Biomod/2011/Caltech/DeoxyriboNucleicAwesome/AFM Experiments Design
From OpenWetWare
| Line 13: | Line 13: | ||
use duplex-probe method, the simper one. | use duplex-probe method, the simper one. | ||
| - | [[Image: AFMdesign1.jpg | | + | [[Image: AFMdesign1.jpg | 200px]] |
As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track. | As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track. | ||
| - | [[Image: AFMdesign2.jpg | | + | [[Image: AFMdesign2.jpg | 200px]] |
Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to | Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to | ||
| Line 28: | Line 28: | ||
In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker. | In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker. | ||
| - | [[Image: AFMdesign3.jpg | | + | [[Image: AFMdesign3.jpg | 200px]] |
We will observe the position of the walker by attaching streptavidin as above. | We will observe the position of the walker by attaching streptavidin as above. | ||
Revision as of 01:57, 3 November 2011
AFM Experiment Design
Rothemund’s regular rectangle will be used for the 2-dimensional field, because it is the most familiar one and also all of the staple sequences are easily accessible. We will start with Onecargo/ one-goal setup, and then expand it to two-cargos/two-goal, or other such combinations.
There are two ways of planting; one is duplex-probe method, and the other is v-shapedjunction probe method. Since one row of duplex probe may not be visible on AFM image, vshaped- junction probe method is useful when we try to plant one rows of tracks. One row of v-shaped-junction probe and multiple rows of duplex probes have similar brightness on AFM image. However, v-shaped-junction probe method is more complicated than duplex-probe method. Considering that tracks will be multiple rows in this project, we will use duplex-probe method, the simper one.
As in the figure, end of the staples at which tracks will be planted on origami will be extended to have 20nt probe section. 5’ end of the trackss will be extended to have 20nt section that is complementary to the probes. 20nt probe section also provides sufficient flexibility and length, so blue toehold of the walker can reach complementary region of the next track. Distance between two vertical spaced trakcs is calculated to be ½ double helix + space + 1 double helix + space + ½ double helix = 2 double helix + 2 space = 6 nm. Distance between two diagonally spaced tracks is calculated to be ((16 nt)2 + (1double helix + 1 space)2)0.5 = 6.21 nm. There is a flexible nick between the probe section and a staple, so probe section will bend into all direction. Since 20nt probe section is about 6nm, walker can easily reach next track.
Cargo will attached on the origami by cargo attaching strand. Same duplex-probe method will be used to plant cargo attaching strand and goal strand on origami. To match domain level design of picking up and dropping off mechanism, 3’ end of the staples, cargo attaching strands, and goal strands will be extended to have probe section. Streptavidin is attached at the 3’end of the cargo (yellow circle in figure), so cargo planting will be verified by taking AFM image.
In order to determine the orientation of the origami on AFM image, asymmetry visible on AFM image is needed. We will not plant substrates for the bottom three rows of the origami, and put marker at bottom right corner. For example, above figure is a diagram for one goal/one cargo system. Goal section is place at the opposite side of the marker. Second diagram of above figure is a diagram after reorganizing. Even though a rectangle is upside-down, we can see that all of the cargos successfully transported to goal section, by determine the orientation from the marker. Marker will be six modified staples forming dumbbells, which uses same sequences as in Rothemund’s paper; ½ staple sequence+TCCTCTTTTGAGGAACAAGTTTTCTTGT+½ staple sequence. In the above figure, maker at the corner will add asymmetry to the origami. Green dots represent the cargos and orange rectangle represents the marker.
We will observe the position of the walker by attaching streptavidin as above.


