Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock
From OpenWetWare
| Line 90: | Line 90: | ||
<div class="img_center"><a rel="lightbox[aptamer_leg]" title="Legend" href="http://openwetware.org/images/e/ed/BM12_Nanosaurs_Aptamer_legend_800.jpg"><img src="http://openwetware.org/images/f/fc/BM12_Nanosaurs_Aptamer_legend_500.jpg"></a> | <div class="img_center"><a rel="lightbox[aptamer_leg]" title="Legend" href="http://openwetware.org/images/e/ed/BM12_Nanosaurs_Aptamer_legend_800.jpg"><img src="http://openwetware.org/images/f/fc/BM12_Nanosaurs_Aptamer_legend_500.jpg"></a> | ||
| - | <p> Fig. 3 Legend<p> | + | <p>  Fig. 3 Legend<p> |
</div> | </div> | ||
Revision as of 11:28, 29 October 2012
The Search for Locks and Keys
After designing our DNA origami box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig. 1.
Fig. 1 When the lock and key interact, the origami box opens.
For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. Such a system has been successfully used for a similar application (Douglas et al., Science 17 Feb 2012, Vol 335: 831-834). Aptamers are artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem 2008, 390: 989–1007). PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for tissue repair and wound healing (GF. Pierce et al., Biochem Apr 1991, 45 (4): 319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al. Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.
Aptamer strand: 5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'
Aptamer locking strand: 3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'
When Human PDGF-BB interacts with such a hybrid, it associates with the aptamer strand and the two strands of the lock dissociate. In other words, the complementary strand is displaced by PDGF because it has a higher affinity to the aptamer (Kd = 0.129±0.011 nM) (Green et al., Biochemistry 1996, 35: 14413-14424). To enhance the efficiency of the system, the aptamer locking strand is designed to be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, facilitates strand displacemnet and hence, opening of the lock by PDGF. However, the lock is still stable enough when the Origami box is closed. The locks were hence designed as described in Fig. 2(a). The two strands of the lock are attached to the the origami box by means of origami attachment sequences, complementary to the origami scaffold.
In order to see how efficiently this lock and key system works we had to come up with an assay to characterize its functioning. To actualize this, Black Hole Quencher (BHQ) labeled aptamer strands and Cyanine 3 (Cy3) labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed, the fluorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2 (a)). In the presence of PDGF, When the box is open, the distance between the BHQ and Cy3 is large enough to observe a strong Cy3 fluorescence (Fig. 2 (c)). Consequently, opening of the structure can be detected by an increase in the Cy3 fluorescence signal.
Fig. 2 Lock Sequences.
Spectrophotometric Measurements
In all our experiments, the lock is a hybrid of the complete aptamer strand and the complete aptamer locking strand. These strands will heneceforth be refered to as the aptamer strand and the aptamer locking strand respectively. Unless otherwise specified, the mention of a "lock" refers to a hydrid of the complete aptamer and aptamer locking strands, labeled with BHQ and Cy3 respectively. Whenever, labeled strands were used, the aptamer strand was labeled with BHQ and the aptamer locking strand was labeled with Cy3. All the samples were prepared as described under (Lab Book -> Protocols).
The legend below (Fig. 3) shows all the components mentioned here.
To begin with, the experiments for characterization of the lock were performed independent of the origami. In these experiments, the aptamer strand of the lock was not labeled with BHQ. Only the aptamer locking strand was labeled with Cy3.
We performed experiments to obtain an optimal fluorophore (Cy3) labeled lock concentration with an optimal signal-to-noise ratio. In all such measurements, samples containing the fluorophore were excited at 510 nm and emission was recorded at 564 nm, using a spectrophotometer. Fluorescence was measured for 1 nM, 10 nM and 100 nM Cy3 labeled lock concentrations. It was observed that the intensity of fluorescence increased linearly with the increase in Cy3 concentration (Fig. 4). A 10 nM Cy3 labeled lock concentration proved optimal, based on the fluorescence spectra obtained.
Solutions with 10 nM lock concentrations were measured for fluorescence. A control experiment was also designed, in which the aptamer strand of the lock hybrid was unlabeled. In such a control, since the Cy3 fluorescence from the fluorophore on the aptamer locking strand, does not get quenched, a high fluorescence was obtained. In comparison, the lock hybrid with both labels, showed a considerably lower fluorescence signal (Fig. 5). Hence, it was clear that the closed state of the lock is clearly discernible.
We now had the lock and had to work on opening it with its key. Samples of the lock were incubated with PDGF for 24 Hrs. PDGF was always used in a 10 times excess concentration than that of the lock. Control experiments were also designed. The negative control, consisted of the lock. Hence, very minimal signal would be expected with such a control. The positive control sample had the lock with only the aptamer locking strand labeled. In such a control, since the BHQ is absent, a high fluorescence signal would be expected. After repeated trials of such experiments, no significant increase in fluorescence intensity was observed in the presence of PDGF (Fig. 6).
Since, the use of PDGF to open the lock did not seem to work, the question remained; why did the PDGF key not open the aptamer lock?
- What would you do if you cannot open a lock with your key?
- You would probably try another key!
That is exactly what we did. We used two oligonucleotidic single strands, with sequences complementary to the aptamer strand and the aptamer locking strand, which we call blockers (Fig. 7). Blocker 1 and blocker 2 are complementary to the aptamer strand and the aptamer locking strand respectively. One may consider blockers as better keys because their interaction with the lock is guaranteed due to their sequence complementarity.
Fig. 7 Blocker sequences can open the lock.
Experiments were hence also designed, including the blockers. The following samples were prepared, to serve as the experiments and the controls.
Samples
- Lock
- Lock - aptamer strand without BHQ, aptamer locking strand with Cy3
- Lock - aptamer strand without BHQ, aptamer locking strand with Cy3; with PDGF
- Lock; with PDGF
- Lock; with blocker 1
- Lock; with blocker 2
- Lock; with both blockers, blocker1:blocker2 = 10:1
- Lock; with both blockers, blocker2:blocker1 = 10:1
- Lock; with both blockers, blocker1:blocker2 = 10:1, sample annealed before incubation
- Lock; with both blockers, blocker2:blocker1 = 10:1, sample annealed before incubation
PDGF was always used in a 10 times excess concentration than that of the lock. All the samples were incubated at room temperature for 24 Hrs. The results of this experiment are presented in Fig. 8. The results shown were obtained from averaging the measurements from three sets of experiments. The error bars show the standard deviation with is reasonably low. Hence, the results were consistent over multiple experiments
From the results obtained, it was observed hat the blockers work better than PDGF at opening the lock hybrid. Blocker 1 was found to be more efficient than blocker 2 as expected, since Blocker 1 is complementary to the aptamer strand over a longer length than Blocker 2 to the aptamer locking strand.
Gel Shift Assays
Our lock and key system was adapted from previously published results (Douglas et al., Science 17 Feb 2012, Vol 335: 831-834), the only variable being that both the aptamer strand and the aptamer locking strand were labeled. Hence, when our spectrophotometric measurements did not give us affirmative results, our first concern was whether the presence of the fluorophores was causing steric hinderences that prevented the key from binding to the lock. To clarify this concern, we ran a gel shift experiment (Fig. 9). With this experiment, we wanted to observe the differences in the functioning of the lock and key system with and without modification with fluorophores. The samples for each lane of the gel are as described below.
Lanes:
- Lock
- Lock; PDGF
- Aptamer strand with BHQ
- Aptamer strand with BHQ; with PDGF
- Aptamer locking strand with Cy3
- Ladder
- Lock - aptamer strand without BHQ, aptamer locking strand without Cy3
- Lock - aptamer strand without BHQ, aptamer locking strand without Cy3; PDGF
- Aptamer strand without BHQ
- Aptamer strand without BHQ; PDGF
All samples were incubated at room temperature for 24 hours, before being run on the gel. A 20 bp DNA ladder was used. A shift was clearly observed everytime PDGF was present with the aptamer strand or the lock hybrid. More importantly, it was observed that labeling the strands did not affect the binding of PDGF to the aptamer, since similar shifts in bands were observed with and without the fluorophores.
As the next step, to reaffirm the specificity of PDGF to the aptamer strand, another gel experiment was run. The gel is shown in Fig. 10. The samples for each lane of the gel are as described below.
Lanes:
- PDGF
- Aptamer locking strand with Cy3; PDGF
- Aptamer locking strand with Cy3
- Aptamer locking strand
- Aptamer strand with BHQ
- Aptamer strand
- Lock
- Lock - aptamer strand without BHQ, aptamer locking strand with Cy3
- Lock - aptamer strand without BHQ, aptamer locking strand with Cy3; with PDGF
- Aptamer strand without BHQ, incubated with PDGF. Aptamer Locking strand with Cy3 added after incubation period.
- Ladder
- Lock; PDGF
- Unspecific ds-DNA, one strand labeled with Cy3
- Unspecific short ds-DNA, one strand labeled with Cy3; PDGF
- Lock,aptamer strand without BHQ, aptamer locking strand with Cy3; blocker 1 and blocker 2
All samples were incubated at room temperature for 24 hours, before being run on the gel. A 20 bp DNA ladder was used. The gel was scanned in a gel scanner for the presence of bands rich in Cy3. A Cy3 band is seen in every lane that has DNA labeled with Cy3. In all the wells with PDGF – 2,9, 10,12 and 14, binding is observed, because Cy3 is observed in the wells. In well 9, no separate Cy3 band is observed except in the well. This suggests that the two strands of the lock hybrid do not separate when PDGF binds to the aptamer. In lanes 2 and10, a separate Cy3 band is observed, way below. This is easily explained for well 10, because, in this sample, the aptamer and PDGF were incubated for 24 hours and the complementary Cy3 labeled strand was added later. Ideally in lane 2, we should have seen just the Cy3 band in the gel with no Cy3 remanants in the well, since we expect PDGF to bind specifically only with the aptamer strand. This is however not the case. Similarly, in lane 14, we would expect just the Cy3 band in the gel with no Cy3 remanants in the well. However, we again notice unspecific binding here. These observations suggest that PDGF do not specifically bind only to the aptamer. However, in the last lane with the blockers, we observe to faint bands. One of these bands corresponds to the single stranded complementary strand. The other band corresponds to the complementary strand-blocker2 hybrid. This suggests that when the blockers are used, the lock does open.
To confer specificity to the opening of our DNA Origami Box, we wanted to use an aptamer based lock and key system. The specificity of aptamer-protein binding reactions, opens up numerous possibilities for using the system in biological scenarios. Our lock and key mechanism was adapted from previously established results. However, the system did not work as well as expected. It was hard to ascertain that the lock was definitely open. Multiple spectroscopic measurements were run with different parametric conditions and different lock and key concentrations. The end result was however, not satisfactory. To rule out the possibility of hinderances in aptamer-protein binding due to the presence of the fluorophores, gel shift assays were run. It was seen that the presence of the fluorophores did not show results different from when fluorophores were present. To confirm the specificity of PDGF to the aptamer, gel shift assays were run. It was observed that PDGF bound to the unspecific sequences too. Overall, the system did not perform as expected. However, the use of blockers to open the lock was our temporary fix to the problem.
















