BioMicroCenter:RTPCR Protocol for Sample QC: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 147: Line 147:


<span style="color: red">If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is so the machine will calculate curve with a CP less than 15.</span>
<span style="color: red">If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is so the machine will calculate curve with a CP less than 15.</span>


Look over the amplification plots.  If successful amplification has occurred you should see typical exponential amplification for each plot:  
Look over the amplification plots.  If successful amplification has occurred you should see typical exponential amplification for each plot:  
Line 158: Line 157:


(image: Broad Institute, “QPCR Quantitation of up to Sixteen Enriched Illumina Libraries,” 2009)
(image: Broad Institute, “QPCR Quantitation of up to Sixteen Enriched Illumina Libraries,” 2009)


'''Calculate the Standard Curve:'''  
'''Calculate the Standard Curve:'''  
Line 173: Line 171:


* Solve the log to calculate the concentrations of the unknowns.  Multiply the values calculated by 5 since the unknowns are 5 times more dilute than the standards (multiply by 10 if unknowns were diluted at 1:1000).
* Solve the log to calculate the concentrations of the unknowns.  Multiply the values calculated by 5 since the unknowns are 5 times more dilute than the standards (multiply by 10 if unknowns were diluted at 1:1000).
== Using RT-PCR Information to Improve Clustering ==
We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto the Genome Analyzer for sequencing. We take these concentrations into account during the denaturation step of cluster generation.  2uL of a 10nM sample will be denatured in 17uL EB and 1uL of 2N NaOH for a final volume of 20uL. 
For samples that are under 20nM:
* the amount of sample to denature will be calculated (2uL x 10nM = >20nM RT concentration x '''X'''uL) and the variation from the standard 2uL of 10nM added will be subtracted from the EB added (17uL-('''X'''uL-2uL))
* This caculation will sometimes require more sample than is available.  In this instance

Revision as of 14:36, 22 March 2009

HOME -- SEQUENCING -- LIBRARY PREP -- HIGH-THROUGHPUT -- COMPUTING -- OTHER TECHNOLOGY

QPCR Quantification for Solexa Sequencing Libraries

Materials:

  • Enriched sample libraries (with either paired end or standard adapters)
  • Phix 335bp control library (Cat. No. CT-901-1001)
  • Qiagen Buffer EB
  • Molecular biology grade water
  • 10uM Forward Primer: AATGATACGGCGACCACCGA
  • 10uM Reverse Primer: CAAGCAGAAGACGGCATACGA
  • LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)
  • LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001)
  • Light Cycler 480 Sealing Foil (included in Lightcycler plate order)
  • Light Cycler 480 II RT-PCR machine (Roche)

SYBR Green and 96 well plate listed in materials are specific for Roche LightCycler 480, please adjust for use on other RT-PCR machines

Remember to turn on the RT-PCR machine before preparing your plate so it can warm up.


Preparing Standards:

This procedure creates seven standards ranging from ~20nM to 0.3nM with which to create the standard curve. In preparing these standards 1:100 dilutions are created. After this step the standards are ready to use, they do not need to be diluted any further, and they can be kept at 4° for up to seven days.

  • S1 – add 2uL of Phix control to 98uL of EB
  • S2 – add 50uL of S1 to 50uL of EB
  • S3 – add 50uL of S2 to 50uL of EB
  • S4 – add 50uL of S3 to 50uL of EB
  • S5 – add 50uL of S4 to 50uL of EB
  • S6 – add 50uL of S5 to 50uL of EB
  • S7 – add 50uL of S6 to 50uL of EB

Vortex well and spin down in between each step

Illumina Phix concentrations vary from lot to lot. It is recommended that you quantify Phix each time you are preparing a new set of standards. We usually use the Qubit to accomplish this.

Preparing Samples:

  • Dilute all samples to ~10nM with EB using previous quantification (bioanalyzer or Qubit are recommended).
  • Create 10nM 1:500 stocks of each sample by adding 2uL of 10nM sample to 998uL of EB. If a sample is suspected to be very concentrated (or you do not have a previous quantification) do a 1:1000 dilution by adding 2uL sample to 1998uL EB.
  • Make sure to vortex well and spin down each sample

Having a rough idea of the concentrations of your samples helps to avoid loading samples that are too concentrated for the RT-PCR machine to read.


Preparing Master Mix:

Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells.

For 1 well:

  • Water – 3uL
  • PCR Primer Forward (P5), 10uM – 1uL
  • PCR Primer Reverse (P7), 10uM – 1uL
  • Roche SYBR Green – 10uL


For 45 wells:

  • Water – 135uL
  • PCR Primer Forward (P5), 10uM – 45uL
  • PCR Primer Reverse (P7), 10uM – 45uL
  • Roche SYBR Green – 450uL

Flick and spin down master mix after SYBR green has been added

Do not add SYBR Green to master mix until right before use

Master mix may vary depending on type of RT-PCR machine and brand of SYBR green being used

Plate Preparation:

  • Add 5uL of samples and standards to appropriate wells
  • Add 5uL of EB to wells H11 and H12 for negative controls
  • Add 15uL of Master Mix

We have found that the most effective way to load the plate is:

  • prepare the samples and incomplete master mix (containing everything but SYBR green)
  • plate all of the samples and standards
  • then add SYBR green to master mix and add now complete master mix to all wells being used.

We have also found that it is beneficial to “cold load” the plate by preparing it over ice.

Plate set up:

Lanes 4 through 10 can be used for additional samples or left empty

  • Apply sealing foil
  • Briefly spin plate down

RT-PCR Amplification Protocol:

Run protocol for 30 cycles (On the LightCycler 480 we have found that most samples amplify and cross threshold between cycles 10 and 20, this may vary on other RT-PCR instruments)

  • 95°C – 5 seconds
  • 60°C – 10 seconds The annealing temp can vary, primer temp is 58.6 but annealing at 60 was recommended by Roche and the Boyer lab
  • 72°C – 30 seconds

The protocol will run on the machine for about one hour

Result Analysis

When run is complete use standard CP (cycle number at which the amplification curve crosses the threshold) analysis for the machine being used.

If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is so the machine will calculate curve with a CP less than 15.

Look over the amplification plots. If successful amplification has occurred you should see typical exponential amplification for each plot:

50pm

If instead the curves start below the 0 mark on the y-axis and appear to flat line, the sample is most likely too concentrated for the machine:

2pm

(image: Broad Institute, “QPCR Quantitation of up to Sixteen Enriched Illumina Libraries,” 2009)

Calculate the Standard Curve:

  • graph log concentration vs. CP of your standards:

  • The R2 for the standard curve must be >0.98 or the RT-PCR will have to be repeated. Omit outliers as necessary.

If using standards prepared on a previous day compare the trend line equation to ensure that error has not been introduced

Calculate the Concentration of the Unknown Samples

  • Use the standard curve equation to calculate the log concentration of your unknown samples (x = log concentration, y = CP determined by RT-PCR)
  • Solve the log to calculate the concentrations of the unknowns. Multiply the values calculated by 5 since the unknowns are 5 times more dilute than the standards (multiply by 10 if unknowns were diluted at 1:1000).

Using RT-PCR Information to Improve Clustering

We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto the Genome Analyzer for sequencing. We take these concentrations into account during the denaturation step of cluster generation. 2uL of a 10nM sample will be denatured in 17uL EB and 1uL of 2N NaOH for a final volume of 20uL.

For samples that are under 20nM:

  • the amount of sample to denature will be calculated (2uL x 10nM = >20nM RT concentration x XuL) and the variation from the standard 2uL of 10nM added will be subtracted from the EB added (17uL-(XuL-2uL))
  • This caculation will sometimes require more sample than is available. In this instance