Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami
<html>
<style type="text/css"> <!--
- column-one {display:none; width:0px;}
- column-content {margin: 0;}
.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}
- globalWrapper{margin: 0 auto; padding: 0; width: 900px;}
.firstHeading {display:none; width:0px;}
- content {margin-left: 0; padding: 0; border: none;}
- sidebar-main {display:none; width:0px;}
- footer{position: center; margin: 0;}
body {
margin: 0; font-family: Calibri, Verdana, helvetica, sans-serif; background: url(http://openwetware.org/images/2/21/Biomod-2012-ut-komaba-Metal-texture.jpg) darkgray repeat-y;
}
- content {
margin: 0;
}
/*title*/
- title{
margin: 10px 0; padding: auto; background-color: black; text-align :center;
}
- navi ul {
font-size: 12px; margin: 0 0 30px; padding: 0; text-align:center; height: 30px; background-color: black}
- navi ul li {
list-style-type: none; float: left; padding: 0; margin: 0; display: block}
- navi ul li a {
display: block; width: 100px; line-height: 30px; text-decoration: none; text-align: center; color: #ffffff; background-color: black;
}
- navi ul li a:hover {
background-color: gainsboro; color: black;
}
- bodyContent{
width: 800px; margin: auto; padding: 50px; background: url("http://openwetware.org/images/c/c2/Biomod_2012_UToyko_UT-Komaba_background.png") white repeat-y; font-size: 140%;
}
- toc{
font-size: 80%;
}
/* table */ table {
border: solid 1px black; border-collapse: collapse; border-spacing: 0;
}
table.noborder, table.noborder th, table.noborder td{
border: none;
}
table th{
border: solid 1px black; padding: 1px 5px; color: white; background-color: darkgray; text-align: center;
}
table td{
border: solid 1px black; padding: 1px 5px; text-align: center;
}
table.tdleft td{
text-align: left;
}
h1,h2,h3,h4 {
font-family: serif; clear: both;
}
table.dialog{
border: none;
}
table.dialog th{
border: none; padding-top: 0px; background-color: white; color: black; text-decolation: bold; text-align: left;
}
table.dialog td{
border: none; padding: 5px 0; text-align: left;
}
--> </style>
<div id="title"><img src="http://openwetware.org/images/4/47/Biomod_2012_UTokyo_UT-Komaba_Top.png" alt="DNA tablet" width="800" height="120" onClick="this.src='http://openwetware.org/images/7/7d/BIOMOD_2012_UTokyo_UT-Komaba_title-animation.gif'"/></div>
<div id="navi"> <ul>
<li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba">Home</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Idea">Idea</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Simulation">Simulation</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Experiment">Experiment</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Progress">Progress</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Episode">Episode</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Team">Team</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Supplementary">Supplementary</a></li>
</ul> </div>
</html>
Concept
We combine DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerhead forms and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strand necessary for the hammerhead structure DNAs do not disturb during annealing in PCR. We observe the modified DNA origami with cover DNA by AFM.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.
GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.
(5' -> 3' direction)
addition to staple | cover | |
---|---|---|
1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
Experiment
October 3rd
We designed the modified origami and annealed them for about an hour in PCR. On the surface of one origami, there are 15 hummer head structure and 1 hairpin structure. Therefore, we order DNA which composes the structures and replace staple strands of normal origami with them. We drew three lines on the surface by the hummer head structures, and one line consisted of 5 hummer head structures. The abstract design of the origami is the picture above.
October 5th
We made modified origami in October 3rd and keep them at the laboratory room temperture.
We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami.
The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done.
Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface.