BioMicroCenter:Illumina Sequencing: Difference between revisions
(41 intermediate revisions by 4 users not shown) | |||
Line 1: | Line 1: | ||
{{BioMicroCenter}} | {{BioMicroCenter}} | ||
The MIT BioMicro Center has five high-throughput Illumina sequencers, including a HiSeq 2000, three Genome Analyzers and one MiSeq. We support a wide variety of applications, such as ChIP-Seq, miRNA sequencing and RNA-seq. Each lane can potentially accomodate dozens of barcoded samples (depending on sequence complexity and desired coverage). [[BioMicroCenter:CoverageCalculations|Read lengths]] vary, depending on users, between 36nt and | The MIT BioMicro Center has five high-throughput Illumina sequencers, including a HiSeq 2000, three Genome Analyzers and one MiSeq. We support a wide variety of applications, such as ChIP-Seq, miRNA sequencing and RNA-seq. Each lane can potentially accomodate dozens of barcoded samples (depending on sequence complexity and desired coverage). [[BioMicroCenter:CoverageCalculations|Read lengths]] vary, depending on users, between 36nt and 250nt per end. <br> | ||
All questions about Illumina Sequencing can be directed to | All questions about Illumina Sequencing can be directed to Michael Gravina at mgravina@mit.edu or Scott Morin at smorin@mit.edu | ||
==Illumina Massively Parallel Sequencing== | ==Illumina Massively Parallel Sequencing== | ||
[[Image:cbot_left.jpg|left]]Illumina sequencing works by binding randomly fragmented DNA to an optical flowcell. Fragments are sequenced by sequentially incorporating and imaging fluorescently labeled nucleotides in a [http://illumina.com/pages.ilmn?ID=203 “Sequencing-By-Synthesis”] reaction. Illumina | [[Image:cbot_left.jpg|left]]Illumina sequencing works by binding randomly fragmented DNA to an optical flowcell. Fragments are sequenced by sequentially incorporating and imaging fluorescently labeled nucleotides in a [http://illumina.com/pages.ilmn?ID=203 “Sequencing-By-Synthesis”] reaction. The BioMicro Center uses Illumina's [http://www.illumina.com/truseq/about_truseq/truseq_sequencing_by_synthesis.ilmn TruSeq v3] reagent kits, improving read quality and reducing GC bias at high cluster densities. For an in-depth overview of the Illumina sequencing chemistry, please refer to [http://www.ncbi.nlm.nih.gov/pubmed/19682367 Kirchner et al 2009.] | ||
== Platforms == | == Platforms == | ||
Line 23: | Line 23: | ||
''The HiSeq2000 was donated to the BioMicro Center by Drs. Penny Chisholm and Chris Burge. '' | ''The HiSeq2000 was donated to the BioMicro Center by Drs. Penny Chisholm and Chris Burge. '' | ||
=== MiSeq === | === MiSeq === | ||
[[Image:BMC_miseq.png|right|200px]] The MiSeq is the newest sequencer in the BioMicro Center. Unlike the HiSeq, the MiSeq is optimized for speed. The MiSeq has a single lane that can produce approximately | [[Image:BMC_miseq.png|right|200px]] The MiSeq is the newest sequencer in the BioMicro Center. Unlike the HiSeq, the MiSeq is optimized for speed. The MiSeq has a single lane that can produce approximately 15 million reads passing filter. The MiSeq does *not* have a control lane so having good base balance is critical for runs on this sequencer. Amplicons, such as 16S, can be run on the sequencer but should be constructed to have [[BioMicroCenter:PhasedSequencing|phased sequencing]]. Highly unbalanced libraries, such as RRBS, should not be run on the MiSeq. <BR><BR> | ||
The strength of the MiSeq is its speed and read length. The MiSeq is able to sequence | The strength of the MiSeq is its speed and read length. The MiSeq is able to sequence 14nt/hour which allows it to complete a 150+150nt paired end read, from cluster to fastq files, in a little less than a day. This compares to 2-3 weeks of sequencing on the HiSeq. Because the chemistry is on the flowcell for less time, error rates are much lower for the MiSeq then the HiSeq. MiSeq runs are available in 50, 300 and 500nt flavors. <BR><BR> | ||
The 50 cycle kit can accommodate up to 60bp read length (single-end or 30+30 paired-end). The 300 cycle kit can accommodate up to 350bp read length, while the 500 cycle kit can accommodate up to 520bp read length. New kits should push read length even longer, with the Broad Institute having reported 400+400PE runs. <BR><BR> | |||
The MiSeq is ideal for: | The MiSeq is ideal for: | ||
* Small genome resequencing | * Small genome resequencing | ||
Line 31: | Line 32: | ||
* smRNA | * smRNA | ||
* barcode sequencing | * barcode sequencing | ||
''The | |||
''The MiSeq was donated to the BioMicro Center by Dr. Chris Love. '' | |||
=== Genome Analyzer IIx === | === Genome Analyzer IIx === | ||
[[Image:GAIIxcollage.jpg|right|200px]] The Genome Analyzer II (GAII) are the oldest sequencers in the BioMicro Center and remain the most flexible. The newer generations of Illumina sequencers have been designed with increasing focus on clinical applications and have removed some of the "hands on" aspects of the older GAIIs. The GAIIs remain the only sequencers where the actual images of the flowcell can be reprocessed for example. The GAII/IIx can produce 20-40m reads per lane passing filter and typically runs read lengths of 36-150nt per side.<BR><BR> | [[Image:GAIIxcollage.jpg|right|200px]] The Genome Analyzer II (GAII) are the oldest sequencers in the BioMicro Center and remain the most flexible. The newer generations of Illumina sequencers have been designed with increasing focus on clinical applications and have removed some of the "hands on" aspects of the older GAIIs. The GAIIs remain the only sequencers where the actual images of the flowcell can be reprocessed for example. The GAII/IIx can produce 20-40m reads per lane passing filter and typically runs read lengths of 36-150nt per side.<BR><BR> | ||
With the addition of the MiSeq, we have reworked how we are processing GAII flowcells. We have been able to create partial flowcells on the GAII by altering recipes. This has allowed us to move from a model like the HiSeq where we need a full flowcell before we run to a model where we can run as soon as the samples pass quality control, more like the MiSeq. However, unlike the MiSeq, we can run multiple lanes at once. Some critical caveats: First, these methods are not supported by Illumina so we cannot offer to replace failed runs. Second, unlike the HiSeq, the PhiX lane is *not* included. You must choose to sequence a lane of PhiX if you want to do control normalization. Finally, this service is completely "a la carte" so the pricing schema is quite different. <BR><BR> | With the addition of the MiSeq, we have reworked how we are processing GAII flowcells. We have been able to create [[BioMicroCenter:PartialFlowcells|'''partial flowcells''']] on the GAII by altering recipes. This has allowed us to move from a model like the HiSeq where we need a full flowcell before we run to a model where we can run as soon as the samples pass quality control, more like the MiSeq. However, unlike the MiSeq, we can run multiple lanes at once. Some critical caveats: First, these methods are not supported by Illumina so we cannot offer to replace failed runs. Second, unlike the HiSeq, the PhiX lane is *not* included. You must choose to sequence a lane of PhiX if you want to do control normalization. Finally, this service is completely "a la carte" so the pricing schema is quite different. <BR><BR> | ||
{| border=1 align="right" | {| border=1 align="right" | ||
! # of Lanes | ! # of Lanes | ||
Line 42: | Line 46: | ||
| 8 | | 8 | ||
| 24 | | 24 | ||
| | | 42 | ||
|-align="center" | |-align="center" | ||
| 4 | | 4 | ||
| 36 | | 36 | ||
| | | 66/33* | ||
|-align="center" | |-align="center" | ||
| 2 | | 2 | ||
| 48 | | 48 | ||
| | | 106/54* | ||
|-align="center" | |-align="center" | ||
| 1 | | 1 | ||
| 72 | | 72 | ||
| | | 140/81* | ||
|- | |||
|colspan="3" align=center |*''Second number pertains to reads greater than 40 nt.'' | |||
|} | |} | ||
Using fewer lanes on each flowcell has allowed us to decrease the cycle time by not imaging all the lanes. In a typical 8 lane run, 20 minutes is spent doing chemistry followed by 40 minutes of imaging (each lane takes ~5 minutes to image). Therefore, a 2 lane flowcell runs twice as fast as an 8 lane flowcell. Also, since the chemistry is not running in to all of the lanes, each sequencing kit can go to a longer read length. The relationships are summarized in the chart on the left. Pricing is set on the number of lanes you are using, the number of days you are running the GAII, and the number of sequencing kits you are using. For example, if you wanted to run a | Using fewer lanes on each flowcell has allowed us to decrease the cycle time by not imaging all the lanes. In a typical 8 lane run, 20 minutes is spent doing chemistry followed by 40 minutes of imaging (each lane takes ~5 minutes to image). Therefore, a 2 lane flowcell runs twice as fast as an 8 lane flowcell. Also, since the chemistry is not running in to all of the lanes, each sequencing kit can go to a longer read length. The relationships are summarized in the chart on the left. Pricing is set on the number of lanes you are using, the number of days you are running the GAII, and the number of sequencing kits you are using. For example, if you wanted to run a 75+75 PE flowcell using 2 lanes, the cost would be the initial cost for the 2 lane PE flowcell plus an additional 3 days (one day is included in the original price) plus two additional sequencing kits. The last kit would not be completely used up (you would have an extra 18nt left that would be thrown away).<BR><BR> | ||
The GAII/GAIIx is ideal for: | The GAII/GAIIx is ideal for: | ||
Line 104: | Line 110: | ||
Full pricing information is available on [[BioMicroCenter:Pricing|our price list]].<br> | Full pricing information is available on [[BioMicroCenter:Pricing|our price list]].<br> | ||
Priority for Illumina sequencing is given to labs associated with the BioMicro Center [[BioMicroCenter:CoreDeps|Core departments]] on a first-come first-served basis. Users requiring expedited services should contact [[BioMicroCenter:People|Stuart Levine]]. We are able offer our services to other MIT and [[BioMicroCenter:FAQ#NON_MIT_USERS|non-MIT]] users as space allows. | Priority for Illumina sequencing is given to labs associated with the BioMicro Center [[BioMicroCenter:CoreDeps|Core departments]] on a first-come first-served basis. Users requiring expedited services should contact [[BioMicroCenter:People|Stuart Levine]]. We are able offer our services to other MIT and [[BioMicroCenter:FAQ#NON_MIT_USERS|non-MIT]] users as space allows. A full description of priority and queue time expectations can be found [[BioMicroCenter:FAQ#HOW_LONG_WILL_IT_TAKE_FOR_MY_HISEQ_SAMPLE_TO_BE_SEQUENCED| on our FAQ.]] | ||
=== Library Preparation === | === Library Preparation === | ||
Line 117: | Line 123: | ||
The BioMicro Center undertakes a number of quality assurance methods to ensure that we produce high quality data for you. All samples submitted for Illumina sequencing are checked for size distribution, presence of proper 5' and 3' adapters, and actual concentration using the [[BioMicroCenter:2100BioAnalyzer|Agilent Bioanalyzer]] and [[BioMicroCenter:RTPCR#Light_Cycler_480_II_Real-time_PCR_Machinesq|qPCR]]. For more information on library quality can be found on the [[BioMicroCenter:Sequencing_Quality_Control|Sequencing Quality Control]] page. <BR> | The BioMicro Center undertakes a number of quality assurance methods to ensure that we produce high quality data for you. All samples submitted for Illumina sequencing are checked for size distribution, presence of proper 5' and 3' adapters, and actual concentration using the [[BioMicroCenter:2100BioAnalyzer|Agilent Bioanalyzer]] and [[BioMicroCenter:RTPCR#Light_Cycler_480_II_Real-time_PCR_Machinesq|qPCR]]. For more information on library quality can be found on the [[BioMicroCenter:Sequencing_Quality_Control|Sequencing Quality Control]] page. <BR> | ||
<BR> | <BR> | ||
We will skip pre-sequencing QC if the user supplies us with concentration and average fragment length information for each sample submitted. '''However''', different labs often vary substantially in their quantifications and our methods are optimized for our own instruments and operators. We cannot guarantee optimal data output and quality for samples which are quantified outside of the BioMicro Center.<br><br> | |||
Additional quality metrics are done during all sequencing runs as part of the standard Illumina process. All samples are spiked with ~0.5% of the bacteriophage [http://en.wikipedia.org/wiki/Phi_X_174 ΦX174]. The ΦX library is primed off the standard Illumina sequencing primers and is used to both ensure the quality of the reagents used in the run and to measure the background sequencing error rates. ΦX reads will not be detected on non-standard libraries using custom priming. <BR> | Additional quality metrics are done during all sequencing runs as part of the standard Illumina process. All samples are spiked with ~0.5% of the bacteriophage [http://en.wikipedia.org/wiki/Phi_X_174 ΦX174]. The ΦX library is primed off the standard Illumina sequencing primers and is used to both ensure the quality of the reagents used in the run and to measure the background sequencing error rates. ΦX reads will not be detected on non-standard libraries using custom priming. <BR> | ||
<BR> | <BR> | ||
Finally, several additional quality metrics are included in the [[BioMicroCenter:IlluminaPipeline|automated analysis pipeline]] currently under active development in the Center. These include standard metrics of base composition, GC%, library complexity and overrepresented reads that are in the TagCount and [http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Fastqc] files. In addition, we now evaluate libraries for contamination from common laboratory species (human, mouse, yeast and E.coli). More information can be found on the [http://bmc-pipeline.mit.edu/flowcell_data_guide.html Flowcell data guide page.] | Finally, several additional quality metrics are included in the [[BioMicroCenter:IlluminaPipeline|automated analysis pipeline]] currently under active development in the Center. These include standard metrics of base composition, GC%, library complexity and overrepresented reads that are in the TagCount and [http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Fastqc] files. In addition, we now evaluate libraries for contamination from common laboratory species (human, mouse, yeast and E.coli). More information can be found on the [http://bmc-pipeline.mit.edu/flowcell_data_guide.html Flowcell data guide page.] | ||
=== Pooling considerations === | |||
When determining how many samples should be combined together in a single lane, the following equations are useful:<br> | |||
<UL> | |||
<LI>'''# of lanes = (genomesize x coverage x #samples) / (#readsperlane x readlength x ends)'''<br> | |||
<LI>'''#samplesperlane = (#readsperlane x readlength x ends) / (genomesize x coverage)'''<br> | |||
</UL> | |||
where,<br> | |||
<UL> | |||
<LI>''# of lanes'' is the total number of lanes that are required to achieve the specified coverage given the other variables<br> | |||
<LI>''#samplesperlane'' is the total number of samples that can be combined into a single lane to achieve the specified coverage given the other variables<br> | |||
<LI>''genomesize'' is the size, in nt, of the library to be sequenced<br> | |||
<LI>''coverage'' is the desired multiplicity of coverage for the library<br> | |||
<LI>''#samples'' is the number of samples needing to be sequenced<br> | |||
<LI>''#readsperlane'' is the number of reads produced by a lane on the sequencer. (See "Platform Comparison" table above for the typical outputs from each platform.) | |||
<LI>''readlength'' is the length, in nt, of each separate read of the run<br> | |||
<LI>''ends'' is the number of insert reads for the run. For single-end, it is 1, and for paired-end, it is 2.<br><br> | |||
</UL> | |||
=== Custom Primers === | |||
Many non-standard Illumina protocols require custom sequencing primers. The design of these oligos is critical for the success of the experiment and we have observed several experimental failures due to improper oligo design. There are a few critical parameters in oligo design.<br> | |||
<UL> | |||
<LI>First, the oligo must only occur once in each sequence. Multiple binding will result in low quality reads.<br> | |||
<LI>On reverse or index reads, we cannot separate the oligos by lane and so the construct must be compatible with having a cocktail of standard Illumina oligonucleotides in the mix.<br> | |||
<LI>The Tm of the oligo '''must''' match the Tm of the sequencing primer they are designed to replace. Being even a couple degrees below the Tm can result in experimental failure. Any online Tm calculator can be used. The standard Illumina sequences are: <br> | |||
Forward read: 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT<br> | |||
Reverse read: 5'CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT<br> | |||
Multiplexing Index Read: 5'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC<br> | |||
</UL> | |||
Custom oligonucleotides should submitted at 100 µM with at least 20 µL provided. At time of submission, please take the time to diagram your primer design for the sequencing technician who can verify its compatibility and help to avoid any unforseen issues. | |||
=== Data Analysis === | === Data Analysis === | ||
Line 131: | Line 172: | ||
* Delivery of the data to a user accessible folder | * Delivery of the data to a user accessible folder | ||
All of these steps are run by our [http://bmc-pipeline.mit.edu/flowcell_data_guide.html automated analysis pipeline]currently in active development. For users requiring further analysis, we have a staff of [[BioMicroCenter:BioInformaticsStaff||bioinformaticists]] that can assist you in analyzing your data. | All of these steps are run by our [http://bmc-pipeline.mit.edu/flowcell_data_guide.html automated analysis pipeline]currently in active development. For users requiring further analysis, we have a staff of [[BioMicroCenter:BioInformaticsStaff||bioinformaticists]] that can assist you in analyzing your data. | ||
<BR><BR> | |||
<BR> | |||
< | |||
== MIT Core Collaboration == | == MIT Core Collaboration == | ||
Because of the layout of Illumina flowcells, samples must be run in batches of 7 lanes (a pool of multiplexed samples counts as one lane). In order to ensure quick throughput, we have established a collaboration that allows us to move partial flowcells between the various centers at MIT. For users with less then 4 samples, their samples may be moved between the BioMicro Center, the [http://jura.wi.mit.edu/genomecorewiki/index.php/Main_Page Whitehead Institute Center for Genome Technologies] and the [http://web.mit.edu/biopolymers/www/ Koch Institute Biopolymer Center]. Samples will be moved only to fill out runs or to expedite processing. The Centers are committed to working together to maintain consistent quality between the different cores, so you should see no difference whether your samples are run in BioMicro or at one of our sister centers. Transfers are only available for members of the MIT community. | Because of the layout of Illumina flowcells, samples must be run in batches of 7 lanes (a pool of multiplexed samples counts as one lane). In order to ensure quick throughput, we have established a collaboration that allows us to move partial flowcells between the various centers at MIT. For users with less then 4 samples, their samples may be moved between the BioMicro Center, the [http://jura.wi.mit.edu/genomecorewiki/index.php/Main_Page Whitehead Institute Center for Genome Technologies] and the [http://web.mit.edu/biopolymers/www/ Koch Institute Biopolymer Center]. Samples will be moved only to fill out runs or to expedite processing. The Centers are committed to working together to maintain consistent quality between the different cores, so you should see no difference whether your samples are run in BioMicro or at one of our sister centers. Transfers are only available for members of the MIT community. | ||
[[Media:QueueReport.pdf| '''View current samples queuing for Illumina''']] | [[Media:QueueReport.pdf| '''View current samples queuing for Illumina''']] -- obsolete | ||
<BR> | <BR> | ||
'''OLDE LINKS''' | '''OLDE LINKS''' | ||
* [[BioMicroCenter: | * [[BioMicroCenter:ChIP|'''ChIP Seq''']] | ||
* [[BioMicroCenter:Small_RNA_Seq|'''Small RNA Sequencing''']] | * [[BioMicroCenter:Small_RNA_Seq|'''Small RNA Sequencing''']] | ||
* [[BioMicroCenter:Genome_Seq|'''Genome sequencing and resequencing''']] | * [[BioMicroCenter:Genome_Seq|'''Genome sequencing and resequencing''']] |
Revision as of 12:05, 6 August 2013
HOME -- | SEQUENCING -- | LIBRARY PREP -- | HIGH-THROUGHPUT -- | COMPUTING -- | OTHER TECHNOLOGY |
The MIT BioMicro Center has five high-throughput Illumina sequencers, including a HiSeq 2000, three Genome Analyzers and one MiSeq. We support a wide variety of applications, such as ChIP-Seq, miRNA sequencing and RNA-seq. Each lane can potentially accomodate dozens of barcoded samples (depending on sequence complexity and desired coverage). Read lengths vary, depending on users, between 36nt and 250nt per end.
All questions about Illumina Sequencing can be directed to Michael Gravina at mgravina@mit.edu or Scott Morin at smorin@mit.edu
Illumina Massively Parallel Sequencing
Illumina sequencing works by binding randomly fragmented DNA to an optical flowcell. Fragments are sequenced by sequentially incorporating and imaging fluorescently labeled nucleotides in a “Sequencing-By-Synthesis” reaction. The BioMicro Center uses Illumina's TruSeq v3 reagent kits, improving read quality and reducing GC bias at high cluster densities. For an in-depth overview of the Illumina sequencing chemistry, please refer to Kirchner et al 2009.
Platforms
HiSeq 2000
The Illumina HiSeq 2000 is the workhorse of BMC's Illumina fleet and is optimized for maximum yield and the lowest price per basepair. Each lane on the HiSeq is typically produces between 160 and 220 million reads passing our quality filter (for high quality libraries). HiSeq flowcells have 8 lanes, one of which is committed to a control sample that is used for base normalization (lane 1). Read lengths on the HiSeq very between 40 and 100nt per side and nearly all flowcells use barcoding to run multiple samples in each lane.
In order to optimize work flow and keep costs under control, only full flowcells are run. Since all 8 lanes of the flowcell must be run at equal lengths, submissions of single lanes must be grouped with other similar read lengths. This means that some read lengths move through our queue faster then others because more samples of that length are submitted to the BioMicro Center for sequencing. 40nt single end (SE) samples are by far the most common and move through the queue rapidly followed by short paired end (40+40) runs. Many lengths are very unusual (eg. 100nt single end) and can wait months for sequencing. We strongly recommend moving samples with unusual read requirements to one of the other platforms. If you have questions about this (or any other aspect of sequencing) please do not hesitate to contact us.
The HiSeq2000 is ideal for:
- High numbers of multiplexed samples
- De novo sequencing
- SNP detection
- ChIPseq
- Bisulfite sequencing
- RNAseq
- Exome sequencing
The HiSeq2000 was donated to the BioMicro Center by Drs. Penny Chisholm and Chris Burge.
MiSeq
The MiSeq is the newest sequencer in the BioMicro Center. Unlike the HiSeq, the MiSeq is optimized for speed. The MiSeq has a single lane that can produce approximately 15 million reads passing filter. The MiSeq does *not* have a control lane so having good base balance is critical for runs on this sequencer. Amplicons, such as 16S, can be run on the sequencer but should be constructed to have phased sequencing. Highly unbalanced libraries, such as RRBS, should not be run on the MiSeq.
The strength of the MiSeq is its speed and read length. The MiSeq is able to sequence 14nt/hour which allows it to complete a 150+150nt paired end read, from cluster to fastq files, in a little less than a day. This compares to 2-3 weeks of sequencing on the HiSeq. Because the chemistry is on the flowcell for less time, error rates are much lower for the MiSeq then the HiSeq. MiSeq runs are available in 50, 300 and 500nt flavors.
The 50 cycle kit can accommodate up to 60bp read length (single-end or 30+30 paired-end). The 300 cycle kit can accommodate up to 350bp read length, while the 500 cycle kit can accommodate up to 520bp read length. New kits should push read length even longer, with the Broad Institute having reported 400+400PE runs.
The MiSeq is ideal for:
- Small genome resequencing
- Targeted resequencing
- Metagenomics
- smRNA
- barcode sequencing
The MiSeq was donated to the BioMicro Center by Dr. Chris Love.
Genome Analyzer IIx
The Genome Analyzer II (GAII) are the oldest sequencers in the BioMicro Center and remain the most flexible. The newer generations of Illumina sequencers have been designed with increasing focus on clinical applications and have removed some of the "hands on" aspects of the older GAIIs. The GAIIs remain the only sequencers where the actual images of the flowcell can be reprocessed for example. The GAII/IIx can produce 20-40m reads per lane passing filter and typically runs read lengths of 36-150nt per side.
With the addition of the MiSeq, we have reworked how we are processing GAII flowcells. We have been able to create partial flowcells on the GAII by altering recipes. This has allowed us to move from a model like the HiSeq where we need a full flowcell before we run to a model where we can run as soon as the samples pass quality control, more like the MiSeq. However, unlike the MiSeq, we can run multiple lanes at once. Some critical caveats: First, these methods are not supported by Illumina so we cannot offer to replace failed runs. Second, unlike the HiSeq, the PhiX lane is *not* included. You must choose to sequence a lane of PhiX if you want to do control normalization. Finally, this service is completely "a la carte" so the pricing schema is quite different.
# of Lanes | cycles per day | cycles per kit |
---|---|---|
8 | 24 | 42 |
4 | 36 | 66/33* |
2 | 48 | 106/54* |
1 | 72 | 140/81* |
*Second number pertains to reads greater than 40 nt. |
Using fewer lanes on each flowcell has allowed us to decrease the cycle time by not imaging all the lanes. In a typical 8 lane run, 20 minutes is spent doing chemistry followed by 40 minutes of imaging (each lane takes ~5 minutes to image). Therefore, a 2 lane flowcell runs twice as fast as an 8 lane flowcell. Also, since the chemistry is not running in to all of the lanes, each sequencing kit can go to a longer read length. The relationships are summarized in the chart on the left. Pricing is set on the number of lanes you are using, the number of days you are running the GAII, and the number of sequencing kits you are using. For example, if you wanted to run a 75+75 PE flowcell using 2 lanes, the cost would be the initial cost for the 2 lane PE flowcell plus an additional 3 days (one day is included in the original price) plus two additional sequencing kits. The last kit would not be completely used up (you would have an extra 18nt left that would be thrown away).
The GAII/GAIIx is ideal for:
- Unusual read lengths
- Protocol Prototyping
- Non-standard assays such as HITS-FLIP
This GAII pricing model is an experimental model and is subject to change
The Genome Analyzer IIs were donated to the BioMicro Center by Drs. Penny Chisholm, Chris Burge, Ernest Fraenkel and the Dept of Biology with contributions from many others
Platform Comparison
SPEC | HiSeq2000 | GAII/IIx | MiSeq |
---|---|---|---|
Machine Names | FonZie | Ryland Boris Preston |
MiAmore |
# reads / lane | 160-220m | 20-40m | 4-6m |
# lanes coprocessed | 7+PhiX | 1 to 8 | 1 |
nt / day | 24 | 24-72 | 288 |
Additional Information
Pricing and Priority
Full pricing information is available on our price list.
Priority for Illumina sequencing is given to labs associated with the BioMicro Center Core departments on a first-come first-served basis. Users requiring expedited services should contact Stuart Levine. We are able offer our services to other MIT and non-MIT users as space allows. A full description of priority and queue time expectations can be found on our FAQ.
Library Preparation
Illumina sequencing requires the input of libraries with inserts between 10 and 1000bp in length and have specific adapters attached to the 5' and 3' ends. The BioMicro Center accepts custom samples of all types provided the user also submits sequencing primers (though we do not assume responsibility if the samples fail). Samples submitted for Illumina sequencing should be at ~10ng/ul and the user should provide at least 10λ of samples. This is an ideal situation but we do have protocols available to help users with much less concentrated samples. Please submit your sample along with a completed Illumina sequencing form.
In addition to accepting finished libraries, the Biomicro Center supports a number of different sample preparation methodologies for different applications including RNAseq, ChIPseq and genome sequencing. All samples prepped in the BioMicro Center are barcoded for multiplexing.
Quality Control
The BioMicro Center undertakes a number of quality assurance methods to ensure that we produce high quality data for you. All samples submitted for Illumina sequencing are checked for size distribution, presence of proper 5' and 3' adapters, and actual concentration using the Agilent Bioanalyzer and qPCR. For more information on library quality can be found on the Sequencing Quality Control page.
We will skip pre-sequencing QC if the user supplies us with concentration and average fragment length information for each sample submitted. However, different labs often vary substantially in their quantifications and our methods are optimized for our own instruments and operators. We cannot guarantee optimal data output and quality for samples which are quantified outside of the BioMicro Center.
Additional quality metrics are done during all sequencing runs as part of the standard Illumina process. All samples are spiked with ~0.5% of the bacteriophage ΦX174. The ΦX library is primed off the standard Illumina sequencing primers and is used to both ensure the quality of the reagents used in the run and to measure the background sequencing error rates. ΦX reads will not be detected on non-standard libraries using custom priming.
Finally, several additional quality metrics are included in the automated analysis pipeline currently under active development in the Center. These include standard metrics of base composition, GC%, library complexity and overrepresented reads that are in the TagCount and Fastqc files. In addition, we now evaluate libraries for contamination from common laboratory species (human, mouse, yeast and E.coli). More information can be found on the Flowcell data guide page.
Pooling considerations
When determining how many samples should be combined together in a single lane, the following equations are useful:
- # of lanes = (genomesize x coverage x #samples) / (#readsperlane x readlength x ends)
- #samplesperlane = (#readsperlane x readlength x ends) / (genomesize x coverage)
where,
- # of lanes is the total number of lanes that are required to achieve the specified coverage given the other variables
- #samplesperlane is the total number of samples that can be combined into a single lane to achieve the specified coverage given the other variables
- genomesize is the size, in nt, of the library to be sequenced
- coverage is the desired multiplicity of coverage for the library
- #samples is the number of samples needing to be sequenced
- #readsperlane is the number of reads produced by a lane on the sequencer. (See "Platform Comparison" table above for the typical outputs from each platform.)
- readlength is the length, in nt, of each separate read of the run
- ends is the number of insert reads for the run. For single-end, it is 1, and for paired-end, it is 2.
Custom Primers
Many non-standard Illumina protocols require custom sequencing primers. The design of these oligos is critical for the success of the experiment and we have observed several experimental failures due to improper oligo design. There are a few critical parameters in oligo design.
- First, the oligo must only occur once in each sequence. Multiple binding will result in low quality reads.
- On reverse or index reads, we cannot separate the oligos by lane and so the construct must be compatible with having a cocktail of standard Illumina oligonucleotides in the mix.
- The Tm of the oligo must match the Tm of the sequencing primer they are designed to replace. Being even a couple degrees below the Tm can result in experimental failure. Any online Tm calculator can be used. The standard Illumina sequences are:
Forward read: 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Reverse read: 5'CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Multiplexing Index Read: 5'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Custom oligonucleotides should submitted at 100 µM with at least 20 µL provided. At time of submission, please take the time to diagram your primer design for the sequencing technician who can verify its compatibility and help to avoid any unforseen issues.
Data Analysis
Illumina sequencing at the BioMicro Center includes basic informatic analysis of the data. These steps include:
- Image analysis to locate clusters
- Basecalling
- Demultiplexing of lanes
- Alignment of sequences to a reference genome
- Quality control
- Delivery of the data to a user accessible folder
All of these steps are run by our automated analysis pipelinecurrently in active development. For users requiring further analysis, we have a staff of |bioinformaticists that can assist you in analyzing your data.
MIT Core Collaboration
Because of the layout of Illumina flowcells, samples must be run in batches of 7 lanes (a pool of multiplexed samples counts as one lane). In order to ensure quick throughput, we have established a collaboration that allows us to move partial flowcells between the various centers at MIT. For users with less then 4 samples, their samples may be moved between the BioMicro Center, the Whitehead Institute Center for Genome Technologies and the Koch Institute Biopolymer Center. Samples will be moved only to fill out runs or to expedite processing. The Centers are committed to working together to maintain consistent quality between the different cores, so you should see no difference whether your samples are run in BioMicro or at one of our sister centers. Transfers are only available for members of the MIT community.
View current samples queuing for Illumina -- obsolete
OLDE LINKS
- ChIP Seq
- Small RNA Sequencing
- Genome sequencing and resequencing
- Illumina pipeline - How it works!
- Illumina pipeline output formats
- Bioinformatic Consulting
- Protocols for all supported technologies can be found here