Biomod/2011/TeamJapan/Tokyo/Achievements/DNA Devices: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(24 intermediate revisions by 3 users not shown)
Line 1: Line 1:
{{HEAD_1}}
{{HEAD_1}}
__NOTOC__
__NOTOC__
<br>
<br>
<br>
<br>
<br>
<br>
<br>
<!--この上の呪文たちは必ず各ページのコピペすること-->
=DNA designs=
:To achieve three modes of DNA ciliate, we designed five types of DNA sequences.
: First is "deoxyribozyme" which is attached to DNA ciliate body. Second is "substrate" which is attached to a glass plate as a scaffold of the track walking mode. Third is "UV-switching DNA" which is used for UV-switching system. Forth is "blocking DNA" which is also used for UV-switching system. Fifth is "complementary strand for deoxyribozyme". Especially, the third DNA, "UV-switching DNA" is the DNA strand which we designed only by ourselves.
:We could check that all these five types of DNA strand work as we expected. This is worthy of special mention.
:In this page, we explain five types of DNA strands which we designed.The results of checking DNA’s work by experimentation are [here].


=DNA design=


:To achieve the DNA ciliate and its three modes, we constructed five types of DNA sequences: (1) "deoxyribozyme", attached to the body of the DNA ciliate; (2) "substrate DNA", attached to a glass plate as a DNA track for the track walking mode; (3) "UV-switching DNA", used for the UV-switching device and originally designed by ourselves; (4) "blocking DNA", used for the UV-switching device; (5) "complementary strand for deoxyribozyme", used for constantly-gathering of the DNA ciliate. All these five types of DNA strands worked as we expected (see Experimental Results). Here, we explain the sequence information and the functions of the five types of DNA strands in detail.


==1.Deoxyribozyme==
==1.Deoxyribozyme==
Line 24: Line 12:
[[Image:Deoxyribozyme2.png|thumb|center|Simplified image of deoxyribozyme|280px]]</td>
[[Image:Deoxyribozyme2.png|thumb|center|Simplified image of deoxyribozyme|280px]]</td>
   <td>
   <td>
*5' -(NH2)-<font color="#696969">TTATTATTAT</font> <font color="#dc143c">CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA</font>-3'
*5' -(NH<sub>2</sub>)-<font color="#696969">TTATTATTAT</font> <font color="#dc143c">CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA</font>-3'
*Size: 41bases
*Size: 41 bases
**This DNA is the only DNA which is attached to DNA ciliate body. This has enzyme activity for substrate. The 31bases from 3' end of the strand1 are act as a deoxyribozyme when it hybridizes with the substrate. Those 31bases are same to the DNA spider's leg(<font color="#dc143c">CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA</font>).  
**This DNA was attached to the DNA ciliate body.This DNA has enzymatic cleaving activity for the substrate DNA; i.e., deoxyribozyme. The 31 bases from 3' end of the above strand (shown in <font color="#dc143c">red</font>) acts as a deoxyribozyme when it hybridizes with the substrate DNA (2). The 31 bases are same as the sequence of the DNA spider leg (<font color="#dc143c">CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA</font>)<sup>[[#References|[1]]]</sup>.  
**We designed by ourselves the first 10 bases from 5’ end as a linker between a substrate and a polystyrene bead (<font color="#696969">TTATTATTAT</font>). Thanks to this linker, the space between DNA ciliate body and deoxyribozyme’s enzyme activity area is appeared, so deoxyribozyme can easily hybridize with other DNAs. The linker shouldn’t hybridize with other DNAs and make unexpected structure, so we also took care of these things. We designed linker which doesn’t make dimer and unexpected inner structure. In addition, we don’t use guanine and cytosine because these bases are easy to make nonspecific dimer. We select some strands as the candidates for linkers. As a result, we decide to use "<font color="#696969">TTATTATTAT</font>" as a linker.
**We designed the first 10 bases from 5’ end as a linker between the deoxyribozyme region and the DNA ciliate body (<font color="#696969">TTATTATTAT</font>). This linker increased the spacing between the DNA ciliate body and the enzymatic activity area of the deoxyribozyme, and thus the deoxyribozyme area easily hybridized with the substrate DNA and exerted its enzymatic activity (see Experimental Results). In addition, we carefully designed the sequence not to cause unexpected intramolecular structures or unexpected hybridization with other DNA in the experimental system.
*This DNA was used for [[Biomod/2011/TeamJapan/Tokyo/Project/Results#The body of the DNA ciliate|construction of the DNA ciliate body]].
 
</td>
</td>
   </tr>
   </tr>
</table>
</table>
==2.Substrate==
==2.Substrate==
<table width="100%">
<table width="100%">
Line 43: Line 25:
[[Image:Substrate2.png|thumb|left|Simplified image of substrate|280px]]</td>
[[Image:Substrate2.png|thumb|left|Simplified image of substrate|280px]]</td>
<td>
<td>
*5' -(NH2)-<font color="#696969">TTTTTTTTTT</font> <font color="#0000ff">TTTTCACTAT</font>[<font color="#ff8c00">rA</font>]<font color="#0000ff">GGAAGAG</font>-3'
*5' -(NH<sub>2</sub>)-<font color="#696969">TTTTTTTTTT</font> <font color="#0000ff">TTTTCACTAT</font>[<font color="#ff8c00">rA</font>]<font color="#0000ff">GGAAGAG</font>-3'
*Size: 28bases
*Size: 28 bases
**Substrate is used for the scaffold of the track walking mode. It contains an RNA base at 21st from its 5' end. When substrate hybridizes with deoxyribozyme, substrate works as deoxyribozyme’s substrete by be cut at the ribose. The last 18bases from 3'end of substrate are equal to cleaved substrate in other pages.
**The substrate DNA is used for the DNA tracks in the track walking mode. The substrate DNA contains an RNA base at the 21st base from 5' end of the DNA (shown as [rA]). When the deoxyribozyme (1) hybridizes with the substrate DNA, the substrate DNA works as an enzymatic substrete of the deoxyribozyme, resulting in the cleavage of the substrate DNA at the RNA base site. The last 18 bases from 3'end of the substrate DNA are same as the substrate of the DNA spider leg (<font color="#0000ff">TTTTCACTAT</font>[<font color="#ff8c00">rA</font>]<font color="#0000ff">GGAAGAG</font>)<sup>[[#References|[1]]]</sup>.  
**Those 18bases are same to the substrate of the DNA spider's leg (<font color="#0000ff">TTTTCACTAT</font>[<font color="#ff8c00">rA</font>]<font color="#0000ff">GGAAGAG</font>).(ref) In molecular spider, substrate is used as a part of DNA origami, but we can’t use DNA origami as a scaffold (link), so we designed substrate as a independent DNA strand.  
**We designed the first 10 bases from 5' end as a linker (<font color="#696969">TTTTTTTTTT</font>). This DNA was also designed not to make unexpected structures.
**We designed the first 10 bases from 5' end as a linker (<font color="#696969">TTTTTTTTTT</font>). This is also designed not to make unexpected structures. As a result, we decide using this linker.
*The 5' end was modified by an amino group (-NH<sub>2</sub>) to be fixed on a glass plate by a silane coupling reaction.
**The 5' end is aminated to be fixed firmly on a glass plate.
*This DNA was used for [[Biomod/2011/TeamJapan/Tokyo/Project/Results#Construction of DNA tracks|construction of DNA tracks]].
<!--**Strand2 contains an RNA base at 21st from its 5' end .
**The last 18bases from 3'end of strand2 are act as a cleavable substrate when it hybridizes with strand1. Those 18bases are same to the substrate of the DNA spider's leg (TTTTCACTAT[rA]GGAAGAG).
**We designed the first 10 bases from 5' end as a linker (<font color="#696969">TTTTTTTTTT</font>).
**The 5' end is aminated to be fixed on a glass plate.-->
</td>
</td>
   </tr>
   </tr>
</table>
</table>
==3.UV-switching DNA==
==3.UV-switching DNA==
<table width="100%">
<table width="100%">
Line 73: Line 44:
  </tr>
  </tr>
</table>
</table>
*5' -(NH<sub>2</sub>)-<font color="#696969">TTTTTT</font> <font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font> <font color="#ff8c00">TTTTT CT </font><font color="#8b008b">X </font><font color="#ff8c00">CT </font><font color="#8b008b">X</font> <font color="#ff8c00">TC</font>-3'(<font color="#8b008b">X </font> = azobenzene)
*Size: 48 bases + 2 azobenzenes
**The UV-switching DNA was used for an anchoring-DNA spot in the light-irradiated gathering mode. The UV-switching DNA forms a stem-loop structure. The loop consists of five bases (<font color="#ff8c00">TTTTT</font>), and the stem (<font color="#ff8c00">CT </font><font color="#8b008b">X </font><font color="#ff8c00">CT </font><font color="#8b008b">X</font> <font color="#ff8c00">TC</font>) has two trans-formed azobenzenes (<font color="#8b008b">X </font>). By UV irradiation, the azobenzenes are isomerized from the trans-form to the cis-form. As a result, the stem with the azobenzenes becomes hard to form the double strand <sup>[[#References|[2]]]</sup>.<br>To achieve this switching, it is necessary to design the stem sequence that firmly forms the stem-loop structure at the room temperature but opens the stem-loop structure by isomerization of the two azobenzenes from trans- to cis-form. There are no reports on the opening-and-closing transition of a single molecular by azobenzenes inserted into a stem. Here, we designed the sequences “<font color="#0000ff">GAAGAG</font>” and "<font color="#ff8c00">CT </font><font color="#8b008b">X </font><font color="#ff8c00">CT </font><font color="#8b008b">X</font> <font color="#ff8c00">TC</font>" as the stem and "<font color="#ff8c00">TTTTT</font>" as the loop by thermodynamic calculations<sup>[[#References|[3]]]</sup>.
**The 7th to 37th bases from 5' end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>) is a complementary sequence for the deoxyribozyme (1). In addition, the 7th to 31th bases from 5’ end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGA</font>) are a complementary part for blocking DNA (4) below.<br>Before UV irradiation, the stem-loop structure of the UV-switching DNA forms, and the blocking DNA is hybridizing with the UV-switching DNA. Thus, the deoxyribozyme cannot hybridize with the UV-switching DNA. After UV irradiation, the branch migration of the deoxyribozyme for the UV-switching DNA starts from the stem part and the blocking DNA is released. As a result, the deoxyribozyme and the UV-switching DNA form a double strand.
**We designed the first 6 bases from 5' end as a linker (<font color="#696969">TTTTTT</font>). This is also designed not to make unexpected structures.
**The 5' end is modified by an amino group (-NH<sub>2</sub>) to be fixed on a glass plate by a silane coupling reaction.


*5' -(NH2)-<font color="#696969">TTTTTT</font> <font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font> <font color="#ff8c00">TTTTT CT </font><font color="#8b008b">X </font><font color="#ff8c00">CT </font><font color="#8b008b">X</font> <font color="#ff8c00">TC</font>-3' (<font color="#8b008b">X </font> means azobenzene. )
*Size: 48bases + 2azobenzenes
**UV-switching DNA is used for the scaffold in light-irradiated gathering mode. We designed this DNA by ourselves. UV-switching DNA has a five bases’ loop (<font color="#ff8c00">TTTTT</font>) and there are two azobenzenes (<font color="#8b008b">X </font>) in the one side of the stem (<font color="#ff8c00">CT</font><font color="#8b008b">X</font><font color="#ff8c00">CT</font><font color="#8b008b">X</font> <font color="#ff8c00">TC</font>).
**By spotting UV, azobenzenes are isomerized (trans to cis), so the part which contains azobenzenes becomes hard to form double strand. It is known that UV-switching can be realized by using this principle. (ref)
**To achieve this switching, it is necessary to design the stem which forms the loop firmly in the room temperature and opens the loop by isomerizing of two azobenzenes. We didn’t find the precedent which succeeded in opening and closing at a single molecular by azobenzenes which are inserted into a stem, so the designing is very difficult. After trial and error, we designed to use “GAAGAG” and "<font color="#ff8c00">CT</font><font color="#8b008b">X</font><font color="#ff8c00">CT</font><font color="#8b008b">X</font><font color="#ff8c00">TC</font>" as the stem and "<font color="#ff8c00">TTTTT</font>" as the loop.
**The 7th to 37th bases from 5' end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>) is a complete complementary part for the deoxyribozyme. In addition, the 7th to 31th bases from 5’ end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGA</font>) are a complementary part for blocking DNA. Consequently, the 32th to 37th bases from 5’ end (<font color="#0000ff">GAAGAG</font>) are a complementary part for deoxyriboyme and not a complementary part for blocking DNA, so branch migration is started from this part and blocking DNA is released. Moreover, these 6 bases are a part which makes stem, so this part is blocked when the loop is closed. By this structure, branch migration doesn’t happen when the loop is formed.
**We designed the first 6 bases from 5' end as a linker (<font color="#696969">TTTTTT</font>). This is also designed not to make unexpected structures. As a result, we decide using this linker
**The 5' end is aminated to be fixed on a glass plate.




Line 91: Line 62:
<td>
<td>
*5' -<font color="#006400">TCCGAGCCGGTCGAAATAGTGAAAA</font>-3'
*5' -<font color="#006400">TCCGAGCCGGTCGAAATAGTGAAAA</font>-3'
*Size: 25bases
*Size: 25 bases
**Blocking DNA is the DNA which hybridizes with UV-switching DNA and prevent hybridization between deoxyrobozyme and UV-switching DNA.
**The blocking DNA helps to prevent the hybridization between the deoxyribozyme (1) the UV-switching DNA (3) before UV irradiation. The blocking DNA has a partly complementary sequence of the UV-switching DNA (<font color="#0000ff">TTTTCACTATTTCGACCG GCTCGGA</font>); that is, the sequence of the blocking DNA is partly equal to the deoxyribozyme sequence (the 25 bases from deoxyribozyme’s 3’ end). However, the blocking DNA does not have deoxyribozyme activity because the blocking DNA does not have a special 6-base sequence needed for the deoxyribozyme activity.
**Blocking DNA is complimentary to UV-switching DNA segment which is the 7th to 31th bases from 5' end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGA</font>).
**Blocking DNA’s sequences is equal to a part of deoxyribozyme. The part is 25 bases from deoxyribozyme’s 3’ end. However, the blocking DNA doesn’t have deoxyribozyme activity because this DNA doesn’t have 6 bases which need for deoxyribozyme activity. Accordingly, in the future, if both substrate and UV-switching DNA are attached, released blocking DNA doesn’t cleave substrate.
</td>
</td>
   </tr>
   </tr>
Line 106: Line 75:
[[Image:Complementary strand for deoxyribozyme.png|thumb|left|Simplified image of complementary DNA for deoxyribozyme|280px]]</td>
[[Image:Complementary strand for deoxyribozyme.png|thumb|left|Simplified image of complementary DNA for deoxyribozyme|280px]]</td>
<td>
<td>
*5' -(NH2)-<font color="#696969">TTTTTT</font> <font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>-3'
*5' -(NH<sub>2</sub>)-<font color="#696969">TTTTTT</font> <font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>-3'
*Size: 48bases
*Size: 48 bases
**The last 31 bases from 3' end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>) are a complete complementaty part for deoxyribozyme, and also, these bases are equal to the UV-switching DNA's 37 bases from 5' end  
*The last 31 bases from 3' end (<font color="#0000ff">TTTTCACTATTTCGACCGGCTCGGAGAAGAG</font>) are a complementary sequence of the deoxyribozyme, and are also equal to the 37 bases from 5' end of the UV-switching DNA. We designed the first 6 bases from 5' end as a linker (<font color="#696969">TTTTTT</font>). This is also designed not to make unexpected structures. The 5' end is modified by an amino group (-NH<sub>2</sub>) to be fixed on a glass plate by a silane coupling reaction.
**We designed the first 6 bases from 5' end as a linker (<font color="#696969">TTTTTT</font>). This is also designed not to make unexpected structures. As a result, we decide using this linker.
**The 5' end is aminated to be fixed on a glass plate.
<!--**The last 31 bases from 3' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) are complete counterpart of the deoxyribozyme part of the strand1.
**We designed the first 6 bases from 5' end as a linker (TTTTTT).
**The 5' end is aminated to be fixed on a glass plate.-->
</td>
</td>
   </tr>
   </tr>
</table>
</table>


==References==
==References==
<h2></h2>
:[1] Kyle Lund　<i>et al</i>.: Molecular robots guided by prescriptive landscapes, <i>Nature</i>, <b>465</b>, 206/210(2010)
:[2] Xingguo Liang <i>et al</i>.: Molecular Design for Reversing the Photoswitching Mode of Turning ON and OFF DNA Hybridization, <i>Chem. Asian J.</i>, <b>3</b>, 553/560(2008)
:[3] J.N. Zadeh,<i>et al</i>.: [http://www.nupack.org/ NUPACK]: analysis and design of nucleic acid systems, <i>J Comput Chem</i>, <b>32</b>, 170/173(2011)

Latest revision as of 04:34, 12 March 2012


<html> <!--<head>--> <!-- We refer to the wiki of team iGEM Heidlberg 2009. --> 

      <style type="text/css">

/* ==================== 

  主に全体に関わるCSS

　　　==================== */ 

      body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}

      .clear {clear:both;}

body.mediawiki { 

                       font-size: 14px;

background-color:#707070; background-position: center center; background-attachment: fixed; background-repeat: no-repeat; font-family: Calibri, Verdana, helvetica, sans-serif; } 

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #0083eb;
                       text-decoration: none;
                       font-weight: bold;}
                       border: none;
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none; 

               }

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover { 

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #bodyContent { 

                       width: 970px;
                       margin: 0px 0px 0px;
                       background-color:#ffffff;
                       border-width: 0px 1px 0px 1px;
                       border-color: #000000;
               }
               #content {
                       padding-left: 0px; width: 970px;
               }

table#team_members { 

                       text-align: justify;
                       border: 0;
               }

table#team_members h2, table#team_members h3 { 

                       clear: both;
               }

#content * a:hover { 

                       text-decoration:none;
               }

#main_wrapper { 

                       position:absolute;
                       left:0px;
                       top:20px;

margin-top: 0; width: 969px; height: 221px; align: center; border-style: solid; 

                       border-color: white;

} /* ==================== 

  メニューの画像を変更できる部分
  ==================== */

#header { 

                       position:relative;
                       left:0px;
                       top:0px;

margin-top: 0; width: 969px; height: 221px; align: left; background-color: #FFFFFF; 

                       background-image: url(http://openwetware.org/images/e/e0/NEW_header.jpg);

} /* ==================== 

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute; 

                       left:18px; top:155px; width:1200px; height:69px;

z-index:100; 

                       background-color: transparent;
                       float: left;

color: #0000FF; } #super_main_wrapper { 

                       position:absolute;
                       left:0px;
                       top:227px;

width: 975px; align: center; background-color: #ede8e2; 

                       heigth: auto;
               }
               #SubWrapper {
                       width: 645px;
                       padding: 0px;
                       border-left:4px solid #ede8e2;
                       float: left;
                       margin-top: 0px;
                       background-color: #ede8e2;
               }
               #SubWrapper * p, #SubWrapper p  {
                       padding: 0 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #SubWrapper * h3, #SubWrapper h3 {
                       padding-top: 10px;
                       font-size: 18px;
               }
               #news {
                       width: 322px;
                       margin-top: 0px;
                       float: left;
                       background-color: #d8d5d0;
                       border-right:4px solid #ede8e2;
               }
               #news p {
                       padding: 0 20px 20px 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #news h3 {
                       padding: 10px 20px;
                       font-size: 18px;
               }
               #mission_box {
                       width:650px;
                       float: left;
               }
               #team_box, #heartbeat_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {
                       width:215px;
                       float: left;
                       padding: 10px 0 0 0;
               }
               div.tleft {
                       border-width: 0px;
                       margin:0;
                       padding:0;
                       border-color:transparent;
               }

/* ==================== 

  ここからプルダウン周辺のデザイン
  ==================== */
  1. menu * {

margin: 0; padding: 0; }

  1. menu {

behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --> font-family: calibri, verdana, sans-serif; 

       font-color: #ffffff;

font-size: 19px; background-color: transparent; float:left; padding: 12px 0 0 0; }

  1. menu ul {

float: left; list-style: none; }

  1. menu ul li {

background-color:transparent; 

       position:relative;

float:left; list-style: none; padding: 10px 20px 0 0; 

       font-weight: bold;
       width: auto;

}

  1. menu a {

color: #FFFFFF; display: inline; text-decoration: none; }

  1. menu a:visited {

color:#FFFFFF; text-decoration: none }

  1. menu a:hover {

color: #00a5ea; }

  1. menu ul li ul {

display: none; position: absolute; left: 0px; 

       width: 155px;
       heigth: 1%;

font-size: 19px; opacity: 0.8; list-style: none; 

       top: 30px;
       padding-top: 20px;
       z-index:500;

}

  1. menu ul li:hover ul {

display: inline; 

       background-position: bottom;

}

  1. menu ul li ul li {

width: 100%; list-style: none; 

       background-color: #000;
       margin: -1px;
       padding: 0px 0 0 5px;
       display: inline;

}

</style> <!-- </head> -->


<!-- ############################# BODY!!!!! #################################### -->

<!-- <body> --> <!--[if IE]> <style type="text/css">

  1. SubWrapper {width: 645px;}
  2. news {width: 317px;}
  3. super_main_wrapper {position:static;}
  4. navigation {left: 15px;}
  5. menu ul li ul {left: -2px; top: 22px;}

</style> <![endif]--> <div id="main_wrapper"> 

 <div id="header">

<div id="navigation"> <div id="menu" style="position:static"> <ul> <li><a class="aMain" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo">Home</a></li> <li><a class="aTeam" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Team/Students">Team</a></li> <li><a class="aProject" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Project</a> <!-- <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/introduction">Introduction</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Model">Model</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Devices">Devices</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Modes">Modes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Results</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> </ul> --> <li><font color="#ffffff">Results</font> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Experiments</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Design</a></li> </ul></li> <!-- <li><a class="Simulation" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a class="DNA design" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Designs</a></li> --> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Protocols">Protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Lab.notebook">Notes</a></li> <li><a class="aNotebook" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sponsors/">Sponsors</a></li> <li><a class="aSitemap" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sitemap">Sitemap</a></li>

</ul> </div><!-- end drop menu --> </div> <!-- end navigation --> </div> </div> <!-- For IE 6 --> <script type="text/javascript">

/***********************************************

  • CSS Vertical List Menu- by JavaScript Kit (www.javascriptkit.com)
  • Menu interface credits: http://www.dynamicdrive.com/style/csslibrary/item/glossy-vertical-menu/
  • This notice must stay intact for usage
  • Visit JavaScript Kit at http://www.javascriptkit.com/ for this script and 100s more
                                                                                              • /

var menuids=new Array("verticalmenu") //Enter id(s) of UL menus, separated by commas var submenuoffset=-2 //Offset of submenus from main menu. Default is -2 pixels.

function createcssmenu(){ for (var i=0; i<menuids.length; i++){ 

 var ultags=document.getElementById(menuids[i]).getElementsByTagName("ul")
   for (var t=0; t<ultags.length; t++){
   var spanref=document.createElement("span")

spanref.className="arrowdiv" spanref.innerHTML="&nbsp;&nbsp;" ultags[t].parentNode.getElementsByTagName("a")[0].appendChild(spanref) 

   ultags[t].parentNode.onmouseover=function(){
   this.getElementsByTagName("ul")[0].style.left=this.parentNode.offsetWidth+submenuoffset+"px"
   this.getElementsByTagName("ul")[0].style.display="block"
   }
   ultags[t].parentNode.onmouseout=function(){
   this.getElementsByTagName("ul")[0].style.display="none"
   }
   }
 }

} if (window.addEventListener) window.addEventListener("load", createcssmenu, false) else if (window.attachEvent) window.attachEvent("onload", createcssmenu) </script> <!-- </body> --> </html>







DNA design

To achieve the DNA ciliate and its three modes, we constructed five types of DNA sequences: (1) "deoxyribozyme", attached to the body of the DNA ciliate; (2) "substrate DNA", attached to a glass plate as a DNA track for the track walking mode; (3) "UV-switching DNA", used for the UV-switching device and originally designed by ourselves; (4) "blocking DNA", used for the UV-switching device; (5) "complementary strand for deoxyribozyme", used for constantly-gathering of the DNA ciliate. All these five types of DNA strands worked as we expected (see Experimental Results). Here, we explain the sequence information and the functions of the five types of DNA strands in detail.

1.Deoxyribozyme

Simplified image of deoxyribozyme
  • 5' -(NH2)-TTATTATTAT CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA-3'
  • Size: 41 bases
    • This DNA was attached to the DNA ciliate body.This DNA has enzymatic cleaving activity for the substrate DNA; i.e., deoxyribozyme. The 31 bases from 3' end of the above strand (shown in red) acts as a deoxyribozyme when it hybridizes with the substrate DNA (2). The 31 bases are same as the sequence of the DNA spider leg (CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA)[1].
    • We designed the first 10 bases from 5’ end as a linker between the deoxyribozyme region and the DNA ciliate body (TTATTATTAT). This linker increased the spacing between the DNA ciliate body and the enzymatic activity area of the deoxyribozyme, and thus the deoxyribozyme area easily hybridized with the substrate DNA and exerted its enzymatic activity (see Experimental Results). In addition, we carefully designed the sequence not to cause unexpected intramolecular structures or unexpected hybridization with other DNA in the experimental system.

2.Substrate

Simplified image of substrate
  • 5' -(NH2)-TTTTTTTTTT TTTTCACTAT[rA]GGAAGAG-3'
  • Size: 28 bases
    • The substrate DNA is used for the DNA tracks in the track walking mode. The substrate DNA contains an RNA base at the 21st base from 5' end of the DNA (shown as [rA]). When the deoxyribozyme (1) hybridizes with the substrate DNA, the substrate DNA works as an enzymatic substrete of the deoxyribozyme, resulting in the cleavage of the substrate DNA at the RNA base site. The last 18 bases from 3'end of the substrate DNA are same as the substrate of the DNA spider leg (TTTTCACTAT[rA]GGAAGAG)[1].
    • We designed the first 10 bases from 5' end as a linker (TTTTTTTTTT). This DNA was also designed not to make unexpected structures.
  • The 5' end was modified by an amino group (-NH2) to be fixed on a glass plate by a silane coupling reaction.

3.UV-switching DNA

　　
Simplified image of UV-switching DNA
　　
Simplified image of UV-switching mechanism
  • 5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG TTTTT CT X CT X TC-3'(X = azobenzene)
  • Size: 48 bases + 2 azobenzenes
    • The UV-switching DNA was used for an anchoring-DNA spot in the light-irradiated gathering mode. The UV-switching DNA forms a stem-loop structure. The loop consists of five bases (TTTTT), and the stem (CT X CT X TC) has two trans-formed azobenzenes (X ). By UV irradiation, the azobenzenes are isomerized from the trans-form to the cis-form. As a result, the stem with the azobenzenes becomes hard to form the double strand [2].
      To achieve this switching, it is necessary to design the stem sequence that firmly forms the stem-loop structure at the room temperature but opens the stem-loop structure by isomerization of the two azobenzenes from trans- to cis-form. There are no reports on the opening-and-closing transition of a single molecular by azobenzenes inserted into a stem. Here, we designed the sequences “GAAGAG” and "CT X CT X TC" as the stem and "TTTTT" as the loop by thermodynamic calculations[3].
    • The 7th to 37th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) is a complementary sequence for the deoxyribozyme (1). In addition, the 7th to 31th bases from 5’ end (TTTTCACTATTTCGACCGGCTCGGA) are a complementary part for blocking DNA (4) below.
      Before UV irradiation, the stem-loop structure of the UV-switching DNA forms, and the blocking DNA is hybridizing with the UV-switching DNA. Thus, the deoxyribozyme cannot hybridize with the UV-switching DNA. After UV irradiation, the branch migration of the deoxyribozyme for the UV-switching DNA starts from the stem part and the blocking DNA is released. As a result, the deoxyribozyme and the UV-switching DNA form a double strand.
    • We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures.
    • The 5' end is modified by an amino group (-NH2) to be fixed on a glass plate by a silane coupling reaction.



4.Blocking DNA

Simplified image of blocking DNA
  • 5' -TCCGAGCCGGTCGAAATAGTGAAAA-3'
  • Size: 25 bases
    • The blocking DNA helps to prevent the hybridization between the deoxyribozyme (1) the UV-switching DNA (3) before UV irradiation. The blocking DNA has a partly complementary sequence of the UV-switching DNA (TTTTCACTATTTCGACCG GCTCGGA); that is, the sequence of the blocking DNA is partly equal to the deoxyribozyme sequence (the 25 bases from deoxyribozyme’s 3’ end). However, the blocking DNA does not have deoxyribozyme activity because the blocking DNA does not have a special 6-base sequence needed for the deoxyribozyme activity.


5.Complementary DNA for deoxyribozyme

Simplified image of complementary DNA for deoxyribozyme
  • 5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG-3'
  • Size: 48 bases
  • The last 31 bases from 3' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) are a complementary sequence of the deoxyribozyme, and are also equal to the 37 bases from 5' end of the UV-switching DNA. We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. The 5' end is modified by an amino group (-NH2) to be fixed on a glass plate by a silane coupling reaction.

References

[1] Kyle Lund　et al.: Molecular robots guided by prescriptive landscapes, Nature, 465, 206/210(2010)
[2] Xingguo Liang et al.: Molecular Design for Reversing the Photoswitching Mode of Turning ON and OFF DNA Hybridization, Chem. Asian J., 3, 553/560(2008)
[3] J.N. Zadeh,et al.: NUPACK: analysis and design of nucleic acid systems, J Comput Chem, 32, 170/173(2011)
Retrieved from "https://openwetware.org/mediawiki/index.php?title=Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices&oldid=591397"