Biomod/2011/Slovenia/BioNanoWizards/methmodifications: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(New page: <html> <head> <style> #globalWrapper {width: 1000px; padding:0; border:0; margin:0 auto 0 auto;} @media screen { body { background: #E3E3E3 0 0 0 0 no-repeat; /* changed default backgrou...)
 
No edit summary
 
(11 intermediate revisions by 3 users not shown)
Line 489: Line 489:


<big><big><span
<big><big><span
  style="color: black; font-weight: bold;">ZINC FINGER PROTEIN BINDING STAPLES:</span></big></big>
  style="color: black; font-weight: bold;">Zinc finger protein binding staples</span></big></big>


<br><br>
<br><br>
Line 498: Line 498:
<br><br>
<br><br>


<table border="1px" width="75%">
<table style="text-align: left; width: 75%;" border="1"
cellpadding="2" cellspacing="0">
   <tbody>
   <tbody>
     <tr>
     <tr>
Line 529: Line 530:
<table width="75%">
<table width="75%">
     <tr>
     <tr>
       <td>*Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
       <td>* Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
     </tr>
     </tr>
</table>
</table>
<br>
<br><br>


<big><big><span
<big><big><span
  style="color: black; font-weight: bold;">Type A and type B hairpins:</span></big></big>
  style="color: black; font-weight: bold;">Type A and type B hairpins</span></big></big>


<br><br>
<br><br>
Line 550: Line 551:
   <tbody>
   <tbody>
     <tr>
     <tr>
       <td style="text-align: center;"><img
       <td style="text-align: left;"><img
  style="font-family: Arial; width: 890px; height: 267px; padding: 0 0 10px 0;" alt=""
  style="font-family: Arial; width: 890px; height: 267px; padding: 0 0 10px 0;" alt=""
  src="http://openwetware.org/images/6/6e/Slika10.png"></td>
  src="http://openwetware.org/images/6/6e/Slika10.png"></td>
     </tr>
     </tr>
     <tr style="font-family: Arial; font-weight: bold;">
     <tr style="font-family: Arial; font-weight: bold;">
       <td style="text-align: justify;">Figure 1: Type A and B hairpins. <span
       <td style="text-align: justify;">Figure 45: Type A and B hairpins. <span
  style="font-weight: normal;">Target DNA sequences depicted are binding sites for 2C7 zinc finger protein.</span></td>
  style="font-weight: normal;">Target DNA sequences depicted are binding sites for 2C7 zinc finger protein.<br><br></span></td>
     </tr>
     </tr>
   </tbody>
   </tbody>
</table>
</table>
<br>
 


<big><big><span
<big><big><span
  style="color: black; font-weight: bold;">Type C hairpin:</span></big></big>
  style="color: black; font-weight: bold;"><br>Type C hairpin</span></big></big>


<br><br>
<br><br>


<span style="font-family: Arial;">
<span style="font-family: Arial">
Type C hairpins were inspired by Rothemund's original dumbbell staple strand design (Rothemund, Nature 2006). We speculated we might have to bind chimeric zinc fingers more rigidly to the surface of DNA origami to achieve higher contrasting with the AFM. The main difference between type A/B and type C design is the position of the binding DNA helix relative to DNA origami rectangle. The DNA helix is perpendicular in the former design and parallel to the rectangle in the latter.
Type C hairpins were inspired by Rothemund's original dumbbell staple strand design (Rothemund, Nature 2006). We speculated we might have to bind chimeric zinc fingers more rigidly to the surface of DNA origami to achieve higher contrasting with the AFM. The main difference between type A/B and type C design is the position of the binding DNA helix relative to DNA origami rectangle. The DNA helix is perpendicular in the former design and parallel to the rectangle in the latter.
</span>
</span>
<br><br>
<br><br>


<br>
<big><big><span
style="color: black; font-weight: bold;">DNA tethers for DNA origami stacking</span></big></big>
<br><br>
<table
<table
  style="margin-top: 3px; margin-bottom: 20px; float: right; width: 100%; height: 50px;"
  style="margin: 3px 0px 15px 30px; float: right; width: 460px; height: 50px;"
  border="0" cellpadding="0" cellspacing="0">
  border="0" cellpadding="0" cellspacing="0">
   <tbody>
   <tbody>
Line 582: Line 590:
     </tr>
     </tr>
     <tr style="font-family: Arial; font-weight: bold;">
     <tr style="font-family: Arial; font-weight: bold;">
       <td style="text-align: justify;">Figure 2: Type C hairpin <span
       <td style="text-align: justify;">Figure 46: Type C hairpin <span
  style="font-weight: normal;"></span></td>
  style="font-weight: normal;"></span></td>
     </tr>
     </tr>
   </tbody>
   </tbody>
</table>
</table>
<br>
<big><big><span
style="color: black; font-weight: bold;">DNA TETHERS FOR DNA ORIGAMI STACKING:</span></big></big>
<br><br>
<span style="font-family: Arial;">
<span style="font-family: Arial;">
Using DNASequenceGenerator_v1.01b we designed the first set of ten unique binding sequences that were 20 bp long. The pool of sequences, which served as a reference for unique sequence calculations contained 216 standard staple strands used for construction of DNA origami rectangle. The uniqueness was set to be 7, which means that any heptad or higher (and its complementary sequence) should not be contained either in the pool of standard staple (and their complementary strands) either in the binding strands already generated and added to the pool. These unique staple strands were added to the 3' termini of sequences of selected staple strands, except when stated otherwise. The first set of binding sequences protrudes from the rectangle in the upward direction.
Using DNASequenceGenerator_v1.01b we designed the first set of ten unique binding sequences that were 20 bp long. The pool of sequences, which served as a reference for unique sequence calculations contained 216 standard staple strands used for construction of DNA origami rectangle. The uniqueness was set to be 7, which means that any heptad or higher (and its complementary sequence) should not be contained either in the pool of standard staple (and their complementary strands) either in the binding strands already generated and added to the pool. These unique staple strands were added to the 3' termini of sequences of selected staple strands, except when stated otherwise. The first set of binding sequences protrudes from the rectangle in the upward direction.
</span>
</span>


<br><br>
<br><br><br>


<table border="1px" width="75%">
<table style="text-align: left; width: 100%;" border="1"
cellpadding="2" cellspacing="0">
   <tbody>
   <tbody>
<tr><th style="font-weight: bold;">Sequence position in the
<tr><th style="font-weight: bold;">Sequence position in the
Line 606: Line 608:
generated binding sequences</th></tr>
generated binding sequences</th></tr>
<tr><td>Aa3 </td><td style="font-family: Courier">5' ctatcttcgactctcgattc 3'</td></tr>
<tr><td>Aa3 </td><td style="font-family: Courier">5' ctatcttcgactctcgattc 3'</td></tr>
<tr><td>AS1 </td><td style="font-family: Courier">5' cgagcgtccattgagttata 3'</th></tr>
<tr><td>AS1 </td><td style="font-family: Courier">5' cgagcgtccattgagttata 3'</td></tr>
<tr><td>Af3 </td><td style="font-family: Courier">5' ggtgttgcacgatacatacc 3'</td></tr>
<tr><td>Af3 </td><td style="font-family: Courier">5' ggtgttgcacgatacatacc 3'</td></tr>
<tr><td>Cb3 </td><td style="font-family: Courier">5' cctgcatcacatctagcttc 3'</th></tr>
<tr><td>Cb3 </td><td style="font-family: Courier">5' cctgcatcacatctagcttc 3'</td></tr>
<tr><td>CS1 </td><td style="font-family: Courier">5' gggaggccaaattaggatat 3'</td></tr>
<tr><td>CS1 </td><td style="font-family: Courier">5' gggaggccaaattaggatat 3'</td></tr>
<tr><td>CS4*</td><td style="font-family: Courier">5' gtagcactaagaaggcttgt 3'</th></tr>
<tr><td>CS4*</td><td style="font-family: Courier">5' gtagcactaagaaggcttgt 3'</td></tr>
<tr><td>Ce3 </td><td style="font-family: Courier">5' catacaccacaagaccactc 3'</td></tr>
<tr><td>Ce3 </td><td style="font-family: Courier">5' catacaccacaagaccactc 3'</td></tr>
<tr><td>Ea1 </td><td style="font-family: Courier">5' gcgtatagctgtataatggc 3'</th></tr>
<tr><td>Ea1 </td><td style="font-family: Courier">5' gcgtatagctgtataatggc 3'</td></tr>
<tr><td>ES4*</td><td style="font-family: Courier">5' cgatgctctcaggctattag 3'</td></tr>
<tr><td>ES4*</td><td style="font-family: Courier">5' cgatgctctcaggctattag 3'</td></tr>
<tr><td>Ef1 </td><td style="font-family: Courier">5' ggaattgctcaactattcgc 3'</th></tr>
<tr><td>Ef1 </td><td style="font-family: Courier">5' ggaattgctcaactattcgc 3'</td></tr>
</tbody>
</tbody>
</table>
</table>
<table width="75%">
<table width="75%">
     <tr>
     <tr>
       <td>*Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
       <td>* Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
     </tr>
     </tr>
</table>
</table>


<br>
<br><br>


After generating the first set of binding sequences we determined the set of complementary binding staples. Positions within the model were chosen such to allow for rectangles in the same spatial orientation to stack on top of each other. For this purpose we also had to be sure for the complementary sets of binding sequences to project from the rectangle on the opposite site as the first set. Staple strands at selected positions were divided in halves. The first halves were elongated with appropriate binding staples complementary to the first set at 3'-terminus, except when stated otherwise. The second halves were added to fill up the gaps that remained.
After generating the first set of binding sequences we determined the set of complementary binding staples. Positions within the model were chosen such to allow for rectangles in the same spatial orientation to stack on top of each other. For this purpose we also had to be sure for the complementary sets of binding sequences to project from the rectangle on the opposite site as the first set. Staple strands at selected positions were divided in halves. The first halves were elongated with appropriate binding staples complementary to the first set at 3'-terminus, except when stated otherwise. The second halves were added to fill up the gaps that remained.
<br><br>
<br><br>


<table border="1px" width="75%">
<table style="text-align: left; width: 100%;" border="1"
cellpadding="2" cellspacing="0">
   <tbody>
   <tbody>
<tr><th style=”font-weight: bold;”>Sequence position in the
<tr><th style=”font-weight: bold;”>Sequence position in the
DNA origami model </th><th style=”font-weight: bold;”>Nucleotide sequence of
DNA origami model </th><th style=”font-weight: bold;”>Nucleotide sequence of
generated binding sequences</th></tr>
generated binding sequences</th></tr>
<tr><td>Ba1 </td><td>5' gaatcgagagtcgaagatag 3'</td></tr>
<tr><td>Ba1 </td><td style="font-family: Courier">5' gaatcgagagtcgaagatag 3'</td></tr>
<tr><td>AS5 </td><td>5' tataactcaatggacgctcg 3'</th></tr>
<tr><td>AS5 </td><td style="font-family: Courier">5' tataactcaatggacgctcg 3'</td></tr>
<tr><td>Bf1 </td><td>5' ggtatgtatcgtgcaacacc 3'</td></tr>
<tr><td>Bf1 </td><td style="font-family: Courier">5' ggtatgtatcgtgcaacacc 3'</td></tr>
<tr><td>Db1 </td><td>5' gaagctagatgtgatgcagg 3'</th></tr>
<tr><td>Db1 </td><td style="font-family: Courier">5' gaagctagatgtgatgcagg 3'</td></tr>
<tr><td>CS5 </td><td>5' atatcctaatttggcctccc 3'</td></tr>
<tr><td>CS5 </td><td style="font-family: Courier">5' atatcctaatttggcctccc 3'</td></tr>
<tr><td>CS8* </td><td>5' acaagccttcttagtgctac 3'</th></tr>
<tr><td>CS8* </td><td style="font-family: Courier">5' acaagccttcttagtgctac 3'</td></tr>
<tr><td>De1 </td><td>5' gagtggtcttgtggtgtatg 3'</td></tr>
<tr><td>De1 </td><td style="font-family: Courier">5' gagtggtcttgtggtgtatg 3'</td></tr>
<tr><td>Ea3 </td><td>5' gagtggtcttgtggtgtatg 3'</th></tr>
<tr><td>Ea3 </td><td style="font-family: Courier">5' gagtggtcttgtggtgtatg 3'</th></tr>
<tr><td>ES8* </td><td>5' ctaatagcctgagagcatcg 3'</td></tr>
<tr><td>ES8* </td><td style="font-family: Courier">5' ctaatagcctgagagcatcg 3'</td></tr>
<tr><td>Ef3 </td><td>5' gcgaatagttgagcaattcc 3'</th></tr>
<tr><td>Ef3 </td><td style="font-family: Courier">5' gcgaatagttgagcaattcc 3'</td></tr>
</tbody>
</tbody>
</table>
</table>
Line 652: Line 655:
   <tbody>
   <tbody>
     <tr>
     <tr>
       <td style="text-align: center;"><img
       <td style="text-align: left;"><img
  style="font-family: Arial; width: 608px; height: 743px; padding: 0 0 10px 0;" alt=""
  style="font-family: Arial; width: 608px; height: 743px; padding: 0 0 10px 0;" alt=""
  src="http://openwetware.org/images/d/d5/Slika12.png"></td>
  src="http://openwetware.org/images/d/d5/Slika12.png"></td>
     </tr>
     </tr>
     <tr style="font-family: Arial; font-weight: bold;">
     <tr style="font-family: Arial; font-weight: bold">
       <td style="text-align: justify;">Figure 1: Type A and B hairpins. <span
       <td style="text-align: justify;">
  style="font-weight: normal;">Target DNA sequences depicted are binding sites for 2C7 zinc finger protein.</span></td>
      Figure 47: Arrangement of 10 binding staples on the opposing faces of DNA origami rectangle. <span
  style="font-weight: normal;">Asymmetric arrangement decreases the likelihood of staggered overlay.</span></td>
     </tr>
     </tr>
   </tbody>
   </tbody>
</table>
</table>
<br>
<br>


</div>
</div>
Line 679: Line 684:
     <tr>
     <tr>
       <td style="text-align: right;"><a
       <td style="text-align: right;"><a
  href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultssolublezfp"><img
  href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methgeneraldesignstrategy"><img
  alt="" style="border: 0px solid ; width: 132px; height: 39px;"
  alt="" style="border: 0px solid ; width: 132px; height: 39px;"
  src="http://openwetware.org/images/d/d3/Previousblue.JPG"></a></td>
  src="http://openwetware.org/images/d/d3/Previousblue.JPG"></a></td>
       <td style="text-align: left;"><a
       <td style="text-align: left;"><a
  href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultsfunctionalizedzfp"><img
  href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methplasmidconst"><img
  alt="" style="border: 0px solid ; width: 132px; height: 39px;"
  alt="" style="border: 0px solid ; width: 132px; height: 39px;"
  src="http://openwetware.org/images/6/69/Nextblue.JPG"></a></td>
  src="http://openwetware.org/images/6/69/Nextblue.JPG"></a></td>

Latest revision as of 16:09, 2 November 2011

<html> <head> 

 <style>
  1. globalWrapper {width: 1000px; padding:0; border:0; margin:0 auto 0 auto;}

@media screen { body { background: #E3E3E3 0 0 0 0 no-repeat; /* changed default background */ } }

  1. column-one {display:none; width:0px;}
  2. contentSub {display:none; width:0px;}
  3. column-content {border:0px; width: 1000px; padding:0; margin:0;}

.firstHeading {display:none;}

  1. footer {display:none;}
  2. content {background-color: #e3e3e3; border:0; padding:0; margin:0;}
  3. bodyContent {background: none; border:0x; padding0; margin:0;}
  4. header{display:none;}
 </style>
 <style type="text/css">

/* Design by Free CSS Templates http://www.freecsstemplates.org Released for free under a Creative Commons Attribution 2.5 License

  • /

body { margin: 0; padding:0; background: #E3E3E3; font-family: Arial, Helvetica, sans-serif; font-size: 12px; color: #616161; } p, ul, ol { margin-top: 0; line-height: 180%; } ul, ol { } a { text-decoration: none; color: #274775; } a:hover { }

  1. wrapper {

margin: 0 auto; padding: 0; } .container { width: 1000px; margin: 0px auto; } /* Header */

  1. headercss {

width: 900px; height: 150px; margin: 0 auto; padding: 0px 50px; background: url(http://openwetware.org/images/c/cc/Img01.PNG) no-repeat left top; position: relative; z-index:10; } /* Logo */

  1. logo {

width: 800px; margin: 0 0 0 0; padding: 30px 0 0 0; }

  1. logolinknabiomod {

width: 800px; margin: 0 0 0 0; padding: 0 0 0 0; }

  1. logolinknabiomod h1, #logo p {

}

  1. logolinknabiomod h1 {

padding: 60px 0px 0px 0px; letter-spacing: -2px; font-size: 3.8em; background: none; }

  1. logolinknabiomod p {

margin: 0 0 0 0; padding: 0 0 0 0; letter-spacing: -1px; font: normal 14px Georgia, "Times New Roman", Times, serif; font-style: normal; color: #8e8e8e; } #logolinknabiomod p a { color: #8E8E8E; }

  1. logolinknabiomod a {

border: none; background: none; text-decoration: none; } /* Splash */

  1. splash {

height: 300px; } /* Menu */ /* Page */

  1. page {

width: 890px; margin: 0 auto; padding: 30px 55px; background: url(http://openwetware.org/images/e/e6/Lepidimg03.jpg) repeat-y left top; } /* Content */

  1. content {

float: left; width: 890px; padding: 0px 0px 0px 0px; background: none; } .post .entry { text-align: justify; font: Arial; letter-spacing: 0px; z-index:5; } /* Three Column Footer Content */

  1. footer-content {

background: url(http://openwetware.org/images/e/e3/Img04brezcrne.JPG) repeat-y left top; color: #BFBFBF; }

  1. footer-bg {

overflow: hidden; width: 890px; padding: 10px 55px 80px 55px; background: url(http://openwetware.org/images/0/06/Footerbrezozadja.jpg) no-repeat left bottom; }

  1. footer-content h2 {

margin: 0px; padding: 0px 0px 20px 0px; letter-spacing: -1px; text-transform: lowercase; font-size: 26px; color: #202020; }

  1. footer-content ul {

margin: 0px; padding: 0px 0px 0px 0px; }

  1. footer-content a {

color: #447ECF; }

  1. column1 {

float: left; width: 423px; margin: 0px 0px 0px 0px; text-align: justify; }

  1. column2 {

float: right; width: 423px; margin: 0px 0px 0px 0px; text-align: justify; } /* Footer */

  1. footerCSS {

height: 20px; width: 600px; padding: 0px 200px 0px 200px; font-family: Arial, Helvetica, sans-serif; }

  1. footerCSS p {

margin: 0; padding-top: 0px; line-height: normal; font-size: 9px; text-align: center; color: #202020; }

  1. footerCSS a {

color: #202020; }

  1. marketing {

overflow: hidden; margin-bottom: 30px; padding: 20px 0px 10px 0px; border-top: 1px solid #E3E3E3; border-bottom: 1px solid #E3E3E3; }

  1. marketing .text1 {

float: left; margin: 0px; padding: 0 0 0 100px; font-size: 34px; color: #345E9B; }

  1. marketing .text2 {

float: right; }

  1. marketing .text2 a {

display: block; width: 252px; height: 38px; padding: 15px 100px 0px 0px; background: url(http://openwetware.org/images/f/f4/Lepidimg07.jpg) no-repeat left top; letter-spacing: -2px; text-align: center; font-size: 30px; color: #ffffff; }

  1. jebenimeni {

width: 800px; height: 30px; padding: 45px 0 0 0;} <!-- Start PureCSSMenu.com STYLE -->

  1. pcm{display:none;}

ul.pureCssMenu ul{display:none} ul.pureCssMenu li:hover>ul{display:block} ul.pureCssMenu ul{position: absolute;left:-1px;top:98%;} ul.pureCssMenu ul ul{position: absolute;left:98%;top:-2px;} ul.pureCssMenu,ul.pureCssMenu ul { margin:0px; list-style:none; padding:0px 2px 2px 0px; background-color:#2A4B7D; background-repeat:repeat; border-color:#cccccc #111111 #111111 #cccccc; border-width:1px; border-style:solid; } ul.pureCssMenu table {border-collapse:collapse}ul.pureCssMenu { display:block; zoom:1; float: left; } ul.pureCssMenu ul{ width:260.40000000000003px; } ul.pureCssMenu li{ display:block; margin:2px 0px 0px 2px; font-size:0px; } ul.pureCssMenu a:active, ul.pureCssMenu a:focus { outline-style:none; } ul.pureCssMenu a, ul.pureCssMenu li.dis a:hover, ul.pureCssMenu li.sep a:hover { display:block; vertical-align:middle; background-color:#2A4B7D; border-width:1px; border-color:#2A4B7D; border-style:solid; text-align:left; text-decoration:none; padding:2px 5px 2px 10px; _padding-left:0; font:16px Trebuchet MS; color: #ffffff; text-decoration:none; cursor:default; } ul.pureCssMenu span{ overflow:hidden; } ul.pureCssMenu li { float:left; } ul.pureCssMenu ul li { float:none; } ul.pureCssMenu ul a { text-align:left; white-space:nowrap; } ul.pureCssMenu li.sep{ text-align:left; padding:0px; line-height:0; height:100%; } ul.pureCssMenu li.sep span{ float:none; padding-right:0; width:3px; height:100%; display:inline-block; background-color:#cccccc #111111 #111111 #cccccc; background-image:none;} ul.pureCssMenu ul li.sep span{ width:100%; height:3px; } ul.pureCssMenu li:hover{ position:relative; } ul.pureCssMenu li:hover>a{ background-color:#377D9F; border-color:#377D9F; border-style:solid; font:16px Trebuchet MS; color: #FFFFFF; text-decoration:none; } ul.pureCssMenu li a:hover{ position:relative; background-color:#377D9F; border-color:#377D9F; border-style:solid; font:16px Trebuchet MS; color: #FFFFFF; text-decoration:none; } ul.pureCssMenu li.dis a { color: #666 !important; } ul.pureCssMenu img {border: none;float:left;_float:none;margin-right:2px;width:16px; height:16px; } ul.pureCssMenu ul img {width:16px; height:16px; } ul.pureCssMenu img.over{display:none} ul.pureCssMenu li.dis a:hover img.over{display:none !important} ul.pureCssMenu li.dis a:hover img.def {display:inline !important} ul.pureCssMenu li:hover > a img.def {display:none} ul.pureCssMenu li:hover > a img.over {display:inline} ul.pureCssMenu a:hover img.over,ul.pureCssMenu a:hover ul img.def,ul.pureCssMenu a:hover a:hover ul img.def,ul.pureCssMenu a:hover a:hover img.over,ul.pureCssMenu a:hover a:hover a:hover img.over{display:inline} ul.pureCssMenu a:hover img.def,ul.pureCssMenu a:hover ul img.over,ul.pureCssMenu a:hover a:hover ul img.over,ul.pureCssMenu a:hover a:hover img.def,ul.pureCssMenu a:hover a:hover a:hover img.def{display:none} ul.pureCssMenu a:hover ul,ul.pureCssMenu a:hover a:hover ul{display:block} ul.pureCssMenu a:hover ul ul{display:none} ul.pureCssMenu span{ display:block; background-image:url(http://openwetware.org/images/5/50/Arr_white.gif); background-position:right center; background-repeat: no-repeat; padding-right:12px;} ul.pureCssMenu li:hover>a>span{ background-image:url(http://openwetware.org/images/6/6f/Arrv_white.gif); } ul.pureCssMenu a:hover span{ _background-image:url(http://openwetware.org/images/6/6f/Arrv_white.gif)} ul.pureCssMenu ul span,ul.pureCssMenu a:hover table span{background-image:url(http://openwetware.org/images/5/50/Arr_white.gif)} <!-- End PureCSSMenu.com STYLE --> 

 </style>

</head> <body> <div id="wrapper"> <div id="headercss" class="container"> <div id="logo"> <div id="logolinknabiomod"> <p><a href="http://openwetware.org/wiki/Biomod/2011">&lt;-- Back to BioMod 2011</a></p> </div> <div id="jebenimeni"> <!-- Start PureCSSMenu.com MENU --> <ul class="pureCssMenu pureCssMenum"> 

 <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards">Home</a></li>
 <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Idea</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
   <ul class="pureCssMenum">
     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/ideastateoftheart">State

of the art</a></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/ideaproteinaddons">Protein

add-ons</a></li> <!-- TUKI SEM IZBRISAL PROTEIN CHIMERAS --> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/ideaverticalstacks">Vertical

stacks</a></li> 

   </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

 <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Results</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
   <ul class="pureCssMenum">
     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultssummary">Summary</a></li>
     <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Protein add-ons</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
       <ul class="pureCssMenum">
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultssolublezfp">Soluble

ZFPs</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultstightbindingzfp">Tight

binding ZFPs</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultsfunctionalizedzfp">Functionalized

ZFPs</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/protdnahybrid">Protein-DNA

origami hybrid</a></li> 

       </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Vertical stacks</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
       <ul class="pureCssMenum">
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultsdnatethers">DNA

tethers</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/resultsproteintethers">Protein

tethers</a></li> 

       </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

   </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

 <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Discussion</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
   <ul class="pureCssMenum">
     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/discussion">Discussion</a></li>
     <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Applications</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
       <ul class="pureCssMenum">
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/applabonchip">Lab-on-a-nanochip</a></li>
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/appbiosynthteticcompartments">Biosynthetic

compartments</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/appbiosensors">Biosensors</a></li>
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/appnanoelectronics">Nanoelectronics</a></li>
       </ul>
     </li>
   </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

 <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Methods</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
   <ul class="pureCssMenum">
     <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>DNA origami design</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
       <ul class="pureCssMenum">
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methgeneraldesignstrategy">General

design strategy</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methmodifications%20">Modifications</a></li>
       </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methplasmidconst">Plasmid

construction</a></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methprotprodandisol">Protein

production and isolation</a></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="#"><span>Protein characterization</span></a><!--[if lte IE 6]><table><tr><td><![endif]-->
       <ul class="pureCssMenum">
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methemsa">EMSA</a></li>
         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methalphascreen">AlphaScreen

assay</a></li> 

         <li class="pureCssMenui"><a
class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methbret">BRET

assay</a></li> 

       </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methafm">AFM</a></li>
     <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methtimeline">Timeline</a></li>
   </ul>

<!--[if lte IE 6]></td></tr></table></a><![endif]--></li> 

 <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/team">Team</a></li>
 <li class="pureCssMenui"><a class="pureCssMenui"
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/acknowledgments">Acknowledgments</a></li>

</ul> <!-- End PureCSSMenu.com MENU --> </div> </div> </div> <!-- end #header --> <div id="page" class="container"> <div id="content"> <div class="post"> <div class="entry"><big><big><big><big><span 

style="color: black; font-weight: bold;">Modifications</span></big></big></big></big>

<br> <br> <br>

<big><big><span 

style="color: black; font-weight: bold;">Zinc finger protein binding staples</span></big></big>

<br><br> <span style="font-family: Arial;"> Basic guideline of our approach was to avoid unnecessary use of covalent modifications of staple strands intended for DNA origami functionalization, which is the main advantage of our protein DNA origami add-ons approach. We achieved positional control of zinc finger binding proteins through replacement of appropriate standard staples with such that contained additional nucleotide sequences, which did not anneal to single stranded M13 mp18 DNA but formed double stranded DNA hairpins. These hairpins contained zinc finger protein variants target sequences. We prepared three types of hairpins: type A, B and C. Type A and type B hairpins are essentially the same but they form on opposite sides of DNA rectangle. Such design was intended for the formation of multiple layered stacks using protein tethers. Additionally we designed special dumbbell staples with which we wanted to make the binding of the protein on the surface of DNA origami more rigid. </span>

<br><br>

<table style="text-align: left; width: 75%;" border="1" 

cellpadding="2" cellspacing="0">
 <tbody>
   <tr>
     <th style="font-weight: bold;">Zinc finger protein</th>
     <th style="font-weight: bold;">Target DNA sequence</th>
     <th style="font-weight: bold;">Target sequence length [bp]</th>
   </tr>
   <tr>
     <td>Zif268 variants*</td>
     <td style="font-family: Courier">5' gcgtgggcg 3'</td>
     <td>9</td>
   </tr>
   <tr>
     <td>6F6</td>
     <td style="font-family: Courier">5' gatcgggcggtaatgagat 3'</td>
     <td>19</td>
   </tr>
   <tr>
     <td>2C7</td>
     <td style="font-family: Courier">5' gcgtgggcggcgtgggcg 3'</td>
     <td>18</td>
   </tr>
   <tr>
     <td>AZPA4</td>
     <td style="font-family: Courier">5' gcgtgggcggcgtgggcg 3'</td>
     <td>18</td>
   </tr>
 <tbody>

</table> <table width="75%"> 

   <tr>
     <td>* Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
   </tr>

</table> <br><br>

<big><big><span 

style="color: black; font-weight: bold;">Type A and type B hairpins</span></big></big>

<br><br>

<span style="font-family: Arial;"> Both A and B type hairpins are inverted repeats of ZFP target DNA sequences that fold onto themselves. The difference between types A and B is in the position of binding sequence within the staple strand. Type A hairpins are positioned at 3'-terminus of staple strands, whereas type B hairpins are integrated in the middle of staple strands. We included thymines at positions where steric hinderance might pose a problem. </span>

<br><br>

<table 

style="margin-top: 3px; margin-bottom: 20px; float: left; width: 100%; height: 50px;"
border="0" cellpadding="0" cellspacing="0">
 <tbody>
   <tr>
     <td style="text-align: left;"><img
style="font-family: Arial; width: 890px; height: 267px; padding: 0 0 10px 0;" alt=""
src="http://openwetware.org/images/6/6e/Slika10.png"></td>
   </tr>
   <tr style="font-family: Arial; font-weight: bold;">
     <td style="text-align: justify;">Figure 45: Type A and B hairpins. <span
style="font-weight: normal;">Target DNA sequences depicted are binding sites for 2C7 zinc finger protein.<br><br></span></td>
   </tr>
 </tbody>

</table>


<big><big><span 

style="color: black; font-weight: bold;"><br>Type C hairpin</span></big></big>

<br><br>

<span style="font-family: Arial"> Type C hairpins were inspired by Rothemund's original dumbbell staple strand design (Rothemund, Nature 2006). We speculated we might have to bind chimeric zinc fingers more rigidly to the surface of DNA origami to achieve higher contrasting with the AFM. The main difference between type A/B and type C design is the position of the binding DNA helix relative to DNA origami rectangle. The DNA helix is perpendicular in the former design and parallel to the rectangle in the latter. </span> <br><br>


<br>

<big><big><span 

style="color: black; font-weight: bold;">DNA tethers for DNA origami stacking</span></big></big>

<br><br> <table 

style="margin: 3px 0px 15px 30px; float: right; width: 460px; height: 50px;"
border="0" cellpadding="0" cellspacing="0">
 <tbody>
   <tr>
     <td style="text-align: center;"><img
style="font-family: Arial; width: 460px; height: 275px; padding: 0 0 10px 0;" alt=""
src="http://openwetware.org/images/1/1e/Slika11.png"></td>
   </tr>
   <tr style="font-family: Arial; font-weight: bold;">
     <td style="text-align: justify;">Figure 46: Type C hairpin <span
style="font-weight: normal;"></span></td>
   </tr>
 </tbody>

</table> <span style="font-family: Arial;"> Using DNASequenceGenerator_v1.01b we designed the first set of ten unique binding sequences that were 20 bp long. The pool of sequences, which served as a reference for unique sequence calculations contained 216 standard staple strands used for construction of DNA origami rectangle. The uniqueness was set to be 7, which means that any heptad or higher (and its complementary sequence) should not be contained either in the pool of standard staple (and their complementary strands) either in the binding strands already generated and added to the pool. These unique staple strands were added to the 3' termini of sequences of selected staple strands, except when stated otherwise. The first set of binding sequences protrudes from the rectangle in the upward direction. </span>

<br><br><br>

<table style="text-align: left; width: 100%;" border="1" 

cellpadding="2" cellspacing="0">
 <tbody>

<tr><th style="font-weight: bold;">Sequence position in the DNA origami model</th><th style="font-weight: bold;">Nucleotide sequence of generated binding sequences</th></tr> <tr><td>Aa3 </td><td style="font-family: Courier">5' ctatcttcgactctcgattc 3'</td></tr> <tr><td>AS1 </td><td style="font-family: Courier">5' cgagcgtccattgagttata 3'</td></tr> <tr><td>Af3 </td><td style="font-family: Courier">5' ggtgttgcacgatacatacc 3'</td></tr> <tr><td>Cb3 </td><td style="font-family: Courier">5' cctgcatcacatctagcttc 3'</td></tr> <tr><td>CS1 </td><td style="font-family: Courier">5' gggaggccaaattaggatat 3'</td></tr> <tr><td>CS4*</td><td style="font-family: Courier">5' gtagcactaagaaggcttgt 3'</td></tr> <tr><td>Ce3 </td><td style="font-family: Courier">5' catacaccacaagaccactc 3'</td></tr> <tr><td>Ea1 </td><td style="font-family: Courier">5' gcgtatagctgtataatggc 3'</td></tr> <tr><td>ES4*</td><td style="font-family: Courier">5' cgatgctctcaggctattag 3'</td></tr> <tr><td>Ef1 </td><td style="font-family: Courier">5' ggaattgctcaactattcgc 3'</td></tr> </tbody> </table> <table width="75%"> 

   <tr>
     <td>* Soluble Zif268 variant is an "in-house" designed protein with amino acid that are not essential for binding substituted with charged amino acids to improve solubility.</td>
   </tr>

</table>

<br><br>

After generating the first set of binding sequences we determined the set of complementary binding staples. Positions within the model were chosen such to allow for rectangles in the same spatial orientation to stack on top of each other. For this purpose we also had to be sure for the complementary sets of binding sequences to project from the rectangle on the opposite site as the first set. Staple strands at selected positions were divided in halves. The first halves were elongated with appropriate binding staples complementary to the first set at 3'-terminus, except when stated otherwise. The second halves were added to fill up the gaps that remained. <br><br>

<table style="text-align: left; width: 100%;" border="1" 

cellpadding="2" cellspacing="0">
 <tbody>

<tr><th style=”font-weight: bold;”>Sequence position in the DNA origami model </th><th style=”font-weight: bold;”>Nucleotide sequence of generated binding sequences</th></tr> <tr><td>Ba1 </td><td style="font-family: Courier">5' gaatcgagagtcgaagatag 3'</td></tr> <tr><td>AS5 </td><td style="font-family: Courier">5' tataactcaatggacgctcg 3'</td></tr> <tr><td>Bf1 </td><td style="font-family: Courier">5' ggtatgtatcgtgcaacacc 3'</td></tr> <tr><td>Db1 </td><td style="font-family: Courier">5' gaagctagatgtgatgcagg 3'</td></tr> <tr><td>CS5 </td><td style="font-family: Courier">5' atatcctaatttggcctccc 3'</td></tr> <tr><td>CS8* </td><td style="font-family: Courier">5' acaagccttcttagtgctac 3'</td></tr> <tr><td>De1 </td><td style="font-family: Courier">5' gagtggtcttgtggtgtatg 3'</td></tr> <tr><td>Ea3 </td><td style="font-family: Courier">5' gagtggtcttgtggtgtatg 3'</th></tr> <tr><td>ES8* </td><td style="font-family: Courier">5' ctaatagcctgagagcatcg 3'</td></tr> <tr><td>Ef3 </td><td style="font-family: Courier">5' gcgaatagttgagcaattcc 3'</td></tr> </tbody> </table> <br><br>

<table 

style="margin-top: 3px; margin-bottom: 20px; float: left; width: 100%; height: 50px;"
border="0" cellpadding="0" cellspacing="0">
 <tbody>
   <tr>
     <td style="text-align: left;"><img
style="font-family: Arial; width: 608px; height: 743px; padding: 0 0 10px 0;" alt=""
src="http://openwetware.org/images/d/d5/Slika12.png"></td>
   </tr>
   <tr style="font-family: Arial; font-weight: bold">
     <td style="text-align: justify;">
      Figure 47: Arrangement of 10 binding staples on the opposing faces of DNA origami rectangle. <span
style="font-weight: normal;">Asymmetric arrangement decreases the likelihood of staggered overlay.</span></td>
   </tr>
 </tbody>

</table> <br>


</div> </div> </div> <!-- end #content --> <div style="clear: both;">&nbsp;</div> </div> <!-- end #page --></div> <div id="footer-content" class="container"> <div id="footer-bg"> <table 

style="width: 100%; text-align: left; margin-left: auto; margin-right: auto; margin-bottom:30px;"
border="0" cellpadding="2" cellspacing="2">
 <tbody>
   <tr>
     <td style="text-align: right;"><a
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methgeneraldesignstrategy"><img
alt="" style="border: 0px solid ; width: 132px; height: 39px;"
src="http://openwetware.org/images/d/d3/Previousblue.JPG"></a></td>
     <td style="text-align: left;"><a
href="http://openwetware.org/wiki/Biomod/2011/Slovenia/BioNanoWizards/methplasmidconst"><img
alt="" style="border: 0px solid ; width: 132px; height: 39px;"
src="http://openwetware.org/images/6/69/Nextblue.JPG"></a></td>
   </tr>
 </tbody>

</table>

</div> </div> <div id="footerCSS"> <p>BioNanoWizards - BioMod 2011 team Slovenia. Design by <a href="http://www.freecsstemplates.org/">Free CSS Templates</a>.</p> </div> <!-- end #footer --> </body> </html>

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Biomod/2011/Slovenia/BioNanoWizards/methmodifications&oldid=562326"