Biomod/2011/TeamJapan/Tokyo/Achievements/DNA Devices

From OpenWetWare
Revision as of 05:12, 2 November 2011 by Kaito Sugaya (talk | contribs)
Jump to navigationJump to search


<html> <!--<head>--> <!-- We refer to the wiki of team iGEM Heidlberg 2009. -->

      <style type="text/css">

/* ====================

  主に全体に関わるCSS

   ==================== */

      body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}
      .clear {clear:both;}

body.mediawiki {

                       font-size: 14px;

background-color:#707070; background-position: center center; background-attachment: fixed; background-repeat: no-repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #0083eb;
                       text-decoration: none;
                       font-weight: bold;}
                       border: none;
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none;

               }

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #bodyContent {

                       width: 970px;
                       margin: 0px 0px 0px;
                       background-color:#ffffff;
                       border-width: 0px 1px 0px 1px;
                       border-color: #000000;
               }
               #content {
                       padding-left: 0px; width: 970px;
               }

table#team_members {

                       text-align: justify;
                       border: 0;
               }

table#team_members h2, table#team_members h3 {

                       clear: both;
               }

#content * a:hover {

                       text-decoration:none;
               }

#main_wrapper {

                       position:absolute;
                       left:0px;
                       top:20px;

margin-top: 0; width: 969px; height: 221px; align: center; border-style: solid;

                       border-color: white;

} /* ====================

  メニューの画像を変更できる部分
  ==================== */

#header {

                       position:relative;
                       left:0px;
                       top:0px;

margin-top: 0; width: 969px; height: 221px; align: left; background-color: #FFFFFF;

                       background-image: url(http://openwetware.org/images/e/e0/NEW_header.jpg); 

} /* ====================

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute;

                       left:18px; top:155px; width:1200px; height:69px;

z-index:100;

                       background-color: transparent;
                       float: left; 

color: #0000FF; } #super_main_wrapper {

                       position:absolute;
                       left:0px;
                       top:227px;

width: 975px; align: center; background-color: #ede8e2;

                       heigth: auto;
               }
               #SubWrapper {
                       width: 645px;
                       padding: 0px;
                       border-left:4px solid #ede8e2;
                       float: left;
                       margin-top: 0px;
                       background-color: #ede8e2;
               }
               #SubWrapper * p, #SubWrapper p  {
                       padding: 0 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #SubWrapper * h3, #SubWrapper h3 {
                       padding-top: 10px;
                       font-size: 18px;
               }
               #news {
                       width: 322px;
                       margin-top: 0px;
                       float: left;
                       background-color: #d8d5d0;
                       border-right:4px solid #ede8e2;
               }
               #news p {
                       padding: 0 20px 20px 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #news h3 {
                       padding: 10px 20px;
                       font-size: 18px;
               }
               #mission_box {
                       width:650px;
                       float: left;
               }
               #team_box, #heartbeat_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {
                       width:215px;
                       float: left;
                       padding: 10px 0 0 0;
               }
               div.tleft {
                       border-width: 0px;
                       margin:0;
                       padding:0;
                       border-color:transparent;
               }

/* ====================

  ここからプルダウン周辺のデザイン
  ==================== */
  1. menu * {

margin: 0; padding: 0; }

  1. menu {

behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --> font-family: calibri, verdana, sans-serif;

       font-color: #ffffff;

font-size: 19px; background-color: transparent; float:left; padding: 12px 0 0 0; }

  1. menu ul {

float: left; list-style: none; }

  1. menu ul li {

background-color:transparent;

       position:relative;

float:left; list-style: none; padding: 10px 20px 0 0;

       font-weight: bold;
       width: auto;

}

  1. menu a {

color: #FFFFFF; display: inline; text-decoration: none; }

  1. menu a:visited {

color:#FFFFFF; text-decoration: none }

  1. menu a:hover {

color: #00a5ea; }

  1. menu ul li ul {

display: none; position: absolute; left: 0px;

       width: 155px;
       heigth: 1%;

font-size: 19px; opacity: 0.8; list-style: none;

       top: 30px;
       padding-top: 20px;
       z-index:500;

}

  1. menu ul li:hover ul {

display: inline;

       background-position: bottom;

}

  1. menu ul li ul li {

width: 100%; list-style: none;

       background-color: #000;
       margin: -1px;
       padding: 0px 0 0 5px;
       display: inline;

}

</style> <!-- </head> -->


<!-- ############################# BODY!!!!! #################################### -->

<!-- <body> --> <!--[if IE]> <style type="text/css">

  1. SubWrapper {width: 645px;}
  2. news {width: 317px;}
  3. super_main_wrapper {position:static;}
  4. navigation {left: 15px;}
  5. menu ul li ul {left: -2px; top: 22px;}

</style> <![endif]--> <div id="main_wrapper">

 <div id="header">

<div id="navigation"> <div id="menu" style="position:static"> <ul> <li><a class="aMain" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo">Home</a></li> <li><a class="aTeam" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Team/Students">Team</a></li> <li><a class="aProject" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Project</a> <!-- <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/introduction">Introduction</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Model">Model</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Devices">Devices</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Modes">Modes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Results</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> </ul> --> <li><font color="#ffffff">Results</font> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Experiments</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Design</a></li> </ul></li> <!-- <li><a class="Simulation" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a class="DNA design" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Designs</a></li> --> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Protocols">Protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Lab.notebook">Notes</a></li> <li><a class="aNotebook" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sponsors/">Sponsors</a></li> <li><a class="aSitemap" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sitemap">Sitemap</a></li>

</ul> </div><!-- end drop menu --> </div> <!-- end navigation --> </div> </div> <!-- For IE 6 --> <script type="text/javascript">

/***********************************************

  • CSS Vertical List Menu- by JavaScript Kit (www.javascriptkit.com)
  • Menu interface credits: http://www.dynamicdrive.com/style/csslibrary/item/glossy-vertical-menu/
  • This notice must stay intact for usage
  • Visit JavaScript Kit at http://www.javascriptkit.com/ for this script and 100s more
                                                                                              • /

var menuids=new Array("verticalmenu") //Enter id(s) of UL menus, separated by commas var submenuoffset=-2 //Offset of submenus from main menu. Default is -2 pixels.

function createcssmenu(){ for (var i=0; i<menuids.length; i++){

 var ultags=document.getElementById(menuids[i]).getElementsByTagName("ul")
   for (var t=0; t<ultags.length; t++){
   var spanref=document.createElement("span")

spanref.className="arrowdiv" spanref.innerHTML="&nbsp;&nbsp;" ultags[t].parentNode.getElementsByTagName("a")[0].appendChild(spanref)

   ultags[t].parentNode.onmouseover=function(){
   this.getElementsByTagName("ul")[0].style.left=this.parentNode.offsetWidth+submenuoffset+"px"
   this.getElementsByTagName("ul")[0].style.display="block"
   }
   ultags[t].parentNode.onmouseout=function(){
   this.getElementsByTagName("ul")[0].style.display="none"
   }
   }
 }

} if (window.addEventListener) window.addEventListener("load", createcssmenu, false) else if (window.attachEvent) window.attachEvent("onload", createcssmenu) </script> <!-- </body> --> </html>













DNA designs

To achieve three modes of DNA ciliate, we designed five types of DNA sequences.
First is "deoxyribozyme" which is attached to DNA ciliate body. Second is "substrate" which is attached to a glass plate as a scaffold of the track walking mode. Third is "UV-switching DNA" which is used for UV-switching system. Forth is "blocking DNA" which is also used for UV-switching system. Fifth is "complementary strand for deoxyribozyme". Especially, the third DNA, "UV-switching DNA" is the DNA strand which we designed only by ourselves.
We could check that all these five types of DNA strand work as we expected. This is worthy of special mention.
In this page, we explain sequences and functions of five types of DNA strands.


1.Deoxyribozyme

Simplified image of deoxyribozyme
Simplified image of deoxyribozyme
  • 5' -(NH2)-TTATTATTAT CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA-3'
  • Size: 41bases
    • This DNA is the only DNA which is attached to DNA ciliate body. This has enzyme activity for substrate. The 31bases from 3' end of the strand1 are act as a deoxyribozyme when it hybridizes with the substrate. Those 31bases are same to the DNA spider's leg(CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA).
    • We designed by ourselves the first 10 bases from 5’ end as a linker between a substrate and a polystyrene bead (TTATTATTAT). Thanks to this linker, the space between DNA ciliate body and deoxyribozyme’s enzyme activity area is appeared, so deoxyribozyme can easily hybridize with other DNAs. The linker shouldn’t hybridize with other DNAs and make unexpected structure, so we also took care of these things. We designed linker which doesn’t make dimer and unexpected inner structure. In addition, we don’t use guanine and cytosine because these bases are easy to make nonspecific dimer. We select some strands as the candidates for linkers. As a result, we decide to use "TTATTATTAT" as a linker.
  • This DNA was used for construction of the DNA ciliate body.



2.Substrate

Simplified image of substrate
Simplified image of substrate
  • 5' -(NH2)-TTTTTTTTTT TTTTCACTAT[rA]GGAAGAG-3'
  • Size: 28bases
    • Substrate is used for the scaffold of the track walking mode. It contains an RNA base at 21st from its 5' end. When substrate hybridizes with deoxyribozyme, substrate works as deoxyribozyme’s substrete by be cut at the ribose. The last 18bases from 3'end of substrate are equal to cleaved substrate in other pages.
    • Those 18bases are same to the substrate of the DNA spider's leg (TTTTCACTAT[rA]GGAAGAG).(ref) In molecular spider, substrate is used as a part of DNA origami, but we can’t use DNA origami as a scaffold (link), so we designed substrate as a independent DNA strand.
    • We designed the first 10 bases from 5' end as a linker (TTTTTTTTTT). This is also designed not to make unexpected structures. As a result, we decide using this linker.
    • The 5' end is aminated to be fixed firmly on a glass plate.
  • This DNA was used for construction of DNA tracks.



3.UV-switching DNA

  

Simplified image of UV-switching DNA

  

Simplified image of UV-switching mechanism

  • 5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG TTTTT CT X CT X TC-3' (X means azobenzene. )
  • Size: 48bases + 2azobenzenes
    • UV-switching DNA is used for the scaffold in light-irradiated gathering mode. We designed this DNA by ourselves. UV-switching DNA has a five bases’ loop (TTTTT) and there are two azobenzenes (X ) in the one side of the stem (CTXCTX TC).
    • By spotting UV, azobenzenes are isomerized (trans to cis), so the part which contains azobenzenes becomes hard to form double strand. It is known that UV-switching can be realized by using this principle. (ref)
    • To achieve this switching, it is necessary to design the stem which forms the loop firmly in the room temperature and opens the loop by isomerizing of two azobenzenes. We didn’t find the precedent which succeeded in opening and closing at a single molecular by azobenzenes which are inserted into a stem, so the designing is very difficult. After trial and error, we designed to use “GAAGAG” and "CTXCTXTC" as the stem and "TTTTT" as the loop.
    • The 7th to 37th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) is a complete complementary part for the deoxyribozyme. In addition, the 7th to 31th bases from 5’ end (TTTTCACTATTTCGACCGGCTCGGA) are a complementary part for blocking DNA. Consequently, the 32th to 37th bases from 5’ end (GAAGAG) are a complementary part for deoxyriboyme and not a complementary part for blocking DNA, so branch migration is started from this part and blocking DNA is released. Moreover, these 6 bases are a part which makes stem, so this part is blocked when the loop is closed. By this structure, branch migration doesn’t happen when the loop is formed.
    • We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. As a result, we decide using this linker.
    • The 5' end is aminated to be fixed on a glass plate.
  • This DNA was used for UV-switching DNA devices.

4.Blocking DNA

Simplified image of blocking DNA
Simplified image of blocking DNA
  • 5' -TCCGAGCCGGTCGAAATAGTGAAAA-3'
  • Size: 25bases
    • Blocking DNA is the DNA which hybridizes with UV-switching DNA and prevent hybridization between deoxyrobozyme and UV-switching DNA.
    • Blocking DNA is complimentary to UV-switching DNA segment which is the 7th to 31th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGA).
    • Blocking DNA’s sequences is equal to a part of deoxyribozyme. The part is 25 bases from deoxyribozyme’s 3’ end. However, the blocking DNA doesn’t have deoxyribozyme activity because this DNA doesn’t have 6 bases which need for deoxyribozyme activity. Accordingly, in the future, if both substrate and UV-switching DNA are attached, released blocking DNA doesn’t cleave substrate.
  • This DNA was used for UV-switching DNA devices.


5.Complementary DNA for deoxyribozyme

Simplified image of complementary DNA for deoxyribozyme
Simplified image of complementary DNA for deoxyribozyme
  • 5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG-3'
  • Size: 48bases
    • The last 31 bases from 3' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) are a complete complementaty part for deoxyribozyme, and also, these bases are equal to the UV-switching DNA's 37 bases from 5' end
    • We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. As a result, we decide using this linker.
    • The 5' end is aminated to be fixed on a glass plate.
  • This DNA was used for construction of DNA tracks.