Biomod/2011/Caltech/DeoxyriboNucleicAwesome/Sequence Design

From OpenWetWare

< Biomod | 2011 | Caltech/DeoxyriboNucleicAwesome
Revision as of 12:53, 3 November 2011 by Shayan Doroudi (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search


Monday, January 26, 2015








Sequence Design


Design Process

After having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced.

After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences.

Detachers were strands that were meant to detach the corresponding strand from the origami, so we could test our results on origami using gel electrophoresis, but we decided to not run such experiments due to the potential difficulty of seeing bands corresponding to small strands of DNA when running origami in a gel. Additionally, we felt our other methods (fluorescence spectroscopy and atomic force microscopy) were sufficient for showing our mechanisms work on origami. Therefore, we have never used the detacher strands.

List of Domains

Probe Domains

The length of these sequences is 20 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')




† The lp domain is 27 nucleotides long.

Toehold Domains

The length of these sequences is 7 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')

† The a2' domain is a subset of the a2 domain and is 4 nucleotides long.
‡ Toeholds cgd and wgd are the same. This does not change the function of our system because they are never used in the same solution together.

Other Domains

The length of these sequences is 15 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')

List of Strands

  • The M13 scaffold was used to construct an origami.

A star(*) denotes the complement of a domain.

Strand Name Shorthand Abbreviation Domain Composition (5' → 3') Length Sequence (5' → 3')
Probe for Track 1 Ptr1 ptr1 54 CCAACTCAACCCATTTCATCTT - Staple
Probe for Track 2 Ptr2 ptr2 54 TACATACACCAACCTCCACCTT - Staple
Probe for Walker Goal Pwg wgd pwg 60 AGATGACCTCTTTCTTATCACTTCAATT - Staple

Walker Goal Detacher WGD pwg* wgd* 26 TTGAAGTGATAAGAAAGAGGTCATCT

Cargo Goal Inhibitor CGI x* cgi* 21 AATAGAAAGGAGATACAACAT



Staple sequences for the rectangular origami were from Rothemund, P. W. K. (2006).

Personal tools