control > select:disabled, .input-control > textarea:disabled { background-color: #eaeaea; }

.input-control > input[type=text]:focus, .input-control > input[type=email]:focus, .input-control > input[type=url]:focus, .input-control > input[type=phone]:focus, .input-control > input[type=password]:focus, .input-control > input[type=number]:focus, .input-control > input[type=time]:focus, .input-control > select:focus, .input-control > textarea:focus { border-color: #000; }

.input-control > input[type=text]::-ms-clear, .input-control > input[type=email]::-ms-clear, .input-control > input[type=url]::-ms-clear, .input-control > input[type=phone]::-ms-clear, .input-control > input[type=number]::-ms-clear, .input-control > input[type=time]::-ms-clear { display: none; }

.input-control > input[type=password]::-ms-reveal { display: none; }

.input-control > select { padding-right: 5px; }

.input-control > textarea { padding-right: 5px; min-height: 100px; }

.input-control.text input[type=text]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=text]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=password]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=password]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=email]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=email]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=phone]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=phone]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=number]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=number]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=time]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=time]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=url]:not(:focus) ~ [class^="btn-"], .input-control.password input[type=url]:not(:focus) ~ [class^="btn-"], .input-control.text input[type=text]:not(:focus) ~ .helper, .input-control.password input[type=text]:not(:focus) ~ .helper, .input-control.text input[type=password]:not(:focus) ~ .helper, .input-control.password input[type=password]:not(:focus) ~ .helper, .input-control.text input[type=email]:not(:focus) ~ .helper, .input-control.password input[type=email]:not(:focus) ~ .helper, .input-control.text input[type=phone]:not(:focus) ~ .helper, .input-control.password input[type=phone]:not(:focus) ~ .helper, .input-control.text input[type=number]:not(:focus) ~ .helper, .input-control.password input[type=number]:not(:focus) ~ .helper, .input-control.text input[type=time]:not(:focus) ~ .helper, .input-control.password input[type=time]:not(:focus) ~ .helper, .input-control.text input[type=url]:not(:focus) ~ .helper, .input-control.password input[type=url]:not(:focus) ~ .helper { display: none; }

.input-control.text input[type=text]:focus ~ [class^="btn-"], .input-control.password input[type=text]:focus ~ [class^="btn-"], .input-control.text input[type=password]:focus ~ [class^="btn-"], .input-control.password input[type=password]:focus ~ [class^="btn-"], .input-control.text input[type=email]:focus ~ [class^="btn-"], .input-control.password input[type=email]:focus ~ [class^="btn-"], .input-control.text input[type=phone]:focus ~ [class^="btn-"], .input-control.password input[type=phone]:focus ~ [class^="btn-"], .input-control.text input[type=number]:focus ~ [class^="btn-"], .input-control.password input[type=number]:focus ~ [class^="btn-"], .input-control.text input[type=time]:focus ~ [class^="btn-"], .input-control.password input[type=time]:focus ~ [class^="btn-"], .input-control.text input[type=url]:focus ~ [class^="btn-"], .input-control.password input[type=url]:focus ~ [class^="btn-"], .input-control.text input[type=text]:focus ~ .helper, .input-control.password input[type=text]:focus ~ .helper, .input-control.text input[type=password]:focus ~ .helper, .input-control.password input[type=password]:focus ~ .helper, .input-control.text input[type=email]:focus ~ .helper, .input-control.password input[type=email]:focus ~ .helper, .input-control.text input[type=phone]:focus ~ .helper, .input-control.password input[type=phone]:focus ~ .helper, .input-control.text input[type=number]:focus ~ .helper, .input-control.password input[type=number]:focus ~ .helper, .input-control.text input[type=time]:focus ~ .helper, .input-control.password input[type=time]:focus ~ .helper, .input-control.text input[type=url]:focus ~ .helper, .input-control.password input[type=url]:focus ~ .helper { display: block; }

.input-control.text input[type=text]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=text]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=password]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=password]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=email]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=email]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=phone]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=phone]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=number]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=number]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=time]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=time]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=url]:not(:focus) ~ [class^="btn-"]:active, .input-control.password input[type=url]:not(:focus) ~ [class^="btn-"]:active, .input-control.text input[type=text]:not(:focus) ~ .helper:active, .input-control.password input[type=text]:not(:focus) ~ .helper:active, .input-control.text input[type=password]:not(:focus) ~ .helper:active, .input-control.password input[type=password]:not(:focus) ~ .helper:active, .input-control.text input[type=email]:not(:focus) ~ .helper:active, .input-control.password input[type=email]:not(:focus) ~ .helper:active, .input-control.text input[type=phone]:not(:focus) ~ .helper:active, .input-control.password input[type=phone]:not(:focus) ~ .helper:active, .input-control.text input[type=number]:not(:focus) ~ .helper:active, .input-control.password input[type=number]:not(:focus) ~ .helper:active, .input-control.text input[type=time]:not(:focus) ~ .helper:active, .input-control.password input[type=time]:not(:focus) ~ .helper:active, .input-control.text input[type=url]:not(:focus) ~ .helper:active, .input-control.password input[type=url]:not(:focus) ~ .helper:active { display: block; }

.input-control input[type=text] ~ .btn-search, .input-control input[type=text] ~ .btn-date { display: block !important; }

.input-control { margin-right: 0px; margin-bottom: 10px; position: relative; }

.input-control.text .helper, .input-control.password .helper, .input-control.text [class^="btn-"], .input-control.password [class^="btn-"] { font-family: "iconFont" !important; background: #fff; top: 2px; width: 26px !important; height: 27px !important; min-width: 26px !important; min-height: 27px !important; cursor: pointer; color: #000; position: absolute; left: 100%; margin-left: -28px; display: block; border: 1px #fff solid; }

.input-control.text .helper:before, .input-control.password .helper:before, .input-control.text [class^="btn-"]:before, .input-control.password [class^="btn-"]:before { font-size: 10pt !important; position: absolute; color: #000 !important; font-family: "iconFont" !important; left: 6px; top: 4px; }

.input-control.text .helper:hover, .input-control.password .helper:hover, .input-control.text [class^="btn-"]:hover, .input-control.password [class^="btn-"]:hover { background: #d9d9d9; }

.input-control.text .helper:active, .input-control.password .helper:active, .input-control.text [class^="btn-"]:active, .input-control.password [class^="btn-"]:active { background-color: #000; }

.input-control.text .helper:active:before, .input-control.password .helper:active:before, .input-control.text [class^="btn-"]:active:before, .input-control.password [class^="btn-"]:active:before { color: #fff; }

.input-control.password .helper, .input-control.password .btn-reveal { background: #ffffff url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABcAAAAXCAYAAADgKtSgAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyJpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMy1jMDExIDY2LjE0NTY2MSwgMjAxMi8wMi8wNi0xNDo1NjoyNyAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNiAoV2luZG93cykiIHhtcE1NOkluc3RhbmNlSUQ9InhtcC5paWQ6MzM2OTY1MkEwNkVGMTFFMjhDQkNEODZFQTYyRTI5MDciIHhtcE1NOkRvY3VtZW50SUQ9InhtcC5kaWQ6MzM2OTY1MkIwNkVGMTFFMjhDQkNEODZFQTYyRTI5MDciPiA8eG1wTU06RGVyaXZlZEZyb20gc3RSZWY6aW5zdGFuY2VJRD0ieG1wLmlpZDozMzY5NjUyODA2RUYxMUUyOENCQ0Q4NkVBNjJFMjkwNyIgc3RSZWY6ZG9jdW1lbnRJRD0ieG1wLmRpZDozMzY5NjUyOTA2RUYxMUUyOENCQ0Q4NkVBNjJFMjkwNyIvPiA8L3JkZjpEZXNjcmlwdGlvbj4gPC9yZGY6UkRGPiA8L3g6eG1wbWV0YT4gPD94cGFja2V0IGVuZD0iciI/Ps2lOfsAAAFMSURBVHjaYvz//z8DrQATAw0BTQ1nwSUxe/ZsBSCVD8QBQKyAJv0AiDcA8cTU1NQHuMxgRA9zoKECQKofiBOIdOACIC4EWvIBr+FAgw2A1H4gFiAxBEAGOwItuIDVcBwGf4C6bCOaYf5QnwngswBsODQo7qMpbgTiCdi8ixR8BUBcj2aBIkwPLEL70QxOBCpYgC8coAY0AC0BReh8qDAsvhJBHGZpaWkFqNdhAOTaTmID29jY+MK5c+dAhlpAhQyA/IVA8Q8s0OSG7K1GNO8HQF2jgJQMQaljA1oQIscByMxCUCZyQE5WyGEMNXg9WjoHsddD5ZCDCNn3DrAcaoAkiJ4q+vGECLrcQSS2Ad7sD00NCngMV8CS1vHnUDTD3xNIMYxkFVzQcHyAR+8DSkvFQjLlCBsOTW6BaK4EsQPRkiJxpeJoTTS0DQcIMACNJ32B6TbHUQAAAABJRU5ErkJggg%3D%3D) 50% no-repeat; }

.input-control.password .helper:hover, .input-control.password .btn-reveal:hover { background: #ffffff url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABcAAAAXCAYAAADgKtSgAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyJpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMy1jMDExIDY2LjE0NTY2MSwgMjAxMi8wMi8wNi0xNDo1NjoyNyAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNiAoV2luZG93cykiIHhtcE1NOkluc3RhbmNlSUQ9InhtcC5paWQ6MzM2OTY1MjIwNkVGMTFFMjhDQkNEODZFQTYyRTI5MDciIHhtcE1NOkRvY3VtZW50SUQ9InhtcC5kaWQ6MzM2OTY1MjMwNkVGMTFFMjhDQkNEODZFQTYyRTI5MDciPiA8eG1wTU06RGVyaXZlZEZyb20gc3RSZWY6aW5zdGFuY2VJRD0ieG1wLmlpZDozMzU3NURCRDA2RUYxMUUyOENCQ0Q4NkVBNjJFMjkwNyIgc3RSZWY6ZG9jdW1lbnRJRD0ieG1wLmRpZDozMzU3NURCRTA2RUYxMUUyOENCQ0Q4NkVBNjJFMjkwNyIvPiA8L3JkZjpEZXNjcmlwdGlvbj4gPC9yZGY6UkRGPiA8L3g6eG1wbWV0YT4gPD94cGFja2V0IGVuZD0iciI/PhJl5kAAAAEMSURBVHja7FXtEYIwDKVO0BE6AiPoBDICo7BBR9AVnMARcIOyAWxQk6PlakwC/uC888zdOwpJXl/SD0yMsdrLDtWO9h1yY4wDeEAARIKQfE7InQfY8xJgFnBB10ZgrCUc85N8rAHjB8QZmFNTcpNfoBQkvifl2SbAFXAjlZ8BLRN7Ar4HtmVRnoKo4o6Wy7SvYyqwL21hetxKpMwkLbMGS3sccfqtxMUEnnC4TO5pWSSxAYQiBscN06KRCkTrJdWJWNohjaK+X3ZNgSNJCAp50ITgN+2E2rQeklHf9MYh3YqJfNTuDsg10vFXlYMTlQwK97B6c61ssc0Lunq3KBOoW1EiN/8/0W+RPwUYACoftglrEejbAAAAAElFTkSuQmCC) 50% no-repeat; }

.input-control.text .helper:before, .input-control.text .btn-clear:before { content: "\e089"; }

.input-control.text .btn-search:before { content: "\e041"; }

.input-control.text .btn-date:before { content: "\e020"; }

label { font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; margin-right: 10px; margin-bottom: 10px; }

fieldset { position: relative; margin-top: 30px; border: 2px #eaeaea solid; padding: 10px; }

fieldset legend { padding-left: 10px; padding-right: 10px; font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; color: #cfcfcf; position: absolute; top: -25px; left: -10px; }

input[type=button], input[type=reset], input[type=submit] { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; font-size: 14px; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; min-height: 32px; height: 32px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; display: inline-block; text-align: center; vertical-align: middle; cursor: pointer; padding: 4px 10px; position: relative; outline: none; border-radius: 0; }

input[type=button] [class^="icon-"], input[type=reset] [class^="icon-"], input[type=submit] [class^="icon-"], input[type=button] [class*=" icon-"], input[type=reset] [class*=" icon-"], input[type=submit] [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

input[type=button] [class^="icon-"].icon-large, input[type=reset] [class^="icon-"].icon-large, input[type=submit] [class^="icon-"].icon-large, input[type=button] [class*=" icon-"].icon-large, input[type=reset] [class*=" icon-"].icon-large, input[type=submit] [class*=" icon-"].icon-large { line-height: .9em; }

input[type=button].big [class^="icon-"], input[type=reset].big [class^="icon-"], input[type=submit].big [class^="icon-"], input[type=button].big [class*=" icon-"], input[type=reset].big [class*=" icon-"], input[type=submit].big [class*=" icon-"] { font-size: 1.3333333333333333em; }

input[type=button] [class^="icon-"], input[type=reset] [class^="icon-"], input[type=submit] [class^="icon-"], input[type=button] [class*=" icon-"], input[type=reset] [class*=" icon-"], input[type=submit] [class*=" icon-"] { margin-right: 5px; }

input[type=button] [class^="icon-"].right, input[type=reset] [class^="icon-"].right, input[type=submit] [class^="icon-"].right, input[type=button] [class*=" icon-"].right, input[type=reset] [class*=" icon-"].right, input[type=submit] [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

input[type=button].standart, input[type=reset].standart, input[type=submit].standart { min-width: 90px; min-height: 32px; }

input[type=button]:active, input[type=reset]:active, input[type=submit]:active, input[type=button].default:active, input[type=reset].default:active, input[type=submit].default:active { top: 1px; left: 1px; }

input[type=button]:disabled, input[type=reset]:disabled, input[type=submit]:disabled, input[type=button].disabled, input[type=reset].disabled, input[type=submit].disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

input[type=button].default, input[type=reset].default, input[type=submit].default { background-color: #008287; color: #fff; }

input[type=button]:hover, input[type=reset]:hover, input[type=submit]:hover, input[type=button].default:hover, input[type=reset].default:hover, input[type=submit].default:hover { color: inherit; }

input[type=button]:focus, input[type=reset]:focus, input[type=submit]:focus { outline: 0; border: 1px #353535 dotted; }

input[type=button].mini, input[type=reset].mini, input[type=submit].mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

input[type=button].big, input[type=reset].big, input[type=submit].big { min-height: 48px; height: 48px; font-size: 1.2em; }

input[type=submit] { background-color: #008287; color: #fff; }

.image-collection { position: relative; margin-left: 0; list-style: none;

  • zoom: 1;

}

.image-collection:before, .image-collection:after { display: table; content: ""; }

.image-collection:after { clear: both; }

.image-collection > div, .image-collection > li { width: 220px; height: 121px; overflow: hidden; margin-right: 20px; margin-bottom: 20px; position: relative; box-shadow: inset 0px 0px 1px #FFFFCC; float: left; background: #cccccc url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAP5SURBVGhD7ZdBSBRRGIB319VW8OBhAwMhgwIPQgpGHYoMDeoYeAkSDBKSEIw8BCUd7FahgZDQxZtBFw9BRkIGezA0FAo0EBIyCCrwILjq6vb9M/8uM7szu+7qaAvzweP9/3tv3vz//978703Ax8fHx2cvBLW2sbW11R4MBp+o6sjOzs7zioqKIVUPjZDWNjC+iqouV2FMNfWh4+hAKRFMJpNhtkxvKBS6iC6RF2oo9aboyrKWw2CNLfypvLx8KLi9vT2IE73aUWqMB4n+b/ZzVBtKCgKfCCYSiaTqJcmBO0DUVlnxacoK+/gn395x2uoo52iL6LBdc5AOvMHIZ+FwOIahCW1LQ18EW67Q9wC12WzNj+cOYNgKVQcZY8psyc/GxsYtVmYQZ1JZ0RWvHYiVlZVdw5A/qhtgYAPtjWwhSR6zODfPmDWz10THvEbMmc69dGAJA5pShskWweABym2XyE5hS3ckEllUPbC+vn6SLTfDeNdT35OTGGMTnC8SecP4zc3NZvQ52vtcjBdacHiOsX2qByorK5eoOkzNGU9WACNHMKZbZCJei/FfckUxE57p4aI4rGoAGz9QtZiaHU8cwPhjGPxL5Fwvd4OViuN0U2o7cdhKdnprdGbgxRaSNJkyvpOqIOMFno+w91+oGkCexCnbR57C1QEmGWIpLxDNE9bCRJfoG9FhWdAXU1Ei2apiwfDseYpxsDFngjJpdGTg9j8wjLF32YcSzWVrkXxOXzeTv9LhNmj/pqLM06hiwfCs3JIbVBVdzpMsHB0g8u9UdIUJHcfggPEi6jBV2oBi4DBLP49Nf1W04egAL5e/rpy4jcEx42ZLnWCM7QArFOvzOHNERRtuW+iR5G5Vs2Bp26jumZodSZsqyjzTKhYFH2/6eeu8VtwciOLxDIb+IJN8txZpo/89xfFA4rmzKso88yoWDNFf4fn0CiCfU9HGvp8DvHiNyB3lhXHkKPMvIBfzw3STeUZFiMfj9cgLRmsGjiuwFzC2ilWS/C+yRLBL5AIZTxkvkPnuqJiFJyexfHwYcAoHVkXnVB2g7aHRmZ950vRldT51oZNVlKyWxb6vgMDLohj9UlW5WvTjwFWKYy4X6JPD6iljz6SMpy1C9MfcjBe8vE5L5ujnMHysqhhUzfa6gZGnkSXLSSL4yrjP1BOMnZVxAv1hgjCG2G62OOOpAwLRGyUzdVFn/Ua6gfE1anzee5QnW8gKxnRizAKBMj7sXDA2wvlzXzIX6q4ugZ6vgBUMlL09wZb5yKrI9xCnVNNei95K3cZK5f0PtnKgDnhBCK8d79mlQoglS9/fS5DFEGmtByHGSuw6S/wnzJIcrqvs4+Pj41MMgcA/8Fr5zKgSl7AAAAAASUVORK5CYII%3D) 50% no-repeat; display: table-cell; vertical-align: middle !important; text-align: center; }

.image-collection > div > img, .image-collection > li > img { width: 100%; height: auto; min-height: 100%; max-width: 100%; }

.image-collection > div > .overlay, .image-collection > li > .overlay { position: absolute; width: 100%; height: 55px; overflow: hidden; background-color: #1e1e1e; color: #fff; font-size: 8pt; text-align: left; line-height: 12px; padding: 5px 10px; opacity: .8; bottom: -55px; }

.image-collection > div:hover .overlay, .image-collection > li:hover .overlay { -webkit-transform: translate(0, -55px); -ms-transform: translate(0, -55px); -o-transform: translate(0, -55px); -moz-transform: translate(0, -55px); transform: translate(0, -55px); -webkit-transition: all 0.3s ease; -moz-transition: all 0.3s ease; -o-transition: all 0.3s ease; -ms-transition: all 0.3s ease; transition: all 0.3s easet; }

.image-collection.p16x9 > div { width: 220px; height: 121px; }

.image-collection.p4x3 > div { width: 220px; height: 165px; }

.image-container { position: relative; padding: 5px 5px 50px; background-color: #1e1e1e; width: 220px; margin-right: 20px; margin-bottom: 20px; }

.image-container img { width: 100%; height: auto; }

.image-container > .overlay { position: absolute; bottom: 0; left: 0; right: 0; height: 50px; font-size: 8pt; color: #fff; line-height: 14px; padding: 0 5px; overflow: hidden; text-overflow: ellipsis; }

.image-container.light { background-color: #ccc; }

.image-container.light > .overlay { color: #1e1e1e; }

.card { width: 75px; height: 105px; border: 1px #eaeaea solid; border-radius: 0px; position: relative; float: left; display: block; margin-right: 10px; margin-bottom: 10px; cursor: pointer; background: #fff; font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; font-family: Tahoma, Arial, sans-serif; line-height: 18pt; }

.card:hover { box-shadow: 1px 1px 1px #ccc; }

.card .suit { padding: 0; font-size: 80px; position: absolute; right: 5px; bottom: 30px; }

.card .small-suit:after { top: 5px; left: 13px; position: absolute; }

.card .small-suit:before { top: 22px; left: 10px; position: absolute; }

.card .suit:after { position: relative; bottom: 10px; }

.red { color: red; }

.black { color: black; }

.card.two .small-suit:after { content: "2"; }

.card.three .small-suit:after { content: "3"; }

.card.four .small-suit:after { content: "4"; }

.card.five .small-suit:after { content: "5"; }

.card.six .small-suit:after { content: "6"; }

.card.seven .small-suit:after { content: "7"; }

.card.eight .small-suit:after { content: "8"; }

.card.nine .small-suit:after { content: "9"; }

.card.ten .small-suit:after { content: "10"; margin-left: -7px; }

.card.jack .small-suit:after { content: "J"; }

.card.dame .small-suit:after { content: "Q"; }

.card.king .small-suit:after { content: "K"; }

.card.ace .small-suit:after { content: "A"; }

.card.joker { background: #ffffff url(data:image/jpeg;base64,/9j/4QAYRXhpZgAASUkqAAgAAAAAAAAAAAAAAP/sABFEdWNreQABAAQAAABkAAD/7gAOQWRvYmUAZMAAAAAB/9sAhAABAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAgICAgICAgICAgIDAwMDAwMDAwMDAQEBAQEBAQIBAQICAgECAgMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwP/wAARCABqAEADAREAAhEBAxEB/8QAlAAAAgMBAAMAAAAAAAAAAAAAAAkHCAoGAgULAQABBAMBAQAAAAAAAAAAAAAABQYHCAEECQIDEAABBAIBAwQBAwUBAQAAAAAEAgMFBgEHCAAREhMUFQkhMUEKYSIjFhckJhEAAgEDAwMDAwMCBQUAAAAAAQIDEQQFABIGIRMHMSIUQTIIUWEjcRXwgZHhFsFSMxgJ/9oADAMBAAIRAxEAPwDfx0aNeOVJT4+Skp8leKe+cY8lZxnOEp7/AKqzjGfx1gsq0qQKmg/rooT6aqbsnnzwW01epvV+3+aHE/Veyqz8Zix692PyJ1FSLvAZmogGfh0zVUs1vjJ2LXKwUoKaNh9hGXxCmXkd23W1K+bzwx9JHVT+5A1v2+Lyd1H3bW3nkioTVY2YUHQmoBFAfU/TXOSP2EcTjKSPfdVbq1nyAr5NjlKniT0dsWj7HhArDAx8NLz8NMWWtT8hXoWYh4mxAEPBEktmYZNZXhrwX5Yr359/Jfgv4+2FhLyKC+yOWybSfHtbJEeQxw7O9NKzuiRRJ3EVSSXkdgI0ZVleJ88F8W8k55dXMFl2rWC0VDLJcbkVTISI1ChWdixB9FoKe4glQ00UTkJrXYlKi7vW5RwkSQdWGVDK9nmwQcmyyp4iMmo9ox1Ij7beEqS5ha2H2nmXWnHGn2VrkTxX5Q4t5g4Rac74jIzYu53K0bgLNBNGdssE6AtsljPqK0ZSrqSjqS3eX8TzHCc/Px7NoFvIT0Za7JEP2yRkhSyN9CQCCCrBWVlEhVq4R1mcMQGhbWBnMoay4rGclIb8Uvut4SnslDbisfjOfLwWjKsJUrKEyLps663o0aOjRo6NGq8724r6N5LkU5W7aUNfoum4sYrNXmiiyKdZIO2tRKbJVrvVFuqgrfV5p6vAKLCNYdaKZGUG96gBZ4hbT5JwnjvLL/GZHOwvNcYi8+VbUkkRVmCFVZ1RlEmwkOgcELIquBUaWcTyDK4SG6gxkgjS9g7Mp2qWMZYMQrMCUJpQlCCVJWtCdUK+ycf6idQaW1HrPnfpnj9J06XhbLo3jDqrGoICZvURHSNbga/M1PjmBV4Vmy6djBgAq/GOzcITX4uCIXDJIPCzkFeFfKXmNx9v3L7aFNdop1JALUFPT06saKDSpFRpU41iOV517iXA91o7aISTv3AqIm4KGcswDGp9qKHkajbENDTI3e+JWx+KG2H4D6yNj7UM4gcnpV7cxtUSPYrOqnAGaskYHbnDW8SkDVtiQd8p3IWp7VhCKVN2SbbkIbFNIW+gqZhWbIXVPzXluGYS2n8m5CSWzmkwN5gjuMYITJSwSxXCl7hF2WPxZppI1UyTJKQjsUSN5w4paZ25ijwV2FmlS7ivVZa7S1sslFekdYzMsojWQKVQj3EJIzxsjv8A9lt54uWReiNfVaAtt7tlyrTw8ITHWS3GEEylZbDkoOEr1OLHkZecnj0xSYxbThraWg3VYGfSShwep/4a8z5txDxTcYrhOPiv7vIZu4uVeWphCER26oiq8TNK7RFm3yJsoqbGdxS93/rD4t8p2UPkHzHnpuPcctsZcLAYpIFnnEcu7vN3Ipz8S0PyBN/HHU7yJYhFJtvp9dP2QbP3Tti76W3TrUagbYp1fE2EBEAwFrpKWa+x/qIZsFfahapYq0Q9nEXfAJARanVDyAB605YEyIl2Q6A+MfJPJ+SZi64vzbHpY8gtow47ausbpUKaq7yMrg9T76dabVPQVg/Kv8WvHfiriOK8qeEuRNyHxrkLr4khmlhmniuGjeWKRJbeCCKW3kWORWrFHJDIqL/MJHMLu6jsyeIlh4cyMe9QlQacZWo8xwhpgRCHH/Ekp5xh4sYdHjlHptKfX6ikZ83HMTd1rqiZ/bVjevWjR0aNHRo185P+UP8AY9zIov2awOiaZM3/AEtq7jjrKCmdTDGBhF0rb1i3dqyzQext+RMTYaeJE2TOKvsSa1gO4S5YQYR2CmlR5IBsjLDoQc3jYsxC1he7/hNtqFkeJmod3SSNkkWhAoUYVI93QalHhYtLSx+VEFbISOakoG2BSKIN1VO6m5gV/QdR00y/iB9l2q+SXE/j+rT9cPum6KBxY4ncetpkX3WdmgKbqnbsZK37WVsutyko6OiqD/zrYEsOubgF1+x5Jn2RMxcomqZHJMjoz5/xHh/Kre0wvIMdjsjYW6IoS8hS6MfoN1bmOZSxRQe45aQlep2u2538XTkeHW+ytu80KzySvEVkEaz7GBG0bx/43YLQqsYL7as7KBAHAhNSm/sE57XaQnq9f+RWp6lXBtF1GYthD4ZNZ2PJXWctMxWhbRNWO0SpERDB1aJbPXN5yxFy2BSTh25XD47Y4Zxaz4BhshBwLH2i5JEkfGWrskcUky24pEAXQj7ZACJEKqHq6qGkEn+YfIOT5hwvieGzV1cw4KCz+JkDbx+wJFezyxNKYwqN1aKYoYt0kgSdhLOA5efwT4k1+qcl9lcxdkpca39v+A1m1Z6qJKfJ1LVDMTqjUVZuNBrUgPKsw9mVI3jW+SVzL61dhghEBsM4ycuRmXC4NxejkuXVRyWW0SKQLQIg6MyrR5ASW6M29/T2uynVf835KyNxwKDxbiS0fD7fIyXhLNukuJirRxsx2LsjjjZgkQqCWLuSwQI6Ou04ZDSVGxkaGhp9xwNAeHC3MgPGyJjIr0jIN5Nefykhh1x9v0leeMtYz2StS3XqL9SV1nWdHRo1T3lTduTNHldRSmi61AzdCRNWF7eMhJhCnycHBtCxI1UeiwXJ0CQkwiJU8j5AYIbBCR2sF+/EbEWLIt/PTcghELYKOKT3jubz6LuQGg6E+wu3tO6qqoB3GiziIsLKJxl5ZI3ERMW0GjODXYSFbaXHtVyCqk+4U6rUrmFrjg3zi04xTObvF5vkbOQwVrO1hWdc0O8Wbbcj7CMhrlZF6LvtEVDXPXwM/K1CNhpg9uxRNbMkUAxsrIqbLZYX98hk7SyhBuVkkuSrFIokaSWTaKnYi9adVBZiI1ZlDstRpX4nichlMyljj7yzsLZ5I1kuL2dLe2iWSVIi8perOI+5vdII5rjsrLJHEyo9MmXE/jzp7WfLLZnCqs6Z5cSkIHBa52nxk1pzI1lF/wDe6Vr4Cp7wgL7IygVGL15mkWEzam4bPK1M+JjjpZET7pQbQE+7FzkdAvLs3nLIXuU45g7qbP5JClnZTGKGW6u47VujtNOsEKiOBQ0js0awxmRA0+0m3+VwXG+IcPt8ddcowuVms7iQ3l3i5pbiyiFxNAYBHI1mTPGyQSF7dfiXLTSPCytbGWOZtD/A3Y+hStw7K1VPwslyx9zsjdGw2bXZ3bXs6/bJj9cHyVdrEvWKPFSOJmiCQFjjoWuVKJKiYiIi7Bj0CRzk58awca8cfltl/IMHlvn7YfHjBqezjLd2uZ4rdutza2iQRXUTXV3CFd53mnknrDboYwWSFGPMvDeVtLfgl5NdxccyM8ayXYgBiQmRYzdSK80dwY7Yh32ou9WR2VG3AvcTiJy6zsZMyZJV5FG2dr+yTdX2hrPB8va26LMRdvt9SGhy7PJ1KptSMm5imvqLFSG0fClpdCLbaJazhd9OEc7sOYwzwLDcWmds+38q2mikikhMu/t1DrQhxG/2s4UqVLGlTWfyBwduE5f4lteQ5HDTANbXcSsizoUjkDdqQCRDtlQ+4FGBDRvIlGLytabBFvEUy7hOWzMMKcWjPpdlNtLQypWM4MKecz5LxnK1JbwrKs4TjOE+WX6DXTB1J3WdGjo0aoD9iPM2K4Y6aauL9JqW1ZSedlR86ssFks8HJWSqxoCcWeVjGK1qzajD8ZCESYDUgRNNQ8EOg5pt6RQUQEKWzebcsHEMV/cFhFxN7iIt0oZlQAuy9uCf7arUydqIbhulUlQbC/jd4Hfz/wA5HEpr6fFY7+NTerBazQxzzPsghl+Xksb7ptshjjtTeXkgik7NlKiSvEsXg99+nF7eU98JyrrEfx35EmXcugaydr9Mvt/rd5pN8uP/AMVARdpr1WnJqDmoh5IYU45KNgQkiSy3LBusILIi4hl4jyhw28sG5byFILS7s7eUd4IZ2SAhJZ1V4keVATEhkioA7Rxle4VG2YPOX4WeUPFGXl47xiWbL8fEYuJ1k2WbpJbpIDM0U0qxSxlGle3lid32vJEyhlLSLJ+m77RePO2Pti5K7A3XQqPr3kD9mC8XDjxsWyiSY10htXa8Zr+v+PvGGRNj5O40QKbv2pKQNOEnCPweZGzRC48xUgQ/XBBXTgc62d5NkG7cBw1hILaKaoMnyQAblFFCVUCSKMmq1dGUdzd7I18q+LLLxz4f4lMby+HkHN20uUvceY2S2jxsx2Yi4MhCCWaULdzind2WtzEHFuyv8h6u0X4vmrqndmt+U+varUbJQtsUa26bh9R7KtFoCmndd17X23dV3UbalWcp4kzNFXk0k+HxKAxgsaySHkqOeyh50vXwvJ76Rr6Pl8FrY5KOZVgEDtcJJAYUdWMwjBJ7xnB3RRBVKjYekkjY5zwnh9hDhx4myWRzuMuce8l697ax2EsF/wDJuI3hS1aWdI1+ELP3R3d4k8odlnG340FR9P3iBvz1o2IJQILXMpeNs7elrhExAtfbJOsQ+zbMI5ZLCXCQNfYNnr7FIFmXFkocdfWarKXikJy+6vcfbHywTXljEkUk1zJ3SFCtIySOFdyAC5ZG3oWqQr06dRpgc6xM+EzMWOmuheIuPspFdXLqnes4JHt1NSK2sjNavt6b4GAJAB09TQGIByr4Ki3cOFOsgtkIyWQ9hlLY6s4Q2O49kNlS31OZWphvHn/albjim8YbcopplH16+up969aNYwfv1/kRcyvr95OWjhlxu0hQqA8xrEWcY5F7XhbPdZm0DbMqMWutXvR1TJxUKFHO6ttTc2A6VMIvUJKzMf6D4bGADQydaaZkO1af1/x/v9P6aePH+PWmStjd3TvTfQKtB6etTQk1r9NtKepr0wwcjeeXNHl0/KK5Mcpt77oi5O6yGw01C87MtUprmCtso5LLekqbrD5NrXdDHCZnDBgA4SMjwo0F9QojTI3ZlOqZHJqSf9dPu2x2Ps6fGhjRgKVCjdT92PuP+Z1cDjrN7PrfC3aXLx3alXRMcfNn0eq6bgJmKXO7BxskyZoktFS3yUgcVFqq9ZjTSZAUM+ONbkXYx9hTqWBsDuVC8g2vGbvzfh/EMWIvza8jxl3dZGaOTs2Qs4Ypo3TYKPJPNKI4ZWhkha3WaKUCRpCVubxv8iPLt74NynFMhPjMvicPGI4Z76OSbKWUVy0NuEguRcRBYA0i9uOaG6U1KbUiijCT0J/z+H2jqflHE1vYsTRL5MpuurtnazKDq24Gl06RKzEx1Ov5oU3H1XaurpwwSFlz2lHvgGB+on3TCo9bxxG55Bgnl4vmru4ju8XOO8rFokcl6/KhXdUwXLK1zbvvYKX2ApcJcIlheUcw4r5v4fbc441hcLc+VMnjorO8eW2DytcxI1rtdFV2EUkJ7CMq1njRopxJDHboHH6S2Hq621CFfloLklDbF1hAWS2NuR+1d1CwAabSeMokk/W9T2gQCRFgyc23iIi8RhAMIythkIMVvCWETAZjcwrexrCba4QMtY4wQGFfu2hVND79o6mpqdc0rmzjxWRucJdLILyymkjYI8siK8bFGEZ7rb1JACkh6qKj0G7r/r52RsTS962dRdrWuwWGGmtmTmsdOWi8VcGlSF0CrN8l4QK3ORsoZbp6ej9gVSWrktDyKxqoRiQenAPZujC+5z8eL8gyM2bS1u7N7WZba0eR42klgfvKyvEC8EIElvPFMjIjTgQNa3G9TcCJEfk2Hsmws0hkEiETvCJdvei7Z3ULJIxPdXbTeFq3c9rKncOmziXsuaHsYUS24SZgjwFcbU+rOXncuJXlhIrGWOyHvFKGm+7nfKcZVnOf0nCMmtPpqBz6abzj84x+O39M9u+P6Z7Zzj8dfbWNUM58fW9xQ+xfT9y1nyE1RR5y0TFHmanr/dblShydv6ZkzHUSkLZtb3n0hbPCKhbOIMe/GtGtxc0204FJMFAkkju+HRXFD663rHIXWPmWW3YgBqla+0/TqPT0qK+or0180Tnv/Hz+yP65ZK5bUc1iByC466ylF2IPkBq6Pr13gG6xEuS9gGsW0NITjk3c6jGQlegMFWf5OIladHZcUM5LnMKw66ntFIpO4dAfX6H6/wBf26gdf2oTJFnyLG5JfjMzRXEg20PtNSKe1x0r+nUN6UFemuV2tsil8tOKobOnaNQdT2mScEHveo9YUovU+s1X2oOUIiLnI+CYs5dDkZOYfsE8wFIrbxLezKHHkC3ENDsiV0zmUvMH5YtMvyL4nxg0scDpBtljspbc1Ly7nZx8hTvjNArW5kAKSqsd9Px58J5fnf46+QZ8JHNc5WQYyGz7kyM8t5a5CCea3jDCMJ37eW3jjDOVkmkVfa67nohXiN/ceNl2qk6MuJy33KdbbcJKIjqst1mIpNQkrpatkVQSyJm2Nd7EpcVSzyIywRD41oi/a5+ONbddxhckYu1wHkKytc9kLZP7lbuaMGZZECtvETSxlDJC42l4GLQSsKSROBTUF+U+G5fwbz2+4hbXjvB2lVbgKIhOpURzHYSxiInEsaqWMoX0arHTZthcqv8AZN6O7umjgdXw22qlx8KxW2LBdqpFRE7fNBUXac2zPzwDkZMiV5NqS5hqaVhA5KjxCS1NBEFGj/HIXyXufnxqKu1F3gbasSAI2ABUhhUkmhDVHTdWmm5F4xkxPiWx5vG7m8e7a2cb/YU/nlUltyvG4QW6IoDRncahHX3WrlbxyJsl0p89Qdlaz0hXKm/RLhUH77e5j3fIq+z8/caXTtNaysNNr1nCrodxkIB8XGbqdXBLMJIAvjHrq0niZJ2Exvx7CTIQTwR3cVWq0ixqoiBdxLurtZgjbg2xQock9KBu8cznHoc4tvzC2ubrj88EkUqxxGYxrcoYBOjDaaQtNE4eMyO0hSNRuYka09Ov2nTu0o2Jt4GYmSkAgpEcXBYR7uImScMHFdKXCmSTDZj6wn23hXMpJbU3lDqG1Zx5STEGQgONpp6VBp+3Qkf6Ej9DquLep6g9fUdAf3AoKD9OmnlwMyNPxYsoJ6nokowrHqMPsZ75SlXdKCG21qQrCsZSrHkhWM90qUnsrO3r5iv19de46NZ0ozkNtC7TPMJnVV0fsVf0lCQTgw8bH2y166HunzGsZeyYsw9kq05VZ4s9i/4Ahw3RCXfZkhLQKpsh0vHXPbyz5PaT8t8L4x5/l77BeLY8dI6xx3k2Pt8lcT25MRurm3khkeAzdyCON5hC1xbGIo3dcSWE4rxqOPxDecmwVpb3/KWuBuLQJcy20UUihhHHIsihwn8rsse4Ryq5I7akYfOXGi6Jxr5OciKVq2uKrNFXahLVV4nwcWwAxP0+uTLUc04+SWYc1BDnMhqMIdWZI+3UWWt418p1a95WtZoOXriXnmns7dlRGlZ5CqTUudnccEuo7pCAlyq7UFFCDXY3/wCYPIDH+PfJ8swH90GVnZQirtrFZ20YNAQw2uAzVNQNzDrU66Hht9fUlv3YnH/YNvhZD/nktVuV4d+CYPAzm1VnbdMrGlqzT/dA2WItdY+chrVbJDMgI2RlpMU2z3HWWwS3YnxXijbYqe+KlY55hHGNxNYrddm7bWinvGcH0LAKeqhSec35reSoMpyyy4bbSJJPjrf5VxRIyyX2RuDdOguUZzNHHYQ4wdpyPj3LXce0P3RpwG6f45c1sDQFRjdQWRuXsNe1BrnWez6/bSJWtw+7AtR1evV+q26JlYkqRGq11GHp4OHod1T8MYsUV7BAJQfeT3eXcKy13k4+T8Xn7WdjIFHoVZOikdfaPZ6qRRvd1BbSN+PX5I+PuP8AGr7xF56xMuS8XZAs6TWoUXdlKXeUMpBSR0Mzh96P3I9qjbKiRxIxsH6+XNlzQvJHeNMr9M3pL0C3Yf0dT5OazourbR2ReS7bdZLYItZ23bY7aSr1Wa9X4QmuyDhVOCKHnJJyFMKm3H1ujH2+QvkW95Iim8ktey9uyxvCgevdC+6XpKmxJkVhG7xlzGSwbVceW/8AFMc0/HODSC+xltkZZYMqTdRT3MIVFgT40gt44NjrJN3TAbmkscBnKW4U91qqvrjNyF13dZzq7ZGmB4JLPP8AlUloWIA/GFsyzjyyXY9yJ9BbPbLa0Ix4rQjKMpw4o23sS5q1fXUZyRyQnZIKNp8VZEjw4QDEbj/zEMNF+Xm6v1XX2m1OO59VbmUqcVjurGO2PLv+MdbevkNe+6NGuJumuqTsEZhm31Wu2JwFspuMJnISNl34zB3t/eZj3JAYhQeSvaNeeW8pyrLaM/qlOcNbknB+Gcya2k5biMZlJLKXuW5u7aG4MEhpV4TKjmNjtWpShO1a12iipjs3msOsq4i7ubVZ12yCKV4xIv8A2uEYbh1PRqjqf11kU/kA8JZ6m1uzcldeOMkU7W9Zq5m1h5tTgWTl7Qt0frSvKqporZD7svGFxgeHwVtOM5DcdJWUO7hkcyr/AJD4ZnL7zlkLyG3mHFTgMbeyXbFjGL4XdzYi1RNgEhktoYpm2SE24hZpQBcwg9Gvwe8+xeL+L5bg6wQ3F5yZ57YICUkSO0tpbhpd4Dhdwu5l3Oq72WNU90e9Vs/Vhy5mK7eK3recmY02Ej4gpmoDHMuvTCX44gaXchRZERpxL0OiESaYyktGFjNh+ih1DTTTHUg+NuR5mxzv/FMoyvjJIpHtzsCsjK290JAANAXJ3FqkKVIBppa/MnxB44zPjMfkBwuO7t+aJkbS0yluJO7A8TQvEt4yHcYSWitoozGY4Wq4eNpmEr7EL3yQLntEyMbUoOJlzG6mGdZo9+VkBXDK+8Y0NIQwY8I3LTqDJeOENQvChkseBDLTbRCXXENS3yPNvj4ljiVlV94Mn27CEr7WI27vctGrQE0oxquuaWBx1rkskmPuluGaU0RY0PvIUvsLhlKmQIVTbUbqlmRVLa8Zqm2e669gYCBsE1RJStX3V5khLLOCSdLVrT27KZK3JgRVBtU0OuM3BUqbIx+WyCsL+MmktSgiHkmRze5dR3N1aiK2kaKUTpuboWKwzqZBVGp/IsZFOvtcqyqahXpgLyw4vl3lylpBkbR8VcRrES4jWW9xsiQSgzQh+5Yz3CSh1Ub5bfdDMyGOZqO8xTJaI33rotI5gIpVBh4sQhzD+Ry3Y+1WNwpPrqabUS6G2e0hSEr9RDfp/vnGFKIHuLKKAn9z/jpQaYeSdmlVTTaq9AK7RVmJoKmgJJPUk9epPrp4Gjz1SWt6+S4+6+7lhOHFPd/UTnLTLiG85z374Q04nt2yr8fv+2N8emkylDqW+s6NHRo1BG7uPWut6aj3ZqC2iHCV7fFcn4C8SEQQN8zh2dpgdFRPQ7k2HNw4E3BREYG8ApwN4Rk0Np9xhxXqeaOeP4wpfpDH23ycvcuGHUvKIIbZZAH3KGWGCFVAXbWMEqWLEuDBcmynHs5jeQWWx7zFTRyQK4OwiOZp+04RkZo5HZxIu9SyOy7gCKfNF07ruycTOfUtovbYqIq26h2JsOgz2WY+XbBlzo+CscJWZ+rpnoeGlCoG3YPGkIU5Y7Dh8YcO+ltOH8ZzX3J39l48yUnJs/FLNHj0kJEC9yaRyhj2xqXVaOCCA7KqjqxBFV6Kc95dNzbwDdYvCuiQZs48sHYxxRqlxHc1kI3gmNlZGFWZetSzeuoCu8kqQNpPUm3NXytzU5siTmdcF2hUDOTYkJbJI21xEIu7BzsiXJPQVylfTg40V1oEJyaj4KLYJWSZDxeJNs7m05nxoZ2zeWLGXKbmtrtkTtSo6qx71r3zbOrIzCeOSaMBu44oSRzkvsZf4vNLa3DxtcW4qJVKLtTt1BRp/jiRAOhhnKqSOu0Bw10CeZAWswffW+Gm5SGevDlBCi0QlukrNLSbrA51kmArSIGZV6zGV9uLn2A4+fPjUSigx/bnCNOggOr+Pa9t/j49v5bf44YuzOZR7QygvR4robXXdNHIHUlA4kYu52VyNlLZdxY2ivFl9y7do2EAJVHaMxk0disUc0XRNkoDlY+S5PSjm84LS141+NInR8OZZHjBCWiB5SMdmBKK+yGaIThTTaw0gZYU8yt0ZxaM4accxhK8rpjcg7eh9Af+tP2+mk28nimCFOp61H6en+/ppxHGJ41zVFfRIMrafQGxjGV4c75aR6oyWkqWnGMpYWMpOMJ/t/fGMd/zvJ9v7aT/AK6sN170aOjRpYv2XXS1xtRo2vYywD1Sl39i8L2FMPpKw2TEwgkAILCynt5uDwVUCMWEgqZDU8yk4YRAzjzY7xGF0P8AzZ51m8bc8K8T4/IyYnDcyzYtL+7jKJJHaLcWMMu2R/aqBLtmkrtB2pubZuR7AeCsLaSDNcve1W9yWGsu5bQsodWmaOd1Owq26SsKiMgFlqxUbgrLl8tGstbb45Eayt5r/vjq9p2rbSqmMM1P/ZBZtDdlrL0BYLjW61BFSUUHNB/MZELw2KxOKMQy0yK/kJuBeV8j4V+ObcZ5H4wGRPjfIXFm97bzXE1yVa3vwtxLFDK5UXMjWsiSlEo9SUCqItkqcduuVc3xOe4lyCWFL7ZIqEII0KvGskT0SgGwNEUO7dtJVixZ6uf+s3jDDf6ViJHy0/X1y9ydMA9iOwC3HWezTE45GrAU+6KoePDm8DJ/x/5vQyrwThSkp6mYHDWuGsvh2x3IZZJDWlayyNJQ0A+3cEWoJCKo9RqnuTyVxkrs3c5o5RVoPT2qAaD6BjViB0qzfrUyfu36850S3kj0mr1MDXDEhEYpSYAs4yzmx2fbMOQlyCNgVe2bqRTaWoRYki+2UPIkqIHwW2op/wBxYhYMnNkFZj3RWm5gNzO7MdikRehVQxQyUU1ehIPq8yT30SRyAL2wqqBXaFVAvTcW21oPZGIkBBJWRm3KzrRmmK9Wdaw0NLwrLpSBlNryQN6CsYU22lxxLf4wvu+jOW3M+ScpSlbf9ucZysqKLTSXqwUPDgQMcPFxjCRxBk+LaEpQnKv283MtoRhbmcYxjOe3fOMY69aNez6NGjo0aibbmmKPuaFDjLjEoOJhXTDq8egggMqMkCgnBcqwUGtt9YLq8tOPDqypl1bDSlpVltHaMvJnhzxt5hsbXH+RsYmRt7KYywHvXFvJE7ABtk1rLBMFbahdN+xiiMykohDn4zzLk3Dp5bnjd01tJMgVxtjkVwK03JKjoStTtbbuXc20jca54eXfF6s8adkaJhA34+Irc1E7JzWkBKJQVE5hHa0u4CLOlHiB1wEuDYI9SE4aznJCVuPrU6hLfXPj86+GnifGuOYDh9o39hPzVihBluJXupJ7aWoZ3e4mmMjgxb5C4d2WM0YhLGeBs2MvfZXJZqUf3Njb73osa9pIpI16JSNERFO4qi0FCzEmhYR9V65JVImcksFZQrL2XCpFlrEinyK88NloDJfBFJIV4rc8HiUZyjGG1LTn1MdOONnKHBWf98CDN/Fh+QFoVE/bXuhdpI2iTdShIpShpqrGQFoL6YWBJse8/brWvb3HYTUA120rUA/qNNsWhDicocQhxGe3dC04WnPbOFY7pVjOM9lYxnH9elzWnrz/AE/GP06NGjo0aOjRo6NGjo0ap5y10ENvljXA8pCoNiaDNTlwZkwSnlTw1kIim6rDRWIQaunEy1YMAsR8gapqREWOfEx+cinNqc9uzOT8PxfKsriLrLW8M0GKu2u4y1CwnRCkK7TG1UDObjeJY2Se2tqLKpbY4MNnrrCWV/DZOyzXtv8AHan29p2rKfu+4qDEvtNFldgyMq7pR0VpqM05V0QoaEIeVjCXMNOLy3hKHHO2cpQpLGcrTlPbHjnwwntjPbPbDxVdop9dIBJYlianU5detY0dGjR0aNHRo0dGjR0aNHRo0dGjR0aNHRo0dGjX/9k%3D) no-repeat 10px; }

.card.back { background-color: #b91d47; background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent)); background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent); background-image: -moz-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent); background-image: -ms-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent); background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent); background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent); }

.card.spades .small-suit:after { color: black; }

.card.spades .small-suit:before { font-family: iconFont; content: "\e009"; color: black; }

.card.spades .suit:after { font-size: 40pt; font-family: iconFont; content: "\e009"; color: black; }

.card.clubs .small-suit:after { color: black; }

.card.clubs .small-suit:before { font-family: iconFont; content: "\e00a"; color: black; }

.card.clubs .suit:after { font-size: 40pt; font-family: iconFont; content: "\e00a"; color: black; }

.card.diamonds .small-suit:after { color: red; }

.card.diamonds .small-suit:before { font-family: iconFont; content: "\e00b"; color: red; }

.card.diamonds .suit:after { font-size: 40pt; font-family: iconFont; content: "\e00b"; color: red; }

.card.hearts .small-suit:after { color: red; }

.card.hearts .small-suit:before { font-family: iconFont; content: "\e07f"; color: red; }

.card.hearts .suit:after { font-size: 40pt; font-family: iconFont; content: "\e07f"; color: red; }

code, pre { padding: 0 3px 2px; font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; font-size: 10pt; color: #525252; }

code { padding: 2px 4px; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; color: #d14; background-color: #f7f7f9; border: 1px #e1e1e8 solid; }

pre { display: block; padding: 10px; margin: 0; line-height: 14pt; word-break: break-all; word-wrap: break-word; white-space: pre; white-space: pre-wrap; background-color: #f5f5f5; border: 1px solid rgba(0, 0, 0, 0.15); }

pre.prettyprint { margin-bottom: 10px; }

pre code { padding: 0; color: inherit; background-color: transparent; border: 0; }

.page-control { position: relative;

  • zoom: 1;

}

.page-control:before, .page-control:after { display: table; content: ""; }

.page-control:after { clear: both; }

.page-control > ul { margin-left: 0; list-style: none;

  • zoom: 1;

position: absolute; z-index: 5; width: 100%; background-color: rgba(217, 217, 217, 0.16); height: 31px; }

.page-control > ul:before, .page-control > ul:after { display: table; content: ""; }

.page-control > ul:after { clear: both; }

.page-control > ul li:first-child { margin-left: 20px; }

.page-control > ul li { float: left; display: block; text-align: center; height: 100%; }

.page-control > ul li img { float: left; width: 16px; height: 16px; margin-right: 5px; margin-top: 3px; }

.page-control > ul li.active { border: 1px #ccc solid; border-bottom: 0; background-color: #fff; }

.page-control > ul li.active span, .page-control > ul li.active a { color: #2d89ef; }

.page-control > ul li span, .page-control > ul li a { text-decoration: none; display: block; float: left; padding: 5px 10px; color: #1e1e1e; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; cursor: pointer; outline: 0; }

.page-control.tabs-right > ul li { float: right !important; margin-left: 10px; }

.page-control .frames { margin-top: 30px; width: 100%; min-height: 50px; border: 1px #ccc solid; }

.page-control .frames .frame { width: 100%; min-height: 100%; height: auto; display: none; padding: 20px; }

.page-control .frames .frame.active { display: block; }

.page-control ul { display: block; overflow: visible; }

.page-control .menu-pull, .page-control .menu-pull-bar { display: none; }

.accordion { margin-left: 0; list-style: none;

  • zoom: 1;

margin-bottom: 10px; }

.accordion:before, .accordion:after { display: table; content: ""; }

.accordion:after { clear: both; }

.accordion > li { margin-bottom: 5px; display: block; }

.accordion > li > a { display: block; height: 32px; background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAALnSURBVEhLrZY/aNNREMeTXzPYksHBQdoMGUxbSkXSpK2gULcKCnas0MEODoIOgqWrRcHJujpEonQQh2LrVKVCgxWEtMVABMFCW0iTDg4iqNikiZ/vy2vMX2v/fOHy7t293929e/fuxe36B7q6urwtLS1DhUJh0O12+xH5ihrXFpTK5/Ovkc8sLy9/LYprUdeBDDc3N9+BHcdACgczjuN8wuC69MjkqAP5ZcZu5o/hJ+o5qnHQ29sbxtBL8Ri9Ho/H54yiAXp6es6yLgp7EkdXq9c32dEgHA4PE8ksC1/lcrkrKysrSatqiEwmkwoEAk+2t7eP8+1kW1vbj3Q6/cGq/0KRh0KhXzgZsaJ9g+8vQFl2pdQZmB0o5x6P550iX1paumc0BwC7WW9tbW0iZQ99Pt/U5ubmd0cKe6CubDZ7W2M9sMNr7K4gIsq7VlwDr9d7n1Stco4mUEfRM47rQBOJxDcJD4NYLJbD1ihORoLB4ClHdU5qUntVy36ArY8MCzgadvA0CM0UVUcKVeOghx8/9NYKS1DOLWtAEOcsq4t2plpP1E8tu4sk34y7ObQ1mFFu4YJVGOgwLftfoPoqLm1/f79/Z2dnTSnyMM8VxUcPRwesNNl5CTieKCdE5ee0UEdfATqBD/mWok9BHUZaBlJWUevKOR8MiWeMVeurwZpOBe+o5TIpXe2jAiV6CQdzSpG23q1eVFQdHjpggr6I7WlHPRxG/XxqYGDgmF1zKFA9UWzO68KZ0qK3nEDwBScRHI6ZVQcEtm4yPIJOY+uz6aZ0wZ/08QQOJumG79UVJd8vMK6DfYGdW7wlbyQrPTg8Eqs4+Q37TC23vb19cWNjI1/U7g1Fbo1HMP7AimufTD0WVMBzFq6qK9rG1RD2xkZZfx66gfGIVRnUOBD6+vp86ud8MMx0EZqFkjxKJnX2EnWqFBlVLfOMY8q59OWo62AXpp/TcjGgjqumaP62wJu/LcznoOnGu3S5/gDwHX69fcclgQAAAABJRU5ErkJggg%3D%3D) 5px no-repeat; background-color: rgba(217, 217, 217, 0.16); padding-left: 36px; padding-top: 5px; font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 11pt; letter-spacing: 0.01em; line-height: 13pt; font-smooth: always; }

.accordion > li > div { border: 1px #ccc dotted; padding: 10px; margin-top: 5px; display: none; }

.accordion > li.active > a { background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAKlSURBVEhLtZY/aNNREMeTXzOYkMGxJBkymDSGDua/QyFuERTULYJLBwdBB8HiXBSc7OxQCdJBHIqpUyodClYU8geFFBwCbSB/BJ0kKuavn3t5rX+S2D+JX7jce3fvd3fv3r17MZv+Ab/fb7fZbJd7vV7CbDa7Ebn6GtNHqNLtdteRp/P5/Oe+eBBDHYhhq9V6h+FdDFRwkDYMYxuDu6JHJo5mkF+EzzJ/xHhxmKMBB5FIJIyh5zLG6PVsNptRihEIBoNnWZdiOI2jq3+vn9JcIRwOJ4lkjYUv2u32pUKhUNSqkajX6xWPx/O42Wye5Nslp9P5tVarvdXqX5DIQ6HQd5xc06Ijg+/PQS12JalTUDuQnFssllcSeS6Xu6c0xwC72XU4HFOk7KHL5VqpVqtfDFHoAzW1Wq3bwseB3W6/T6pKnKMK1Kwr5hNerxx0oIcF6T6Dgyx02pA6JzWVSRkXYOsdbJOgkwbbSUDpvmqikGpMGPy48bSthZNEkcDdZspyh8E8t3BTKxSQ9/TwUKD6/ri0sVjM3el0diRFFubtvvg/gEjfjHO5RoELNwfV5R5UoBklnSDIjA9WMajVdSb7V3tSoHAuUEAZqSIp0VnpRX3V+JADJujz2F41pIczkH6+Eo/HT+g1Y4HqSWFzQy6c6kUYX4RNNxqNYze6PXCwN7E3By3IXHVTuuA3+vh7hEt0w9fSFUV+VGDcR+TPsHOLt+SlyPYfHB6JEk5+MHwiLdfr9W6Vy+VuX3swJHJtfBnjD7R48MmUx4IKeMrCEnxeN66R0Dc2xXpJyw2ML2uVwtBHPxqNuqSf80GS6Ra0BhV5lFTqeE5d6HxSinCplg34AgXzQfS/Y6iDPQQCgVMYSWJAOq4brv62MFZ/W5hnoNXRuzSZfgLYkUQRTJGc4wAAAABJRU5ErkJggg%3D%3D); background-color: #d9d9d9; }

.accordion > li.active > div { display: block; }

.accordion.dark > li > a { background-color: #464646; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAIzSURBVEhLtZYhSENRFIb3HgaDwWA0LAgaBBcMggu2DTQYFwwG44JBsE6MBpOwIhO0iahYJgoqBoNhFjEqaDAIBsOCsvn99509mXub080f/t33/nPuOfedd+7d82ItUK1W++AslykYh4PSwTN8gsee5x3AF6dGIDKBAjMsMS4zKpCC3DI+QNmVaBjOwFGYx77SKlGISqUyDh+NaZObAp8JeAdff/THIQPLsMAq+03+Efj2MmfN5i6aXA8MWrkc5kz6NUg0xfx3qNJ9AUMfokpSMOnPIFaOOG+w1hCh+MjYtCzY5mENOZMbgK2HWKVwsQhavUrT8gXh11YCAXuCeCrVkM+N+vzJ9/1iYO4ctOsNwznM+PxoEx3AbuMQpjwe45KMm3Ar0APwZPN26cD9JD4Ldq2NpwAhIuZPwW21571uTA+B9ivYtBBIcekqUQ/8cOo/QCW6YtzgJe8EUgCS13UK92OUQQ2h63OuL5zBwP13/yTcVYl24arpTYFz220qEHMBXqtEx7B+a3cH07Do82hq0VGyjTu5C+AJ9d+RJvaeEugMz8NtDL1y6BTE0TFxSmxtOCcM8AQ6z9ec0AGIkYXvxBwxKQBiGpYxNOyJdqGgxNBJ6jZkAzAsQWXPQe2PtsE8rVzB102KBg4z5lgiScLkpsAnju8Z1OkZvfLvwHEQFqCO8ROYJZDOFm1/MYmmPt83nyO0+pobWn62MHGIIQPdZwtd4f6lCFb7bCmqFcNuaUAs9glLFQdwvFGvGQAAAABJRU5ErkJggg%3D%3D); color: #fff; }

.accordion.dark > li.active > a { background-color: #1e1e1e; background-image: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAHpSURBVEhLtZavT8JRFMXBGQgEg5FAYNNgIBAMBhpsEowEIpFgYLMYMBsMFht/gRNHgRn8EzDoCBY2CAQ3g4GAAz/ncUW+ym++nu3swnn3nfu47/se32BgDobDYRie8DEFozAiHXRhB9aDwWAFvjl1CqYWkDGhSDwjykgmL8QW1LgK7cEMPIA3jF/MKzTGYDBIwLYxbfJMkHMIm/B9YT4JWdiDZVa5Y/JCkBtizqXNPTXZCwa0ciXkTFoZFEoyvw/Vuh8wEEZUS8omrQ28Svh8wO8HYiy2iUu3ZRbw2MarMV6srV6tWbihywLPOH5qVUy9z8FXG/MNeD7A8y0+6xBVnOov7mFKBaJ2iHwFns+EqApot90JnQR9XAk2bRItikRUYBt+OukfoAIdFqCLzAOqrwSbNokIvl1XAOri8hWY7xM6KlCH3qPtD45hTZV2eV51KBIjfXOo5fj1iHEn8OUaNhFCTtgQeD3Cqn11FfUrdJ9fmrQ28CjAPp7agx8gpqF+VtKklSFTPHST5k3ygoEiVPUS1PlYGszTymV+ZdJ0kJCxxAZFRps0B+RoQ9VzPSjTV/4bJEZgGeoa161YwCgpM+MRWh7eWU4Vzdtzw9zXFibGCFnoXls4sO5fCrPv15Ya2i18kv4XgcAXTr+7IYi7bgIAAAAASUVORK5CYII%3D); }

.carousel { display: block; position: relative; margin-bottom: 20px; }

.carousel .slides { width: 100%; height: 100%; overflow: hidden; position: relative; }

.carousel .slides .slide { position: absolute; left: 0; top: 0; width: 100%; height: 100%; }

.carousel .slides .slide.image img { width: 100%; height: 100%; }

.carousel .slides .slide .description { position: absolute; left: 0; right: 0; bottom: 0; padding: 10px; background: rgba(0, 0, 0, 0.7); color: #fff; }

.carousel .control { position: absolute; top: 50%; left: 15px; width: 40px; height: 45px; margin-top: -20px; font-size: 48pt; font-weight: 100; line-height: 30px; color: #fff; text-align: center; cursor: pointer; opacity: .75; }

.carousel .control.right { left: auto; right: 15px; }

.carousel .control:hover { opacity: 1; }

.carousel .markers > ul { margin-left: 0; list-style: none; position: absolute; top: 100%; left: 0; padding-top: 10px; }

.carousel .markers li { display: block; float: left; margin-right: 5px; }

.carousel .markers li a { width: 32px; height: 6px; background-color: red; display: block; float: left; }

.carousel .markers li.active a { background-color: #1e1e1e; }

.listview { margin-left: 0; list-style: none;

  • zoom: 1;

}

.listview li { margin-bottom: 10px; border: 4px transparent solid; padding: 10px; width: 300px; position: relative; display: block; cursor: pointer;

  • zoom: 1;

}

.listview li .icon { width: 48px; height: 48px; font-size: 40px; float: left; }

.listview li .icon img { width: 100%; height: 100%; }

.listview li .icon i { margin-top: 10px; }

.listview li .data { margin-left: 55px; }

.listview li .data h4 { margin: 0; padding: 0 0 2px 0; }

.listview li .data p { margin: 0; font-size: 9pt; }

.listview li:hover { outline: 3px #ccc solid; }

.listview li:active { outline: 3px #3e3e3e solid; }

.listview li:before, .listview li:after { display: table; content: ""; }

.listview li:after { clear: both; }

.listview.image li { width: 380px; }

.listview.image li .icon { width: 100px; height: 100px; border: 1px #ccc solid; }

.listview.image li .data { margin-left: 110px; }

.listview.image li .data h4 { margin-bottom: 4px; }

.listview.image li .data p { line-height: 16px; font-size: 10pt; margin-bottom: 5px; }

.listview.iconic li .icon { width: 32px; height: 32px; border: 1px #ccc solid; }

.listview.iconic li .data { margin-left: 40px; }

.listview.fluid li { float: left; margin-right: 10px; }

.listview li div.badge { position: absolute; left: -4px; top: -4px; background-color: #2d89ef; padding: 5px; margin: 0 !important; text-align: center; display: block; font-size: 9pt; color: #ffffff; }

.listview li div.badge.strech { padding: 0 5px; }

.listview li div.badge.right { right: -4px; left: auto; }

.listview li div.badge.bottom { top: auto; bottom: -4px; }

.listview > li.selected { border: 4px #2d89ef solid; }

.listview > li.selected:after { width: 0; height: 0; border-top: 40px solid #2d89ef; border-left: 40px solid transparent; position: absolute; display: block; right: 0; content: ""; top: 0; z-index: 1001; }

.listview > li.selected:before { position: absolute; content: "\e08a"; color: #fff; right: 4px; top: 0; font-family: iconFont; z-index: 1002; display: block; }

.listview:before, .listview:after { display: table; content: ""; }

.listview:after { clear: both; }

.slider { height: 12px; width: auto; position: relative; background-color: #c6c6c6; margin-bottom: 10px; }

.slider .marker { height: 12px; width: 12px; cursor: pointer; position: absolute; top: 0; left: 0; background-color: #000000; z-index: 3; }

.slider .complete { height: 100%; width: auto; background-color: #00828b; z-index: 2; }

.slider.vertical { height: auto; width: 12px; }

.slider.vertical .complete { position: absolute; height: auto; width: 12px; bottom: 0; }

.slider:hover .complete { background-color: #219297; }

.slider:active .complete, .slider:active + .marker:active .complete { background-color: #25bbc4; }

.dialog { position: absolute; top: 40%; left: 40%; min-width: 150px; min-height: 155px; z-index: 1002; box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2); }

.dialog .header { font-family: 'Segoe UI Light', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 200; font-size: 20pt; letter-spacing: 0.01em; line-height: 22pt; font-smooth: always; width: auto; height: 35px; padding: 0px 35px 5px 5px; font-size: 18px; white-space: nowrap; overflow: hidden; background-color: #2D89EF; color: #fff; border: 1px solid #2D89EF; border-bottom: 0 none; }

.dialog .header div { position: absolute; right: -5px; top: 5px; }

.dialog .header button { font-family: 'Segoe UI', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 400; font-size: 9pt; font-smooth: always; line-height: 11pt; font-size: 14px; padding: 4px 12px; line-height: 20px; vertical-align: middle !important; min-width: 90px; background-color: #ccc; border: 1px transparent solid; color: #353535; margin-right: 10px; margin-bottom: 10px; border-radius: 0; display: inline-block; vertical-align: middle; cursor: pointer; padding: 4px 10px; outline: none; min-width: 32px; min-height: 32px; width: 32px; height: 32px; text-align: center; position: relative; padding: 0; width: 24px !important; height: 24px !important; min-height: 24px; min-width: 24px; }

.dialog .header button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.dialog .header button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.dialog .header button.mini { min-width: 22px; width: 22px; }

.dialog .header button.big { min-width: 48px; width: 48px; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { vertical-align: -10%; font-size: 1.2em; display: inline-block; }

.dialog .header button [class^="icon-"].icon-large, .dialog .header button [class*=" icon-"].icon-large { line-height: .9em; }

.dialog .header button.big [class^="icon-"], .dialog .header button.big [class*=" icon-"] { font-size: 1.3333333333333333em; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { margin-right: 5px; }

.dialog .header button [class^="icon-"].right, .dialog .header button [class*=" icon-"].right { margin-left: 5px; margin-right: auto; }

.dialog .header button.standart { min-width: 90px; min-height: 32px; }

.dialog .header button:active, .dialog .header button.default:active { top: 1px; left: 1px; }

.dialog .header button:disabled, .dialog .header button.disabled { background-color: #eaeaea; color: #bebebe; cursor: not-allowed; }

.dialog .header button.default { background-color: #008287; color: #fff; }

.dialog .header button:hover, .dialog .header button.default:hover { color: inherit; }

.dialog .header button:focus { outline: 0; border: 1px #353535 dotted; }

.dialog .header button.mini { min-height: 20px; min-width: 20px; height: 14px; font-size: .75em !important; padding-top: 0px !important; }

.dialog .header button.big { min-height: 48px; height: 48px; font-size: 1.2em; }

.dialog .header button img { width: 16px; height: 16px; position: absolute; top: 8px; left: 8px; }

.dialog .header button [class^="icon-"], .dialog .header button [class*=" icon-"] { font-size: 11px; }

.dialog .header button i { position: absolute; left: 5px; top: 6px; }

.dialog .content { min-height: 85px; padding: 20px; background-color: #FFFFFF; border-left: 1px solid rgba(0, 0, 0, 0.2); border-right: 1px solid rgba(0, 0, 0, 0.2); font-family: 'Segoe UI Semilight', 'Open Sans', Verdana, Arial, Helvetica, sans-serif; font-weight: 300; font-size: 11pt; letter-spacing: 0.02em; line-height: 14pt; font-smooth: always; }

.dialog .action { position: relative; bottom: 0; width: auto; height: 40px; padding: 0 10px; font-size: 18px; text-align: center; white-space: nowrap; overflow: hidden; background-color: #FFFFFF; border-left: 1px solid rgba(0, 0, 0, 0.2); border-right: 1px solid rgba(0, 0, 0, 0.2); border-bottom: 1px solid rgba(0, 0, 0, 0.2); }

.dialog .action button { margin: 0 10px 0 0; }

.dialog .action button:last-child { margin: 0; }

  1. dialogOverlay {

width: 100%; height: 100%; position: fixed; top: 0; left: 0; background-color: rgba(235, 235, 235, 0.5); z-index: 1002; } </style> <style> /*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • Responsive.less
  • /

/*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • Colors.less
  • /

.fg-color-blue { color: #2d89ef !important; }

.fg-color-blueLight { color: #eff4ff !important; }

.fg-color-blueDark { color: #2b5797 !important; }

.fg-color-green { color: #00a300 !important; }

.fg-color-greenLight { color: #99b433 !important; }

.fg-color-greenDark { color: #1e7145 !important; }

.fg-color-red { color: #b91d47 !important; }

.fg-color-yellow { color: #ffc40d !important; }

.fg-color-orange { color: #e3a21a !important; }

.fg-color-orangeDark { color: #da532c !important; }

.fg-color-pink { color: #9f00a7 !important; }

.fg-color-pinkDark { color: #7e3878 !important; }

.fg-color-purple { color: #603cba !important; }

.fg-color-darken { color: #1d1d1d !important; }

.fg-color-lighten { color: #d5e7ec !important; }

.fg-color-white { color: #ffffff !important; }

.fg-color-grayDark { color: #525252 !important; }

.fg-color-magenta { color: #ff0097 !important; }

.fg-color-teal { color: #00aba9 !important; }

.fg-color-redLight { color: #ee1111 !important; }

.bg-color-blue { background-color: #2d89ef !important; }

.bg-color-blueLight { background-color: #eff4ff !important; }

.bg-color-blueDark { background-color: #2b5797 !important; }

.bg-color-green { background-color: #00a300 !important; }

.bg-color-greenLight { background-color: #99b433 !important; }

.bg-color-greenDark { background-color: #1e7145 !important; }

.bg-color-red { background-color: #b91d47 !important; }

.bg-color-yellow { background-color: #ffc40d !important; }

.bg-color-orange { background-color: #e3a21a !important; }

.bg-color-orangeDark { background-color: #da532c !important; }

.bg-color-pink { background-color: #9f00a7 !important; }

.bg-color-pinkDark { background-color: #7e3878 !important; }

.bg-color-purple { background-color: #603cba !important; }

.bg-color-darken { background-color: #1d1d1d !important; }

.bg-color-lighten { background-color: #d5e7ec !important; }

.bg-color-white { background-color: #ffffff !important; }

.bg-color-grayDark { background-color: #525252 !important; }

.bg-color-magenta { background-color: #ff0097 !important; }

.bg-color-teal { background-color: #00aba9 !important; }

.bg-color-redLight { background-color: #ee1111 !important; }

[class*=border-color] { border: 2px solid; }

.border-color-blue { border-color: #2d89ef !important; }

.border-color-blueLight { border-color: #eff4ff !important; }

.border-color-blueDark { border-color: #2b5797 !important; }

.border-color-green { border-color: #00a300 !important; }

.border-color-greenLight { border-color: #99b433 !important; }

.border-color-greenDark { border-color: #1e7145 !important; }

.border-color-red { border-color: #b91d47 !important; }

.border-color-yellow { border-color: #ffc40d !important; }

.border-color-orange { border-color: #e3a21a !important; }

.border-color-orangeDark { border-color: #da532c !important; }

.border-color-pink { border-color: #9f00a7 !important; }

.border-color-pinkDark { border-color: #7e3878 !important; }

.border-color-purple { border-color: #603cba !important; }

.border-color-darken { border-color: #1d1d1d !important; }

.border-color-lighten { border-color: #d5e7ec !important; }

.border-color-white { border-color: #ffffff !important; }

.border-color-grayDark { border-color: #525252 !important; }

.border-color-magenta { border-color: #ff0097 !important; }

.border-color-teal { border-color: #00aba9 !important; }

.border-color-redLight { border-color: #ee1111 !important; }

  • hover[class=outline-color] {

outline: 3px solid; }

.outline-color-blue { outline-color: #2d89ef !important; }

.outline-color-blueLight { outline-color: #eff4ff !important; }

.outline-color-blueDark { outline-color: #2b5797 !important; }

.outline-color-green { outline-color: #00a300 !important; }

.outline-color-greenLight { outline-color: #99b433 !important; }

.outline-color-greenDark { outline-color: #1e7145 !important; }

.outline-color-red { outline-color: #b91d47 !important; }

.outline-color-yellow { outline-color: #ffc40d !important; }

.outline-color-orange { outline-color: #e3a21a !important; }

.outline-color-orangeDark { outline-color: #da532c !important; }

.outline-color-pink { outline-color: #9f00a7 !important; }

.outline-color-pinkDark { outline-color: #7e3878 !important; }

.outline-color-purple { outline-color: #603cba !important; }

.outline-color-darken { outline-color: #1d1d1d !important; }

.outline-color-lighten { outline-color: #d5e7ec !important; }

.outline-color-white { outline-color: #ffffff !important; }

.outline-color-grayDark { outline-color: #525252 !important; }

.outline-color-magenta { outline-color: #ff0097 !important; }

.outline-color-teal { outline-color: #00aba9 !important; }

.outline-color-redLight { outline-color: #ee1111 !important; } /*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • Responsive-1200.less
  • /

/* Large desktop */ @media (min-width: 1200px) { }

@media (min-width: 1100px) { .nav-bar .nav-bar-inner .pull-menu { display: none; }

.nav-bar .nav-bar-inner > ul.menu { display: block !important; } } /*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • Responsive-979.less
  • /

/* Portrait tablet to landscape and desktop */ @media (min-width: 768px) and (max-width: 979px) { .span1 { width: 42px; }

.span2 { width: 104px; }

.span3 { width: 166px; }

.span4 { width: 228px; }

.span5 { width: 290px; }

.span6 { width: 352px; }

.span7 { width: 414px; }

.span8 { width: 476px; }

.span9 { width: 538px; }

.span10 { width: 600px; }

.span11 { width: 662px; }

.span12 { width: 724px; }

.offset1 { margin-left: 62px; }

.offset2 { margin-left: 124px; }

.offset3 { margin-left: 186px; }

.offset4 { margin-left: 248px; }

.offset5 { margin-left: 310px; }

.offset6 { margin-left: 372px; }

.offset7 { margin-left: 434px; }

.offset8 { margin-left: 496px; }

.offset9 { margin-left: 558px; }

.offset10 { margin-left: 620px; }

.offset11 { margin-left: 682px; }

.offset12 { margin-left: 744px; }

.nav-bar .nav-bar-inner .pull-menu { display: inline-block; }

.nav-bar .nav-bar-inner > .divider { float: none; }

.nav-bar .nav-bar-inner .element { float: none; }

.nav-bar .nav-bar-inner > ul.menu { display: none; float: none; margin: 5px; }

.nav-bar .nav-bar-inner > ul.menu > li { display: block; float: none; width: 100%; margin-left: 0; padding-left: 5px; }

.nav-bar .nav-bar-inner > ul.menu > li a { display: block; float: none; }

.nav-bar .nav-bar-inner > ul.menu > li .dropdown-menu { position: relative; width: 100%; border: 0; }

.nav-bar .nav-bar-inner [data-role=dropdown] { margin-right: 20px !important; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a { cursor: pointer; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a:before { position: absolute; content: "\203A"; display: block; font-size: 1.4em; left: 100%; margin-left: -10px; top: 8px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); } }

.place-left { float: left !important; margin-right: 10px; }

.place-right { float: right !important; margin-left: 10px; }

.scroll-y, .scroll-vertical { overflow-y: scroll; }

.scroll-x, .scroll-horizontal { overflow-x: scroll; }

.pos-rel { position: relative; }

.pos-abs { position: absolute; }

.pos-fix { position: fixed; }

.text-left { text-align: left; }

.text-right { text-align: right; }

.text-center { text-align: center; }

.text-justify { text-align: justify; }

.top-left { position: absolute; top: 0; left: 0; }

.top-right { position: absolute; top: 0; right: 0; }

.bottom-right { position: absolute; bottom: 0; right: 0; }

.bottom-left { position: absolute; bottom: 0; left: 0; }

.no-overflow { overflow: hidden; }

.no-display { display: none; }

.no-margin { margin: 0; }

.no-padding { padding: 0; }

.no-border { border: 0; }

.no-border-all { border: 0; }

.no-border-all * { border: 0; }

.as-block { display: block; float: none !important; }

.as-inline-block { display: inline-block; }

.nlm { margin-left: 0 !important; }

.nrm { margin-right: 0 !important; }

.clearfix {

  • zoom: 1;

}

.clearfix:before, .clearfix:after { display: table; content: ""; }

.clearfix:after { clear: both; }

.padding5 { padding: 5px; }

.padding7 { padding: 7px; }

.padding10 { padding: 10px; }

.padding15 { padding: 15px; }

.padding20 { padding: 20px; }

.padding30 { padding: 30px; }

.padding40 { padding: 40px; }

.padding80 { padding: 80px; }

.selected { border: 4px #2d89ef solid; }

.selected:after { width: 0; height: 0; border-top: 40px solid #2d89ef; border-left: 40px solid transparent; position: absolute; display: block; right: 0; content: "."; top: 0; z-index: 1001; }

.selected:before { position: absolute; content: "\e08a"; color: #fff; right: 4px; font-family: iconFont; z-index: 1002; }

.border { border: 1px #ccc solid; }

@media (max-width: 767px) { body { padding-right: 10px; padding-left: 10px !important; }

[class*="span"], .hero-unit { float: none; display: block; width: 100%; margin-left: 0; margin-right: 0; }

[class*="offset"], .hero-unit { margin-left: 0; }

table thead tr th { font-size: 9pt; }

table tbody tr td { font-size: 10pt; }

h1 { font-size: 30pt; }

h2 { font-size: 16pt; }

.nav-bar .nav-bar-inner .pull-menu { display: inline-block; }

.nav-bar .nav-bar-inner > .divider { float: none !important; }

.nav-bar .nav-bar-inner .element { float: none; }

.nav-bar .nav-bar-inner > ul.menu { display: none; float: none; margin: 5px; }

.nav-bar .nav-bar-inner > ul.menu > li { display: block; float: none; width: 100%; margin-left: 0; padding-left: 5px; }

.nav-bar .nav-bar-inner > ul.menu > li a { display: block; float: none; }

.nav-bar .nav-bar-inner > ul.menu > li .dropdown-menu { position: relative; width: 100%; border: 0; }

.nav-bar .nav-bar-inner [data-role=dropdown] { margin-right: 20px !important; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a { cursor: pointer; }

.nav-bar .nav-bar-inner [data-role=dropdown] > a:before { position: absolute; content: "\203A"; display: block; font-size: 1.4em; left: 100%; margin-left: -10px; top: 8px; -webkit-transform: rotate(90deg); -moz-transform: rotate(90deg); -ms-transform: rotate(90deg); -o-transform: rotate(90deg); transform: rotate(90deg); }

.page-control { position: relative; }

.page-control .menu-pull { background-image: url("data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAYAAADgdz34AAAACXBIWXMAAA7DAAAOwwHHb6hkAAAKT2lDQ1BQaG90b3Nob3AgSUNDIHByb2ZpbGUAAHjanVNnVFPpFj333vRCS4iAlEtvUhUIIFJCi4AUkSYqIQkQSoghodkVUcERRUUEG8igiAOOjoCMFVEsDIoK2AfkIaKOg6OIisr74Xuja9a89+bN/rXXPues852zzwfACAyWSDNRNYAMqUIeEeCDx8TG4eQuQIEKJHAAEAizZCFz/SMBAPh+PDwrIsAHvgABeNMLCADATZvAMByH/w/qQplcAYCEAcB0kThLCIAUAEB6jkKmAEBGAYCdmCZTAKAEAGDLY2LjAFAtAGAnf+bTAICd+Jl7AQBblCEVAaCRACATZYhEAGg7AKzPVopFAFgwABRmS8Q5ANgtADBJV2ZIALC3AMDOEAuyAAgMADBRiIUpAAR7AGDIIyN4AISZABRG8lc88SuuEOcqAAB4mbI8uSQ5RYFbCC1xB1dXLh4ozkkXKxQ2YQJhmkAuwnmZGTKBNA/g88wAAKCRFRHgg/P9eM4Ors7ONo62Dl8t6r8G/yJiYuP+5c+rcEAAAOF0ftH+LC+zGoA7BoBt/qIl7gRoXgugdfeLZrIPQLUAoOnaV/Nw+H48PEWhkLnZ2eXk5NhKxEJbYcpXff5nwl/AV/1s+X48/Pf14L7iJIEyXYFHBPjgwsz0TKUcz5IJhGLc5o9H/LcL//wd0yLESWK5WCoU41EScY5EmozzMqUiiUKSKcUl0v9k4t8s+wM+3zUAsGo+AXuRLahdYwP2SycQWHTA4vcAAPK7b8HUKAgDgGiD4c93/+8//UegJQCAZkmScQAAXkQkLlTKsz/HCAAARKCBKrBBG/TBGCzABhzBBdzBC/xgNoRCJMTCQhBCCmSAHHJgKayCQiiGzbAdKmAv1EAdNMBRaIaTcA4uwlW4Dj1wD/phCJ7BKLyBCQRByAgTYSHaiAFiilgjjggXmYX4IcFIBBKLJCDJiBRRIkuRNUgxUopUIFVIHfI9cgI5h1xGupE7yAAygvyGvEcxlIGyUT3UDLVDuag3GoRGogvQZHQxmo8WoJvQcrQaPYw2oefQq2gP2o8+Q8cwwOgYBzPEbDAuxsNCsTgsCZNjy7EirAyrxhqwVqwDu4n1Y8+xdwQSgUXACTYEd0IgYR5BSFhMWE7YSKggHCQ0EdoJNwkDhFHCJyKTqEu0JroR+cQYYjIxh1hILCPWEo8TLxB7iEPENyQSiUMyJ7mQAkmxpFTSEtJG0m5SI+ksqZs0SBojk8naZGuyBzmULCAryIXkneTD5DPkG+Qh8lsKnWJAcaT4U+IoUspqShnlEOU05QZlmDJBVaOaUt2ooVQRNY9aQq2htlKvUYeoEzR1mjnNgxZJS6WtopXTGmgXaPdpr+h0uhHdlR5Ol9BX0svpR+iX6AP0dwwNhhWDx4hnKBmbGAcYZxl3GK+YTKYZ04sZx1QwNzHrmOeZD5lvVVgqtip8FZHKCpVKlSaVGyovVKmqpqreqgtV81XLVI+pXlN9rkZVM1PjqQnUlqtVqp1Q61MbU2epO6iHqmeob1Q/pH5Z/YkGWcNMw09DpFGgsV/jvMYgC2MZs3gsIWsNq4Z1gTXEJrHN2Xx2KruY/R27iz2qqaE5QzNKM1ezUvOUZj8H45hx+Jx0TgnnKKeX836K3hTvKeIpG6Y0TLkxZVxrqpaXllirSKtRq0frvTau7aedpr1Fu1n7gQ5Bx0onXCdHZ4/OBZ3nU9lT3acKpxZNPTr1ri6qa6UbobtEd79up+6Ynr5egJ5Mb6feeb3n+hx9L/1U/W36p/VHDFgGswwkBtsMzhg8xTVxbzwdL8fb8VFDXcNAQ6VhlWGX4YSRudE8o9VGjUYPjGnGXOMk423GbcajJgYmISZLTepN7ppSTbmmKaY7TDtMx83MzaLN1pk1mz0x1zLnm+eb15vft2BaeFostqi2uGVJsuRaplnutrxuhVo5WaVYVVpds0atna0l1rutu6cRp7lOk06rntZnw7Dxtsm2qbcZsOXYBtuutm22fWFnYhdnt8Wuw+6TvZN9un2N/T0HDYfZDqsdWh1+c7RyFDpWOt6azpzuP33F9JbpL2dYzxDP2DPjthPLKcRpnVOb00dnF2e5c4PziIuJS4LLLpc+Lpsbxt3IveRKdPVxXeF60vWdm7Obwu2o26/uNu5p7ofcn8w0nymeWTNz0MPIQ+BR5dE/C5+VMGvfrH5PQ0+BZ7XnIy9jL5FXrdewt6V3qvdh7xc+9j5yn+M+4zw33jLeWV/MN8C3yLfLT8Nvnl+F30N/I/9k/3r/0QCngCUBZwOJgUGBWwL7+Hp8Ib+OPzrbZfay2e1BjKC5QRVBj4KtguXBrSFoyOyQrSH355jOkc5pDoVQfujW0Adh5mGLw34MJ4WHhVeGP45wiFga0TGXNXfR3ENz30T6RJZE3ptnMU85ry1KNSo+qi5qPNo3ujS6P8YuZlnM1VidWElsSxw5LiquNm5svt/87fOH4p3iC+N7F5gvyF1weaHOwvSFpxapLhIsOpZATIhOOJTwQRAqqBaMJfITdyWOCnnCHcJnIi/RNtGI2ENcKh5O8kgqTXqS7JG8NXkkxTOlLOW5hCepkLxMDUzdmzqeFpp2IG0yPTq9MYOSkZBxQqohTZO2Z+pn5mZ2y6xlhbL+xW6Lty8elQfJa7OQrAVZLQq2QqboVFoo1yoHsmdlV2a/zYnKOZarnivN7cyzytuQN5zvn//tEsIS4ZK2pYZLVy0dWOa9rGo5sjxxedsK4xUFK4ZWBqw8uIq2Km3VT6vtV5eufr0mek1rgV7ByoLBtQFr6wtVCuWFfevc1+1dT1gvWd+1YfqGnRs+FYmKrhTbF5cVf9go3HjlG4dvyr+Z3JS0qavEuWTPZtJm6ebeLZ5bDpaql+aXDm4N2dq0Dd9WtO319kXbL5fNKNu7g7ZDuaO/PLi8ZafJzs07P1SkVPRU+lQ27tLdtWHX+G7R7ht7vPY07NXbW7z3/T7JvttVAVVN1WbVZftJ+7P3P66Jqun4lvttXa1ObXHtxwPSA/0HIw6217nU1R3SPVRSj9Yr60cOxx++/p3vdy0NNg1VjZzG4iNwRHnk6fcJ3/ceDTradox7rOEH0x92HWcdL2pCmvKaRptTmvtbYlu6T8w+0dbq3nr8R9sfD5w0PFl5SvNUyWna6YLTk2fyz4ydlZ19fi753GDborZ752PO32oPb++6EHTh0kX/i+c7vDvOXPK4dPKy2+UTV7hXmq86X23qdOo8/pPTT8e7nLuarrlca7nuer21e2b36RueN87d9L158Rb/1tWeOT3dvfN6b/fF9/XfFt1+cif9zsu72Xcn7q28T7xf9EDtQdlD3YfVP1v+3Njv3H9qwHeg89HcR/cGhYPP/pH1jw9DBY+Zj8uGDYbrnjg+OTniP3L96fynQ89kzyaeF/6i/suuFxYvfvjV69fO0ZjRoZfyl5O/bXyl/erA6xmv28bCxh6+yXgzMV70VvvtwXfcdx3vo98PT+R8IH8o/2j5sfVT0Kf7kxmTk/8EA5jz/GMzLdsAAAAgY0hSTQAAeiUAAICDAAD5/wAAgOkAAHUwAADqYAAAOpgAABdvkl/FRgAAADFJREFUeNpidHd3/89AQ8DEQGMw9C0YBaOAcsA4mpNHc/IoGM3JozmZCgAAAAD//wMAc2MFkuS0c50AAAAASUVORK5CYII="); display: block; width: 24px; height: 24px; float: right; margin-top: 10px; margin-right: 10px; cursor: pointer; }

.page-control .menu-pull-bar { display: block; width: 100%; height: 44px; border: 1px solid #CCC; border-bottom: 0px; background-color: rgba(217, 217, 217, 0.16); padding: 10px 0px 10px 20px; color: #2D89EF; }

.page-control ul { width: 100%; height: auto; margin: 0px; position: relative; padding: 0px 20px 10px 20px; border: 1px solid #CCC; border-bottom: 0px; border-top: 0px; display: none; }

.page-control ul li { display: block; float: left; width: 100%; padding-left: 0; line-height: 32px; position: relative; height: auto; }

.page-control ul li:first-child { margin-left: 0px; }

.page-control ul li.active { border: 0px; background-color: rgba(0, 0, 0, 0); }

.page-control ul li.active a { color: #1e1e1e; }

.page-control ul li a { width: 100%; text-align: left; }

.page-control ul li a:hover { background: #464646; color: #fff; }

.page-control .frames { margin-top: 0px; }

.tile { width: 120px; height: 120px; }

.tile.double { width: 250px; }

.tile.triple { width: 380px; }

.tile.quadro { width: 510px; }

.tile.double-vertical { height: 250px; }

.tile.triple-vertical { height: 380px; }

.tile.quadro-vertical { height: 510px; }

.tile .tile-content { padding: 5px 10px; }

.tile.icon > .tile-content > img { width: 48px; height: 48px; margin-left: -24px; margin-top: -24px; }

.tile.icon > .tile-content > i { margin-left: -24px; font-size: 48px; }

.tile .brand > .badge, .tile .tile-status > .badge { width: 26px; height: 28px; right: 0; font-size: 9pt; }

.tile .brand > .name, .tile .tile-status > .name { margin-left: 10px; }

.tile .brand > .icon, .tile .tile-status > .icon { width: 24px; height: 24px; margin: 5px 10px; }

.tile .brand > img ~ .text, .tile .tile-status > img ~ .text { left: 40px; right: 40px; font-size: 8pt; } } /*

  • Metro UI CSS
  • (c) 2012-2013 by Sergey Pimenov
  • Licensed under the MIT License and Commercial
  • Responsive-480.less
  • /

/* Landscape phones and down */ @media (max-width: 480px) { .page.secondary .page-back { width: 24px; height: 24px; left: 0px !important; }

.page.secondary .page-header .page-header-content { height: 60px; min-height: 50px; }

.page.secondary .page-header .page-header-content h1 { left: 40px; }

.page.secondary .page-region .page-region-content { padding-left: 0; }

.page.fixed-header .page-header { position: relative !important; }

.page.fixed-header .page-header .page-header-content .user-login { float: right; margin: 35px 44px 0 0; cursor: pointer; }

.page.fixed-header .page-header .page-header-content .user-login .avatar { float: right; border: 1px #ccc solid; width: 40px; height: 40px; }

.page.fixed-header .page-header .page-header-content .user-login .avatar img { width: 100%; height: 100%; }

.page.fixed-header .page-header .page-header-content .user-login .name { float: left; margin: 0px 10px; text-align: right; }

.page.fixed-header .page-header .page-header-content .user-login .name .first-name { font-family: "Segoe UI Light", "Open Sans", sans-serif, sans; font-size: 14pt; display: block; margin: 0; }

.page.fixed-header .page-header .page-header-content .user-login .name .last-name { font-family: "Open Sans", sans-serif, sans; font-size: 8pt; display: block; margin: 0; }

.page.fixed-header .page-header .page-header-content h1 { left: 0; }

.page.fixed-header .page-region { padding-top: 20px; }

.horizontal-menu { height: auto; }

.horizontal-menu > ul { width: 100%; display: block; height: auto; }

.horizontal-menu > ul > li { width: 100%; float: none; display: block; position: relative; border-bottom: 1px #1e1e1e solid; }

.horizontal-menu > ul > li:last-child { border-bottom: 1px transparent solid; }

.horizontal-menu > ul > li a { width: 100%; float: none; }

.horizontal-menu > ul li ul { position: relative; width: 100%; border: 0; left: 10px; }

table thead tr th { font-size: 8pt; }

table tbody tr td { font-size: 9pt; padding: 2px 5px; }

h1 { font-size: 26pt; line-height: 18px; }

h2 { font-size: 16pt; line-height: 16px; }

h3 { font-size: 13pt; line-height: 16px; }

h3 { font-size: 13pt; line-height: 14px; }

.tile-group { max-width: 400px; float: none; }

.page.with-sidebar .page-region { margin-left: 0; clear: both; } } </style> <style> body { background-color: #fff; }

  1. bodyContent {

width: 1000px; margin: auto; background-color: #fff; }

.browsers-icons img { float: left; margin-right: 20px; }

  1. brand-name {

line-height: 24px; margin-top: 2px; }

hr { border: 0; border-bottom: 1px #ddd dotted; color: #ddd; background-color: #ddd; }

.charms, .app-bar, .message-dialog, .error-bar, .warning-bar, .info-bar { position: absolute; }

@media (min-width: 768px) and (max-width: 979px) {

  1. bodyContent {

width: 724px; }

.hero-unit > img { zoom: .6; }

.browsers-icons img { zoom: .8; } }

@media (max-width: 767px) {

  1. bodyContent {

width: 100%; }

.hero-unit > img { zoom: .6; }

.modern-ui-logo { width: 24px; height: 24px; }

.github-info { margin-top: 5px; }

a, .link { font-size: 9pt; }

h3 { line-height: 11px; }

.no-mobile { display: none; }

  1. carousel1 {

height: 300px !important; } }

@media (max-width: 480px) { .hero-unit img { display: none; }

  1. jetbrains {

display: none; }

  1. brand-name {

display: none; } }

  1. toctitle {

display: none; }

p { color: rgba(0,0,0,0.7); }

  1. toc {

background-color: transparent; border-width: 0px; } </style> <style>

  1. column-one {

}

.container { background-color: #ffffff; margin-top: 0px; }

.OWWNBcpCurrentDateFilled { display: none; }

  1. content {

width: 0px; margin: 0 auto auto 0; padding: 0em 0em 0em 0em; align: center; }

  1. column-content {

width: 0px; float: left; margin: 0 0 0 0; padding: 0; }

.firstHeading { display: none; width: 0px; }

  1. globalWrapper {

width: 100%; background-color: #ffffff; margin-left: auto; margin-right: auto; }

  1. column-one {

display: none; width: 0px; background-color: #ffffff; }

  1. content {

margin: 0 0 0 0; align: center; width: 100%; background-color: #ffffff; border: 0; }

  1. bodyContent {

margin-left: 42px; align: center; float: left; background-color: #ffffff; }

  1. column-content {

width: 100%; background-color: #ffffff; }

  1. footer {

display: none; position: center; width: 100%; }

  1. contentSub {

display: none; }

  1. nav1 {

position: fixed !important; position: absolute; top: 0; left: 0; width: 100%; }

  1. nav2 {

position: fixed !important; position: absolute; bottom: 0; left: 0; width: 100%; height: 41px; }

body { margin: 0; padding: 40px 0 100px 0; }

h2 { margin-top: 20px; } </style>

</head> <body> <div class="page"> <div class="nav-bar bg-color-darken" id="nav1"> <div class="nav-bar-inner padding7"> <span class="pull-menu"></span> <a href="http://openwetware.org/wiki/Biomod/2013/Komaba"><span class="element brand"><img class="place-left" src="http://openwetware.org/images/d/df/Komabaicon64.png" style="height: 20px" />DNA Screw - Komaba Team <small>Biomod 2013</small></span></a> <div class="divider"></div> <ul class="menu"> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba">Home</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Project">Project</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Design">Design</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Simulation">Simulation</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Experiment">Experiment</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Discussion">Discussion</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/Achievement">Achievement</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2013/Komaba/AboutUs">About</a></li> </ul> </div> </div> </div> </body> </html>

Overview

Figure D1

Our goal is to design the DNA screw in Figure D1. It consists of three parts; a cylinder, a ring, and DNA spiders. Both cylinder and ring are made of DNA origami. A cylinder and a ring were made in one scaffold to avoid the electrostatic interaction which would cause them to keep away from each other. With our design, the cylinder and the ring stay keeping some distance and will have more possibility to connect to each other. However, with this condition, four difficulties exist. First, making the ring and cylinder within 7250 mer. Second, finding an enzyme to cut the ring and cylinder. Third, finding a cylinder and a ring with a compatible size in diameter. Fourth, a proper design which allows putting anchors in an appropriate interval. With careful selection, designs of a cylinder and a ring solving these problems were adopted. The structure of the cylinder and the ring were designed based on two papers[1][2].

With the scaffold, the cylinder has tracks made of unpaired staples on its surface. The ring also has unpaired staples to connect to the spiders. The spiders consist of a tetrameric streptavidin bound to 4 biotinylated ssDNA: 3 walking legs and one CL-H strand. The DNA spider was designed based on this paper[3]. From the surface of the cylinder, 10mer long DNA strands, called anchors, are jutting out and are hybridized with footing DNAs. Two DNA spiders, which have legs made of DNAzyme, advance by cleaving the footings. Those spiders are set in the opposite positions on the surface of the cylinder.

How to construct the DNA screw

Design of Cylinder

Figure D2

Some articles describing cylinder's designing methods were carefully read and the methods were tried with cadnano. Finally the following method was adopted; a rectangle, which is made of a scaffold and staples, are formed into a cylinder shape. This method has two advantages. This cylinder's design is rigid as well as flexible in designing. In addition, the yield is quite high (i.e.88%). However, it is not possible to designate which surface becomes the front surface. Anchors can come up from the back surface in this method. Also There is no separating it from the cylinder in which anchors grow up from the front surface.

The cylinder is put in the center of the DNA screw as an axis supporting the rotation. A rectangular DNA Origami (140 staples and a M13mp18 scaffold) is bent into the cylindrical shape. The two sides of the rectangular origami are connected by staples. The diameter of the cylinder is 30.5 nm and the axial length 43.5 nm. The design was constructed using cadnano[4]. To identify the start and the end of anchors, one side of the cylinder projects out and it was defined as the end side as shown in Figure D2. Not modified side is the start side. In order to bind footing DNAs on its surface spirally, 10mer long DNA strands, anchors, are jutting out from the cylinder's surface. The anchors are designed for the 5' ends of the staples to be the anchors' tips.

Design of Ring

Figure D3

A winding helical pattern was adopted as a ring's part of cylinder-ring structure. The reason of adopting it is that it is small enough for the cylinder and the ring to be designed within 7250 mer of M13mp18. Moreover, because there is no crossover, it is easy to grow anchors. This designing method is not clearly written in the original paper[2] so it required particular conditions to duplicate.

The ring is also composed of DNA Origami and designed using cadnano[4]. A scaffold winds in a spiral shape as shown in Figure D3. There are four loops in the ring and neighboring loops are connected by staples as these loops are as close as possible. The diameter of the ring is 61.8 nm and the thickness of ring is 12.0 nm in consideration of Atomic Force Microscope visibility. Two 10mer long strands come up from the inner side of the ring and are connected to the DNA spiders.

Design of DNA spider

Figure D4

The DNA screw rotates by using DNA spiders. Our DNA spider consists of a streptavidin tetramer body and biotinylated ssDNA as legs. There are two kinds of legs : the first is walking leg and the second is a CL-H strand (Figure D4). The CL-H strand has two parts; capture leg(CL) part and head strand(H strand) part. A biotin is fixed in the middle of the CL-H strand and attached to the DNA spider's body. This is the part that was modified from the one in the original paper[3]. The sequences of those strands are listed here. The capture leg has a function of connecting the DNA spider to the specific strand at the start point on the cylinder. Head strand connects the DNA spider to the Ring. Walking legs make the DNA spider move forward and this function is described in Figure D5. The cohesion of the spider relies on the strong streptavidin/biotin interaction. The DNA spider with one CL-H strand and there walking legs are planned to be purified with electrophoresis。

<html> <img src="http://openwetware.org/images/5/54/DNAwalking.gif" width=300> </html>


Motion of The DNA Screw

The function of DNA spider

DNA spider with one CL-H strand, and three walking legs, is the core of the rotary function. A DNA spider's walking leg consists of 8-17DNAzyme. The spider advances by cleaving common footings by the walking legs and utilizing Brownian motion. The sequence of the common footings is designed as they hybridizes with walking legs. The process is described in the Figure D5. First the tip of the common footing is cleaved away by a walking leg. Second the partially cleaved common footing and the walking leg move by Brownian motion and one time walking leg hybridizes with a tip of next common footing. Finally, the walking leg dissociates from the last common footing followed by binding to the nearest common footing. This cleaving process occurs again and again, and the spider advances down the track.

How the spider advances on the cylinder's surface

Figure D6

The cylinder is rounded from the rectangle shape.Two DNA spiders are operated on the surface of cylinder so there are two tracks, each of which consists of three lines of the common footings. The distance between the common footings was designed as 10.5nm taking it into account that the interval between the common footings on the same track is short enough for the walking leg to move to next common footing. In addition, the interval between the two tracks, 16.2nm, are wide enough to avoid spiders from jumping to next footing track(Figure D6).


The start point and the end point

In order to make the DNA spider start to advance from the same starting point, the start anchor is jutted out at left end side(Figure D6). This start anchor partially hybridizes with specific strand at the starting point, called a start footing, and then the start footing hybridizes with capture leg in the DNA spider. Also to stop the spider's walk, three end anchors are attached at the end side on each track. The end anchors partially hybridizes with end footings. The sequence of the end footing is slightly different from common footing in that the the end footing uses A instead of rA. These sequences are listed here.

Cutting the scaffold

To make the DNA screw rotate, the ring and the cylinder, both of which are made of the same one scaffold, had to be separated. Here two appropriate enzymes were carefully selected considering the temperature, content of buffer, and other factors; BbvCI and SbfI. Both enzymes were incubated at 37℃.

Overall process

<html> <iframe width="640" height="390" src="//www.youtube.com/embed/b04Uk3lB0Mw" frameborder="0" allowfullscreen style="float:right;margin:10px;"></iframe> </html>

The DNA screw was realized by assembling the above three parts: the cylinder, DNA Spiders, and the ring. The DNA screw was assembled in the following process.


Step 1. The cylinder and the ring were synthesized.
Step 2. The DNA spider was synthesized
Step 3. The cylinder-ring structure, the DNA spider, and the start footing were mixed
Step 4. The common footings and the end footings were mixed with the solution made in the Step 3 and hybridized to the common anchors and the end anchors respectively.
Step 5. The two enzymes were put to cut the scaffold.
Step 6. A trigger strand was put. This is complementary to starting strand, which initiate the spider walking.

Other Designed Structures

Cylinder(1st ver.)

Figure D8

Before we designed the cylinder-ring structure, we made only a cylinder and confirmed that a cylinder designed based on the paper[1] was actually formed. The size is the diameter 38.2nm × the axial length 43.5nm. The interval of anchors of this cylinder was too wide for the DNA spiders to walk.

Ring(1st ver.)&(2nd ver.)

Figure D9
Figure D10

Rings with two other designs, Ring(1st ver.) and Ring(2nd ver.), were designed besides the ring shown in the cylinder-ring structure.

Ring(1st ver.) is a ring formed from a long tape using the same method as the cylinder[1].

The designing approach of Ring(2nd ver.) is that six-helix DNA bundle units, assembled from twelve single stranded DNAs arranged in networks of contiguous and semicrossover strands, are connected into nano rings without scaffold. It was designed based on this paper[5]. The sequences of all the staples but one are the same as those in the original paper. The one is one mer longer than the counterpart in the paper. You can see the sequences from Ring(2nd ver.) sequences. These two rings were tried without being designed with a cylinder in one scaffold.

Reference

  1. Yanming Fu.et al., Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors, American Chemical Society, 2012

    [cylinder]
  2. Dongran Han et al., Unidirectional Scaffold-Strand Arrangement in DNA Origami

    [ring]
  3. Kyle Lund et al., Molecular robots guided by prescriptive landscapes, Nature Vol465, 2010

    [spider]
  4. [cadnano]
  5. Yang Yang et al., Self-Assembly of DNA Rings from Scaffold-Free DNA Tiles, Nano Letters 2013

    [Ring2]