Biomod/2011/Caltech/DeoxyriboNucleicAwesome/Sequence Design

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(List of Strands)
m (List of Strands)
Line 177: Line 177:
|-
|-
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Probe for Walker Goal  
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Probe for Walker Goal  
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Track 1
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Track 2
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Inhibitor
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Trigger
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Detacher<sub>1</sub>
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Detacher<sub>2</sub>
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Goal
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Walker Goal Detacher
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo Attacher
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Sub Cargo Attacher
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo 1
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo Goal 1
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Sub Cargo Goal
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo Goal Inhibitor
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCTCAAAACTTATCC
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGATAAGTTTTGAGG
 +
 +
|-
 +
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo Goal Trigger
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| b

Revision as of 14:13, 1 July 2011

Image:DeoxyriboNucleicAwesomeHeader.jpg

Wednesday, August 27, 2014

Home

Members

Project

Protocols

Progress

Discussion

References


Sequence Design

Contents

Design Process

After having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced.

After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences.

List of Domains

Probe Domains

The length of these sequences is 20 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')
Ptr1 CCAACTCAACCCATTTCATC GATGAAATGGGTTGAGTTGG
Ptr2 TACATACACCAACCTCCACC GGTGGAGGTTGGTGTATGTA
lp TTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAAAAA
upca ACCTTACCTCTCCCTAACTT AAGTTAGGGAGAGGTAAGGT
upcg ACTAACTCCTACCCACACCT AGGTGTGGGTAGGAGTTAGT
Pwg CCTCTTTCTTATCACTTCAA TTGAAGTGATAAGAAAGAGG

† The lp domain is 27 nucleotides long.


Toehold Domains

The length of these sequences is 7 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')
a1 CTCCTC GAGGAG
a2 ATCCAC GTGGAT
a2' ATCC GGAT
z AAAAAA TTTTTT
l CCATTC GAATGG
u ACACAC GTGTGT
wi GGTAAG CTTACC
cgi ATGTTG CAACAT
cgd AGATGA TCATCT
wgd AGATGA TCATCT

† The a2' domain is a subset of the a2 domain and is 4 nucleotides long.
‡ Toeholds cgd and wgd are the same. This does not change the function of our system because they are never used in the same solution together.


Other Domains

The length of these sequences is 15 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')
b CCTCAAAACTTATCC GGATAAGTTTTGAGG
x TATCTCCTTTCTATT AATAGAAAGGAGATA


List of Strands

UNDER CONSTRUCTION!!! - This information is currently incorrect and will be fixed shortly.

Strand Name Shorthand Abbreviation Domain Composition (5' → 3') Length Sequence (5' → 3')
Probe for Track 1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Probe for Track 2 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Probe for Cargo Attacher b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Probe for Cargo Goal1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Probe for Walker Goal b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Track 1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Track 2 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Inhibitor b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Trigger b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Detacher1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Detacher2 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Goal b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Walker Goal Detacher b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo Attacher b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Sub Cargo Attacher b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo 1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo Goal 1 b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Sub Cargo Goal b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo Goal Inhibitor b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo Goal Trigger b b CCTCAAAACTTATCC GGATAAGTTTTGAGG
Cargo Goal Detacher x x TATCTCCTTTCTATT AATAGAAAGGAGATA


Personal tools