Biomod/2011/TeamJapan/Tokyo/Achievements/DNA Devices: Difference between revisions
Kaito Sugaya (talk | contribs) No edit summary |
Kaito Sugaya (talk | contribs) No edit summary |
||
Line 6: | Line 6: | ||
:[[Image:DNA devices.jpg|border|300px]] | :[[Image:DNA devices.jpg|border|300px]] | ||
==Abstract== | ==Abstract== | ||
: | :To achieve three mode of DNA ciliate, we designed five types of DNA arrangements. | ||
:Five types of DNA are followings. First is "deoxyribozyme" which is attached to DNA ciliate body. Second is "substrate" which is attached to a glass plate as a scaffold of the track walking mode. Third is "UV-switching DNA" which is used for UV-switching system. Forth is "blocking DNA" which is also used for UV-switching system. Fifth is "complementary strand for deoxyribozyme". Especially, the third DNA, "UV-switching DNA" is the DNA strand which we designed only by ourselves. | :Five types of DNA are followings. First is "deoxyribozyme" which is attached to DNA ciliate body. Second is "substrate" which is attached to a glass plate as a scaffold of the track walking mode. Third is "UV-switching DNA" which is used for UV-switching system. Forth is "blocking DNA" which is also used for UV-switching system. Fifth is "complementary strand for deoxyribozyme". Especially, the third DNA, "UV-switching DNA" is the DNA strand which we designed only by ourselves. | ||
:We could check that all these five types of DNA strand work as we expected. This is worthy of special mention. | :We could check that all these five types of DNA strand work as we expected. This is worthy of special mention. |
Revision as of 10:41, 31 October 2011
<html> <!--<head>--> <!-- We refer to the wiki of team iGEM Heidlberg 2009. -->
<style type="text/css">
/* ====================
主に全体に関わるCSS
==================== */
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}
.clear {clear:both;}
body.mediawiki {
font-size: 14px;
background-color:#707070; background-position: center center; background-attachment: fixed; background-repeat: no-repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }
h1 { padding: 0px 20px 5px 20px; font-size: 34px; font-weight: bold; } h2 { padding: 20px 20px 5px 20px; font-size: 25px; color: #0083eb; text-decoration: none; font-weight: bold;} border: none; h2 a { color: #eb8300; } h3 { padding: 20px 20px 5px 20px; font-size: 20px; color: #000; font-decoration: none; font-weight: bold; } h1.firstHeading {
display: none;
}
p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {
color: #eb8300;
text-decoration: none } a:active { color:#f29400; text-decoration: none } #bodyContent {
width: 970px; margin: 0px 0px 0px; background-color:#ffffff; border-width: 0px 1px 0px 1px; border-color: #000000; } #content { padding-left: 0px; width: 970px; }
table#team_members {
text-align: justify; border: 0; }
table#team_members h2, table#team_members h3 {
clear: both; }
#content * a:hover {
text-decoration:none; }
#main_wrapper {
position:absolute; left:0px; top:20px;
margin-top: 0; width: 969px; height: 221px; align: center; border-style: solid;
border-color: white;
} /* ====================
メニューの画像を変更できる部分 ==================== */
#header {
position:relative; left:0px; top:0px;
margin-top: 0; width: 969px; height: 221px; align: left; background-color: #FFFFFF;
background-image: url(http://openwetware.org/images/e/e0/NEW_header.jpg);
} /* ====================
以下、特殊なclassに適用される ==================== */
#navigation { position:absolute;
left:18px; top:155px; width:1200px; height:69px;
z-index:100;
background-color: transparent; float: left;
color: #0000FF; } #super_main_wrapper {
position:absolute; left:0px; top:227px;
width: 975px; align: center; background-color: #ede8e2;
heigth: auto; } #SubWrapper { width: 645px; padding: 0px; border-left:4px solid #ede8e2; float: left; margin-top: 0px; background-color: #ede8e2; } #SubWrapper * p, #SubWrapper p { padding: 0 20px; text-align: justify; font-size: 12px; } #SubWrapper * h3, #SubWrapper h3 { padding-top: 10px; font-size: 18px; } #news { width: 322px; margin-top: 0px; float: left; background-color: #d8d5d0; border-right:4px solid #ede8e2; } #news p { padding: 0 20px 20px 20px; text-align: justify; font-size: 12px; } #news h3 { padding: 10px 20px; font-size: 18px; } #mission_box { width:650px; float: left; } #team_box, #heartbeat_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy { width:215px; float: left; padding: 10px 0 0 0; } div.tleft { border-width: 0px; margin:0; padding:0; border-color:transparent; }
/* ====================
ここからプルダウン周辺のデザイン ==================== */
- menu * {
margin: 0; padding: 0; }
- menu {
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --> font-family: calibri, verdana, sans-serif;
font-color: #ffffff;
font-size: 19px; background-color: transparent; float:left; padding: 12px 0 0 0; }
- menu ul {
float: left; list-style: none; }
- menu ul li {
background-color:transparent;
position:relative;
float:left; list-style: none; padding: 10px 20px 0 0;
font-weight: bold; width: auto;
}
- menu a {
color: #FFFFFF; display: inline; text-decoration: none; }
- menu a:visited {
color:#FFFFFF; text-decoration: none }
- menu a:hover {
color: #00a5ea; }
- menu ul li ul {
display: none; position: absolute; left: 0px;
width: 155px; heigth: 1%;
font-size: 19px; opacity: 0.8; list-style: none;
top: 30px; padding-top: 20px; z-index:500;
}
- menu ul li:hover ul {
display: inline;
background-position: bottom;
}
- menu ul li ul li {
width: 100%; list-style: none;
background-color: #000; margin: -1px; padding: 0px 0 0 5px; display: inline;
}
</style> <!-- </head> -->
<!-- ############################# BODY!!!!! #################################### -->
<!-- <body> --> <!--[if IE]> <style type="text/css">
- SubWrapper {width: 645px;}
- news {width: 317px;}
- super_main_wrapper {position:static;}
- navigation {left: 15px;}
- menu ul li ul {left: -2px; top: 22px;}
</style> <![endif]--> <div id="main_wrapper">
<div id="header">
<div id="navigation"> <div id="menu" style="position:static"> <ul> <li><a class="aMain" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo">Home</a></li> <li><a class="aTeam" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Team/Students">Team</a></li> <li><a class="aProject" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Project</a> <!-- <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/introduction">Introduction</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Model">Model</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Devices">Devices</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Modes">Modes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Results</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> </ul> --> <li><font color="#ffffff">Results</font> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Experiments</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Design</a></li> </ul></li> <!-- <li><a class="Simulation" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a class="DNA design" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Designs</a></li> --> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Protocols">Protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Lab.notebook">Notes</a></li> <li><a class="aNotebook" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sponsors/">Sponsors</a></li> <li><a class="aSitemap" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sitemap">Sitemap</a></li>
</ul> </div><!-- end drop menu --> </div> <!-- end navigation --> </div> </div> <!-- For IE 6 --> <script type="text/javascript">
/***********************************************
- CSS Vertical List Menu- by JavaScript Kit (www.javascriptkit.com)
- Menu interface credits: http://www.dynamicdrive.com/style/csslibrary/item/glossy-vertical-menu/
- This notice must stay intact for usage
- Visit JavaScript Kit at http://www.javascriptkit.com/ for this script and 100s more
- /
var menuids=new Array("verticalmenu") //Enter id(s) of UL menus, separated by commas var submenuoffset=-2 //Offset of submenus from main menu. Default is -2 pixels.
function createcssmenu(){ for (var i=0; i<menuids.length; i++){
var ultags=document.getElementById(menuids[i]).getElementsByTagName("ul") for (var t=0; t<ultags.length; t++){ var spanref=document.createElement("span")
spanref.className="arrowdiv" spanref.innerHTML=" " ultags[t].parentNode.getElementsByTagName("a")[0].appendChild(spanref)
ultags[t].parentNode.onmouseover=function(){ this.getElementsByTagName("ul")[0].style.left=this.parentNode.offsetWidth+submenuoffset+"px" this.getElementsByTagName("ul")[0].style.display="block" } ultags[t].parentNode.onmouseout=function(){ this.getElementsByTagName("ul")[0].style.display="none" } } }
}
if (window.addEventListener)
window.addEventListener("load", createcssmenu, false)
else if (window.attachEvent)
window.attachEvent("onload", createcssmenu)
</script>
<!-- </body> -->
</html>
DNA design
Abstract
- To achieve three mode of DNA ciliate, we designed five types of DNA arrangements.
- Five types of DNA are followings. First is "deoxyribozyme" which is attached to DNA ciliate body. Second is "substrate" which is attached to a glass plate as a scaffold of the track walking mode. Third is "UV-switching DNA" which is used for UV-switching system. Forth is "blocking DNA" which is also used for UV-switching system. Fifth is "complementary strand for deoxyribozyme". Especially, the third DNA, "UV-switching DNA" is the DNA strand which we designed only by ourselves.
- We could check that all these five types of DNA strand work as we expected. This is worthy of special mention.
- In this page, we explain five types of DNA strands which we designed.The results of checking DNA’s work by experimentation are [here].
Deoxyribozyme
|
Substrate
|
UV-switching DNA
- 5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG TTTTT CT X CT X TC-3' (X means azobenzene. )
- Size: 48bases + 2azobenzenes
- UV-switching DNA is used for the scaffold in light-irradiated gathering mode. We designed this DNA by ourselves. UV-switching DNA has a five bases’ loop (TTTTT) and there are two azobenzenes (X) in the one side of the stem (CTXCTXCT).
- By spotting UV, azobenzenes are isomerized (trans to cis), so the part which contains azobenzenes becomes hard to form double strand. It is known that UV-switching can be realized by using this principle. (ref)
- To achieve this switching, it is necessary to design the stem which forms the loop firmly in the room temperature and opens the loop by isomerizing of two azobenzenes. We didn’t find the precedent which succeeded in opening and closing at a single molecular by azobenzenes which are inserted into a stem, so the designing is very difficult. After trial and error, we designed to use “GAAGAG” and “CTXCTXCT” as the stem and “TTTTT” as the loop.
- The 7th to 37th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) is a complete complementary part for the deoxyribozyme. In addition, the 7th to 31th bases from 5’ end (TTTTCACTATTTCGACCGGCTCGGA) are a complementary part for blocking DNA. Consequently, the 32th to 37th bases from 5’ end (GAAGAG) are a complementary part for deoxyriboyme and not a complementary part for blocking DNA, so branch migration is started from this part and blocking DNA is released. Moreover, these 6 bases are a part which makes stem, so this part is blocked when the loop is closed. By this structure, branch migration doesn’t happen when the loop is formed.
- We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. As a result, we decide using this linker
- The 5' end is aminated to be fixed on a glass plate.
Blocking DNA
|
Complementary DNA for deoxyribozyme
|