BioMicroCenter:RTPCR Protocol for Sample QC

HOME --

SEQUENCING --

LIBRARY PREP --

HIGH-THROUGHPUT --

COMPUTING --

OTHER TECHNOLOGY

This protocol is a slightly modified version of the protocol used at the Broad Institute. The original protocol was developed by Maura Costello. This protocol is similar to the one published in Nature Methods by Quail et al (2008) but uses SYBRgreen instead of Taqman probes.

Proof of Concept

Simultaneous test. Samples were tested for RT-PCR and clustered for sequencing on the same day. Their DNA concentration and the correlation of the concentration as measured by RT-PCR was then compared to their cluster number. All DNA samples had been thought to be at 10nM as determined by Qubit quantification.

Key Notes

• Use forward and reverse primers that match the 5' and 3' linkers used in the Illumina sample prep
• DO NOT FREEZE your samples between preforming RT-PCR and loading the cluster station (they can be left at 4°C for up to 24 hours).
• Standard curve created using serial dilution of PhiX control DNA
• Standard curve must have a R^2 > 0.98
• Notes in red are those specific for the Roche LightCycler 480
• Notes in purple are those that we have found improve the efficiency and results of this protocol

Materials

• Enriched sample libraries (with either paired end or standard adapters)

• Phix 335bp control library (Cat. No. CT-901-1001)

• Qiagen Buffer EB

• Molecular biology grade water

• 10uM Forward Primer: AATGATACGGCGACCACCGA

• 10uM Reverse Primer: CAAGCAGAAGACGGCATACGA

• LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)

• LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001) and Sealing Foil

Remember to turn on the RT-PCR machine before preparing your plate so it can warm up.

Preparing Standards

This procedure creates seven standards ranging from ~20nM to 0.3nM with which to create the standard curve. In preparing these standards 1:100 dilutions are created. After this step the standards are ready to use, they do not need to be diluted any further, and they can be kept at 4° for up to seven days.

• S1 – add 2uL of Phix control to 98uL of EB (1:50)

• S2 – add 50uL of S1 to 50uL of EB (1:100)

• S3 – add 50uL of S2 to 50uL of EB (1:200)

• S4 – add 50uL of S3 to 50uL of EB (1:400)

• S5 – add 50uL of S4 to 50uL of EB (1:800)

• S6 – add 50uL of S5 to 50uL of EB (1:1600)

• S7 – add 50uL of S6 to 50uL of EB (1:3200)

Vortex well and spin down in between each step

Illumina Phix concentrations vary from lot to lot. It is recommended that you pool multiple tubes of Phix, separate them out into one time use aliquots (~2uL) and quantify one aliquot (we use the Qubit to accomplish this). This will allow you to have consistent concentrations across multiple preparations of your standards.

Preparing Samples

• Dilute all samples to ~10nM with EB using previous quantification (bioanalyzer or Qubit are recommended).

• Create 10nM 1:500 stocks of each sample by adding 2uL of 10nM sample to 998uL of EB. If a sample is suspected to be very concentrated (or you do not have a previous quantification) do a 1:1000 dilution by adding 2uL sample to 1998uL EB.

• Make sure to vortex well and spin down each sample

Having a rough idea of the concentrations of your samples helps to avoid loading samples that are too concentrated for the RT-PCR machine to read.

Preparing Master Mix

Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells.

For 1 well:

• Water – 3uL

• PCR Primer Forward (P5), 10uM – 1uL

• PCR Primer Reverse (P7), 10uM – 1uL

• Roche SYBR Green – 10uL

For 45 wells:

• Water – 135uL

• PCR Primer Forward (P5), 10uM – 45uL

• PCR Primer Reverse (P7), 10uM – 45uL

• Roche SYBR Green – 450uL

Flick and spin down master mix after SYBR green has been added

Do not add SYBR Green to master mix until right before use

Master mix may vary depending on type of RT-PCR machine and brand of SYBR green being used

Plate Preparation

Lanes 4 through 10 can be used for additional samples or left empty

Plate set up:

• Add 5uL of samples and standards to appropriate wells
• Add 5uL of EB to wells H11 and H12 for negative controls
• Add 15uL of Master Mix
• Apply sealing foil
• Briefly spin plate down

We have found that the most effective way to load the plate is:

1. prepare the samples and incomplete master mix (containing everything but SYBR green)
2. On ice, plate all of the samples and standards
3. Add SYBR green to master mix and add now complete master mix to all wells being used

RT-PCR Amplification Protocol

Run protocol for 30 cycles (On the LightCycler 480 we have found that most samples amplify and cross threshold between cycles 10 and 20, this may vary on other RT-PCR instruments)

• 95°C – 5 seconds

• 60°C – 10 seconds The annealing temp can vary, primer temp is 58.6 but annealing at 60 was recommended by Roche and the Boyer lab

• 72°C – 30 seconds

The protocol will run on the machine for about one hour

Result Analysis

When run is complete use standard CP (cycle number at which the amplification curve crosses the threshold) analysis for the machine being used.

If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is so the machine will calculate curve with a CP less than 15.

Look over the amplification plots. If successful amplification has occurred you should see typical exponential amplification for each plot. If instead the curves start below the 0 mark on the y-axis and appear to flat line, the sample is most likely too concentrated for the machine.

Calculate the Standard Curve:

• graph log concentration vs. CP of your standards:

• The R2 for the standard curve must be >0.98 or the RT-PCR will have to be repeated. Omit outliers as necessary.

If using standards prepared on a previous day compare the trend line equation to ensure that error has not been introduced

Calculate the Concentration of the Unknown Samples:

• Use the standard curve equation to calculate the log concentration of your unknown samples (x = log concentration, y = CP determined by RT-PCR)

• Solve the log to calculate the concentrations of the unknowns. Multiply the values calculated by 5 since the unknowns are 5 times more dilute than the standards (multiply by 10 if unknowns were diluted at 1:1000)

Using RT-PCR Information to Improve Clustering

We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto the Genome Analyzer for sequencing. We take these concentrations into account during the denaturation step of cluster generation. 2uL of a 10nM sample will be denatured in 17uL EB and 1uL of 2N NaOH for a final volume of 20uL.

For samples that are under 20nM:

• the amount of sample to denature will be calculated (2uL x 10nM = >20nM RT conc x XuL) and the variation from the standard 2uL of 10nM added will be subtracted from the EB added (17uL-(XuL-2uL))

For samples over 20nM:

• Calculate the amount of EB required to dilute 2uL of the sample to 10nM (2uL x <20nM RT conc = X x 10nM, amount EB to add = X - 2) then proceed with denaturation for 10nM samples