Biomod/2011/Caltech/DeoxyriboNucleicAwesome/AFM Experiments Design - Revision history

YAE LIM Lee at 11:52, 3 November 2011

2011-11-03T11:52:47Z

←Older revision		Revision as of 11:52, 3 November 2011
Line 13:		Line 13:

	{\| style= "background: transparent; margin: auto;"		{\| style= "background: transparent; margin: auto;"
-	\|[[Image: AFMdesign2.jpg \| ~~320px~~\|thumb\|center\|Cargo with streptavidin]]	+	\|[[Image: AFMdesign2.jpg \| 330px\|thumb\|center\|Cargo with streptavidin]]
	\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]		\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]
	\|}		\|}

YAE LIM Lee at 11:52, 3 November 2011

2011-11-03T11:52:37Z

←Older revision		Revision as of 11:52, 3 November 2011
Line 13:		Line 13:

	{\| style= "background: transparent; margin: auto;"		{\| style= "background: transparent; margin: auto;"
-	\|[[Image: AFMdesign2.jpg \| ~~310px~~\|thumb\|center\|Cargo with streptavidin]]	+	\|[[Image: AFMdesign2.jpg \| 320px\|thumb\|center\|Cargo with streptavidin]]
	\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]		\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]
	\|}		\|}

YAE LIM Lee at 11:52, 3 November 2011

2011-11-03T11:52:28Z

←Older revision		Revision as of 11:52, 3 November 2011
Line 13:		Line 13:

	{\| style= "background: transparent; margin: auto;"		{\| style= "background: transparent; margin: auto;"
-	\|[[Image: AFMdesign2.jpg \| ~~300px~~\|thumb\|center\|Cargo with streptavidin]]	+	\|[[Image: AFMdesign2.jpg \| 310px\|thumb\|center\|Cargo with streptavidin]]
	\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]		\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]
	\|}		\|}

YAE LIM Lee at 11:52, 3 November 2011

2011-11-03T11:52:17Z

←Older revision		Revision as of 11:52, 3 November 2011
Line 13:		Line 13:

	{\| style= "background: transparent; margin: auto;"		{\| style= "background: transparent; margin: auto;"
-	\|[[Image: AFMdesign2.jpg \| ~~250px~~\|thumb\|center\|Cargo with streptavidin]]	+	\|[[Image: AFMdesign2.jpg \| 300px\|thumb\|center\|Cargo with streptavidin]]
-	\|[[Image: AFMdesign3.jpg \| ~~250px~~\|thumb\|center\|Walker with streptavidin]]	+	\|[[Image: AFMdesign3.jpg \| 200px\|thumb\|center\|Walker with streptavidin]]
	\|}		\|}

YAE LIM Lee at 11:52, 3 November 2011

2011-11-03T11:52:00Z

←Older revision		Revision as of 11:52, 3 November 2011
Line 12:		Line 12:
	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’nd of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provide ssufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.		As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’nd of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provide ssufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.

-	{{\| style= "background: transparent; margin: auto;"\|	+	{\| style= "background: transparent; margin: auto;"
-	[[Image: AFMdesign2.jpg \| 250px\|thumb\|center\|Cargo with streptavidin]]	+	\|[[Image: AFMdesign2.jpg \| 250px\|thumb\|center\|Cargo with streptavidin]]
-	\|[[Image: AFMdesign3.jpg \| 250px\|thumb\|center\|Walker with streptavidin]]\|}	+	\|[[Image: AFMdesign3.jpg \| 250px\|thumb\|center\|Walker with streptavidin]]
		+	\|}

	Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to		Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to

YAE LIM Lee at 11:51, 3 November 2011

2011-11-03T11:51:13Z

←Older revision		Revision as of 11:51, 3 November 2011
Line 3:		Line 3:
	= AFM Experiment Design=		= AFM Experiment Design=

-	Rothemund’s regular rectangle will be used for the 2-dimensional field, because it is the most	+	Rothemund’s regular rectangle will be used for the 2-dimensional field, because it is the most familiar one and also all of the staple sequences are easily accessible. We will start with Onecargo/ one-goal setup, and then expand it to two-cargos/two-goal, or other such combinations.
-	familiar one and also all of the staple sequences are easily accessible. We will start with Onecargo/	+
-	one-goal setup, and then expand it to two-cargos/two-goal, or other such combinations.	+

-	There are two ways of planting; one is duplex-probe method, and the other is v-shapedjunction	+	There are two ways of planting; one is duplex-probe method, and the other is v-shapedjunction probe method. Since one row of duplex probe may not be visible on AFM image, vshaped- junction probe method is useful when we try to plant one rows of tracks. One row of v-shaped-junction probe and multiple rows of duplex probes have similar brightness on AFM image. However, v-shaped-junction probe method is more complicated than duplex-probe method. Considering that tracks will be multiple rows in this project, we will
-	probe method. Since one row of duplex probe may not be visible on AFM image, vshaped-	+
-	junction probe method is useful when we try to plant one rows of tracks.	+
-	One row of v-shaped-junction probe and multiple rows of duplex probes have similar	+
-	brightness on AFM image. However, v-shaped-junction probe method is more complicated than	+
-	duplex-probe method. Considering that tracks will be multiple rows in this project, we will	+
	use duplex-probe method, the simper one.		use duplex-probe method, the simper one.

-	[[Image: AFMdesign1.jpg \| 250px\|thumb\|center]]	+	[[Image: AFMdesign1.jpg \| 250px\|thumb\|center \| Planting tracks on origami using probes]]

-	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. ~~5’ end~~ of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also ~~provides sufficient~~ flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.	+	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’nd of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provide ssufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.

	{{\| style= "background: transparent; margin: auto;"\|		{{\| style= "background: transparent; margin: auto;"\|
	[[Image: AFMdesign2.jpg \| 250px\|thumb\|center\|Cargo with streptavidin]]		[[Image: AFMdesign2.jpg \| 250px\|thumb\|center\|Cargo with streptavidin]]
-	[[Image: AFMdesign3.jpg \| 250px\|thumb\|center\|Walker with streptavidin]]\|}	+	\|[[Image: AFMdesign3.jpg \| 250px\|thumb\|center\|Walker with streptavidin]]\|}

	Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to		Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to

YAE LIM Lee at 11:50, 3 November 2011

2011-11-03T11:50:07Z

←Older revision		Revision as of 11:50, 3 November 2011
Line 15:		Line 15:
	use duplex-probe method, the simper one.		use duplex-probe method, the simper one.

-	[[Image: AFMdesign1.jpg \| 250px]]	+	[[Image: AFMdesign1.jpg \| 250px\|thumb\|center]]

	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.		As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.

-	[[Image: AFMdesign2.jpg \| 250px]]	+	{{\| style= "background: transparent; margin: auto;"\|
		+	[[Image: AFMdesign2.jpg \| 250px\|thumb\|center\|Cargo with streptavidin]]
		+	[[Image: AFMdesign3.jpg \| 250px\|thumb\|center\|Walker with streptavidin]]\|}

	Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to		Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to
	plant cargo attaching strand and goal strand on origami. To match domain level design of picking up and		plant cargo attaching strand and goal strand on origami. To match domain level design of picking up and
	dropping off mechanism, 3’ end of the staples, cargo attaching strands, and goal strands will be extended		dropping off mechanism, 3’ end of the staples, cargo attaching strands, and goal strands will be extended
-	to have probe section. Streptavidin is attached at the 3’end of the cargo (yellow circle in figure), so cargo planting will be verified by taking AFM image.	+	to have probe section. Streptavidin is attached at the 3’end of the cargo (yellow circle in figure), so cargo planting will be verified by taking AFM image. We will also observe the position of the walker by attaching streptavidin as above.

-	[[Image: AFMdesign3(1).jpg \| 600px]]	+	[[Image: AFMdesign3(1).jpg \| 600px\|thumb\|center\|How markers work]]

	In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.		In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.

-	~~[[Image: AFMdesign3.jpg \| 250px]]~~
-
-	~~We will observe the position of the walker by attaching streptavidin as above.~~

	{{Template:DeoxyriboNucleicAwesomeFooter}}		{{Template:DeoxyriboNucleicAwesomeFooter}}

YAE LIM Lee at 07:09, 3 November 2011

2011-11-03T07:09:37Z

←Older revision		Revision as of 07:09, 3 November 2011
Line 1:		Line 1:
		+	{{Template:DeoxyriboNucleicAwesomeHeader}}
		+
	= AFM Experiment Design=		= AFM Experiment Design=

Line 31:		Line 33:

	We will observe the position of the walker by attaching streptavidin as above.		We will observe the position of the walker by attaching streptavidin as above.
		+
		+	{{Template:DeoxyriboNucleicAwesomeFooter}}

YAE LIM Lee at 05:57, 3 November 2011

2011-11-03T05:57:48Z

←Older revision		Revision as of 05:57, 3 November 2011
Line 13:		Line 13:
	use duplex-probe method, the simper one.		use duplex-probe method, the simper one.

-	[[Image: AFMdesign1.jpg \| ~~200px~~]]	+	[[Image: AFMdesign1.jpg \| 250px]]

	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.		As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.

-	[[Image: AFMdesign2.jpg \| ~~200px~~]]	+	[[Image: AFMdesign2.jpg \| 250px]]

	Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to		Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to
Line 28:		Line 28:
	In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.		In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.

-	[[Image: AFMdesign3.jpg \| ~~200px~~]]	+	[[Image: AFMdesign3.jpg \| 250px]]

	We will observe the position of the walker by attaching streptavidin as above.		We will observe the position of the walker by attaching streptavidin as above.

YAE LIM Lee at 05:57, 3 November 2011

2011-11-03T05:57:28Z

←Older revision		Revision as of 05:57, 3 November 2011
Line 13:		Line 13:
	use duplex-probe method, the simper one.		use duplex-probe method, the simper one.

-	[[Image: AFMdesign1.jpg \| ~~150px~~]]	+	[[Image: AFMdesign1.jpg \| 200px]]

	As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.		As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.

-	[[Image: AFMdesign2.jpg \| ~~150px~~]]	+	[[Image: AFMdesign2.jpg \| 200px]]

	Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to		Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to
Line 28:		Line 28:
	In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.		In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.

-	[[Image: AFMdesign3.jpg \| ~~150px~~]]	+	[[Image: AFMdesign3.jpg \| 200px]]

	We will observe the position of the walker by attaching streptavidin as above.		We will observe the position of the walker by attaching streptavidin as above.