BioMicroCenter:RTPCR Protocol for Sample QC
From OpenWetWare
This protocol is a slightly modified version of the protocol used at the Broad Institute. The original protocol was developed by Maura Costello. This protocol is similar to the one published in Nature Methods by Quail et al (2008) but uses SYBRgreen instead of Taqman probes.
Contents |
Proof of Concept
Simultaneous test. Samples were tested for RT-PCR and clustered for sequencing on the same day. Their DNA concentration and the correlation of the concentration as measured by RT-PCR was then compared to their cluster number. All DNA samples had been thought to be at 10nM as determined by Qubit quantification.
Key Notes
- Use forward and reverse primers that match the 5' and 3' linkers used in the Illumina sample prep
- DO NOT FREEZE your samples between preforming RT-PCR and loading the cluster station (they can be left at 4°C for up to 24 hours).
- Standard curve created using serial dilution of PhiX control DNA
- Standard curve must have a R^2 > 0.98
Materials
- Enriched sample libraries (with either paired end or standard adapters)
- Phix 335bp control library (Cat. No. CT-901-1001)
- Qiagen Buffer EB
- Molecular biology grade water
- 10uM Forward Primer: AATGATACGGCGACCACCGA
- 10uM Reverse Primer: CAAGCAGAAGACGGCATACGA
- SYBR Green
Roche LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)
or
KAPA LightCycler 480 SYBR Fast Master Mix (Cat. No. KK4611)
- LightCycler Plate
Roche LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001) and Sealing Foil
or
Axygen LightCycler 480 Multiwell Plate 96, White (Cat No. PCR-96-LC480-W) and Sealing Foil
Preparing Standards
This procedure creates seven standards ranging from ~20nM to 0.3nM with which to create the standard curve. In preparing these standards 1:100 dilutions are created. After this step the standards are ready to use, they do not need to be diluted any further, and they can be kept at 4° for up to seven days.
- S1 – add 2uL of Phix control to 198uL of EB (1:100)
- S2 – add 50uL of S1 to 50uL of EB (1:200)
- S3 – add 50uL of S2 to 50uL of EB (1:400)
- S4 – add 50uL of S3 to 50uL of EB (1:800)
- S5 – add 50uL of S4 to 50uL of EB (1:1600)
- S6 – add 50uL of S5 to 50uL of EB (1:3200)
- S7 – add 50uL of S6 to 50uL of EB (1:6400)
Vortex well and spin down in between each dilution
Illumina Phix concentrations vary from lot to lot. It is recommended that you pool multiple tubes of Phix, separate them out into one time use aliquots (~2uL) and quantify one aliquot (we use the KAPA Library Quantification kit for qPCR). This will allow you to have consistent concentrations across multiple preparations of your standards.
Preparing Samples
- Dilute all samples to ~10nM with EB using previous quantification (Bioanalyzer or Qubit are recommended).
- Create 1:1000 stocks of each sample by adding 1uL of a 10nM sample to 999uL of EB. If a sample is suspected to be highly concentrated based off of previous quantification, do a 1:10,000 dilution by adding 1uL sample to 99uL EB, then 1uL of the diluted stock to 99uL of EB again.
- Make sure to vortex well and spin down each sample
Having a rough idea of the concentrations of your samples helps to avoid loading samples that are too concentrated for the RT-PCR machine to read.
Preparing Master Mix
Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells.
For 1 well: Roche SYBR
- Water – 3uL
- PCR Primer Forward (P5), 10uM – 1uL
- PCR Primer Reverse (P7), 10uM – 1uL
- Roche SYBR Green – 10uL
For 1 well: KAPA SYBR
- Water – 7.2uL
- PCR Primer Forward (P5), 10uM – 0.4uL
- PCR Primer Reverse (P7), 10uM – 0.4uL
- KAPA Sybr Fast – 10uL
Do not add SYBR Green to master mix until right before use. Flick and spin down master mix after SYBR green has been added
Master mix may vary depending on type of RT-PCR machine and brand of SYBR green being used
Plate Preparation
![]()
Lanes 4 through 10 can be used for additional samples or left empty
Plate set up:
- For Roche SYBR, add 5uL of samples and standards to appropriate wells
- Add 5uL of EB to wells H11 and H12 for negative controls
- Add 15uL of Master Mix to each well
- Apply sealing foil
- Briefly spin plate down
- For KAPA SYBR Fast, add 2uL of samples and standards to appropriate wells
- Add 2uL of EB to wells H11 and H12 for negative controls
- Add 18uL of Master Mix to each well
- Apply sealing foil
- Briefly spin plate down
We have found that the most effective way to load the plate is:
- prepare the samples and incomplete master mix (containing everything but SYBR green)
- On ice, plate all of the samples and standards
- Add SYBR green to master mix and then add complete master mix to all wells being used
RT-PCR Amplification Protocol
On the LightCycler, we have found that running 30 cycles of amplification is sufficient for library quantification using the Roche SYBR Green (35 cycles for KAPA SYBR)
- Roche SYBR
Activation:
95°C - 5 minutes
Amplification:
95°C – 5 seconds
60°C – 10 seconds The annealing temp can vary, depending on melting temperature of each primer
72°C – 30 seconds
Melting Curve:
95°C - 5 seconds
65°C - 1 minute
97°C
Cooling:
40°C - 30 seconds
- KAPA SYBR
Activation:
95°C - 5 minutes
Amplification:
95°C – 30 seconds
60°C – 45 seconds 1-step annealing/extension
Result Analysis
When run is complete use standard Cp (cycle number at which the amplification curve crosses the threshold) analysis for the machine being used.
If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is to allow for a more stringent threshold for quantifying Illumina libraries.
Look over the amplification plots. If successful amplification has occurred you should see typical sinusoidal amplification for each plot. If the curves start below the 0 mark on the y-axis and appears to amplify around cycle 6, the sample is most likely too concentrated for the machine to accurately quantify the libraries.
Calculate the Standard Curve:
- graph log concentration vs. Cp of your standards:



