BioMicroCenter:IlluminaDataPipeline: Difference between revisions
Tali Mazor (talk | contribs) No edit summary |
|||
(3 intermediate revisions by one other user not shown) | |||
Line 3: | Line 3: | ||
== Basics == | == Basics == | ||
We are currently using the Illumina Pipeline version 1. | We are currently using the Illumina Pipeline version RTA 2.8.0 / OLB 1.8.0 / CASAVA 1.7.0 | ||
An older version of the pipeline manual is available (v1.0)[[Media:Pipeline v1.0 User Guide.pdf | HERE]] | An older version of the pipeline manual is available (v1.0)[[Media:Pipeline v1.0 User Guide.pdf | HERE]]. | ||
The Genome Analyzer Pipeline Software (Pipeline) is a set of utilities designed to perform a complete data analysis of a sequencing run. It is supplied as source code and scripts. Data analysis consists of three steps: image analysis, base calling, and sequence analysis. | The Genome Analyzer Pipeline Software (Pipeline) is a set of utilities designed to perform a complete data analysis of a sequencing run. It is supplied as source code and scripts. Data analysis consists of three steps: image analysis, base calling, and sequence analysis. | ||
Line 37: | Line 37: | ||
=== Software Options === | === Software Options === | ||
While ELAND is extremely fast, it suffers from some significant deficiencies. The largest is the lack of tolerance of errors. Read failure is typically a function of length and it is likely that many nucleotides will have been successfully read before the phasing/pre-phasing or some other error becomes large enough to cause read failure. However, because ELAND is an all or nothing algorithm, it is incapable of handling 'short' reads. Numerous | While ELAND is extremely fast, it suffers from some significant deficiencies. The largest is the lack of tolerance of errors. Read failure is typically a function of length and it is likely that many nucleotides will have been successfully read before the phasing/pre-phasing or some other error becomes large enough to cause read failure. However, because ELAND is an all or nothing algorithm, it is incapable of handling 'short' reads. Numerous researchers have made significant efforts to create improved versions of ELAND. Some of the options: | ||
* '''MAQ''' http://maq.sourceforge.net/ - Maq maps short reads to a reference genome and calls the genotypes from the alignment. It is specificially designed for Illumina-Solexa/AB-SOLiD reads, not for 454 or capillary ones. Key facts about Maq: 1) Maq maps a repeat read randomly, and 2) it gives a probability score (mapping quality) to each alignment. More information is available on the MAQ page. | * '''MAQ''' http://maq.sourceforge.net/ - Maq maps short reads to a reference genome and calls the genotypes from the alignment. It is specificially designed for Illumina-Solexa/AB-SOLiD reads, not for 454 or capillary ones. Key facts about Maq: 1) Maq maps a repeat read randomly, and 2) it gives a probability score (mapping quality) to each alignment. More information is available on the MAQ page. | ||
* '''Bowtie''' - The Burge Lab is currently analyzing the quality of reads mapped using Bowtie. Bowtie is believed to be MUCH faster then ELAND. | * '''Bowtie''' - The Burge Lab is currently analyzing the quality of reads mapped using Bowtie. Bowtie is believed to be MUCH faster then ELAND. | ||
Line 58: | Line 56: | ||
If you are running a ''paired end'' run, some additional parameters are useful further down. | If you are running a ''paired end'' run, some additional parameters are useful further down. | ||
* Relative orientation statistics. Here, you want to look at the ''>'' and ''<'' signs. "><" reads are pointing to each other while all other configurations (<<,>>,<>) suggest some type of rearangement has caused the reads to point either in parallel or become divergent. | * Relative orientation statistics. Here, you want to look at the ''>'' and ''<'' signs. "><" reads are pointing to each other while all other configurations (<<,>>,<>) suggest some type of rearangement has caused the reads to point either in parallel or become divergent. | ||
* | * Insert statistics: The software calculates the median insert size (of the >< reads) and the std. deviation. The software then calculates out reads that are statistically too large or too small to be expected from the distribution. these reads have the possibility of representing IN/DEL regions. | ||
*'''Reads that fail these thresholds are reported in the s_N_anomaly.txt file''' | *'''Reads that fail these thresholds are reported in the s_N_anomaly.txt file''' | ||
We will be working on additional QC metrics that can be reported in the coming months. | We will be working on additional QC metrics that can be reported in the coming months. | ||
== Output Files == | == Output Files == | ||
Line 79: | Line 76: | ||
ZZZZZZZZZZZZZZZZZYZZZUZZZYZUZUVVVSV | ZZZZZZZZZZZZZZZZZYZZZUZZZYZUZUVVVSV | ||
'''_export.txt''' | '''_export.txt and _sorted.txt''' | ||
Export.txt files include all clusters. Sorted.txt file includes only reads passing filter and mapping uniquely to the genome. | |||
HWI-EAS413 24 8 82 1319 1073 0 1 AACTGCCAGTTGTGCCAGCTCCATTTTGAAAAAGG a`a`_``W]Y^_Y]a][\_]__^\^_\^VY^Z\^Y chr10.fa3004659 F 35 5 | |||
HWI-EAS413 24 8 30 1221 382 0 1 TCCACAAAATAGAAGCAGAAGGGACTCTACCCTTC abbbbbabbb_b^`bbab`_a`aabaaabaaaaaa chr10.fa3005954 R 35 11 | |||
HWI-EAS413 24 8 66 1593 1942 0 1 TCCAGAGCCTGATGCTCGTCACAACTCTGCTCACT abab[`[aa_aa[Ua[_PTaaaa\\YZTRXU`[[U chr10.fa3012198 R 35 112 | |||
HWI-EAS413 24 8 74 745 561 0 1 AGTCTCTGCTCCATTTTCATCCCTGCATTTCCTTT abbbbbbbbbbaZabbba^aaababaaabaaaaab chr10.fa3020132 R 35 15 | |||
HWI-EAS413 24 8 65 1587 440 0 1 AGTCATCCATCTGAGAACACCTTCCAGGTCCTGGA `]`baabba`ba_a^_Za_ba_aaa][XUba_TZY chr10.fa3023984 R 35 67 | |||
HWI-EAS413 24 8 99 224 363 0 1 TGTGTAATGCCCAAATATCAGTTCTAAATAGGTCA aa`a``_aaaaa^^^`Z``^a_`_`YWW_W``]_X chr10.fa3026498 F 35 113 | |||
HWI-EAS413 24 8 15 1636 1926 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA aaaaaaaaaaaaaaaaa_a__^a_a``^_a````X chr10.fa3026790 F 35 52 | |||
HWI-EAS413 24 8 33 622 1685 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA aababaaabaaaaaaaa^aaaaa`a`a`aaa``aa chr10.fa3026790 F 35 53 | |||
HWI-EAS413 24 8 84 237 1877 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA ^aaababa_aabaaaaaaaa^R^`aaaaaaaa_aa chr10.fa3026790 F 35 39 | |||
HWI-EAS413 24 8 60 1470 635 0 1 TCGTGACGAGTAAAGCAGTCTCTCTTAGCTCTGTC aba^`bb``a`_P`^]XX[aaa`a`]]U``a\TT_ chr10.fa3031823 F 35 113 | |||
FIELDS | |||
# Machine (Parsed from Run Folder name) | |||
# Run Number (Parsed from Run Folder name) | |||
# Lane | |||
# Tile | |||
# X Coordinate of cluster | |||
# Y Coordinate of cluster | |||
# Index string (Bland for a non-indexed run) | |||
# Read number (1 or 2 for paired-read analysis, blank for a single-read analysis) | |||
# Read | |||
# Quality string—In symbolic ASCII format (ASCII character code = quality value + 64. B-F = low) | |||
# Match chromosome—Name of chromosome match OR code indicating why no match resulted | |||
# Match Contig—Gives the contig name if there is a match and the match chromosome is split into contigs (Blank if no match found) | |||
# Match Position—Always with respect to forward strand, numbering starts at 1 (Blank if no match found) | |||
# Match Strand—“F” for forward, “R” for reverse (Blank if no match found) | |||
# Match Descriptor—Concise description of alignment (Blank if no match found). A numeral denotes a run of matching bases and a letter denotes substitution of a nucleotide. For a 35 base read, “35” denotes an exact match and “32C2” denotes substitution of a “C” at the 33rd position | |||
# Single-Read Alignment Score—Alignment score of a single-read match, or for a paired read, alignment score of a read if it were treated as a single read. Blank if no match found; any scores less than 4 should be considered as aligned to a repeat | |||
# Paired-Read Alignment Score—Alignment score of a paired read and its partner, taken as a pair. Blank if no match found; any scores less than 4 should be considered as aligned to a repeat | |||
# Partner Chromosome—Name of the chromosome if the read is paired and its partner aligns to another chromosome (Blank for single-read analysis) | |||
# Partner Contig—Not blank if read is paired and its partner aligns to another chromosome and that partner is split into contigs (Blank for single-read analysis) | |||
# Partner Offset—If a partner of a paired read aligns to the same chromosome and contig, this number, added to the Match Position, gives the alignment position of the partner (Blank for single-read analysis) | |||
# Partner Strand—To which strand did the partner of the paired read align? “F” for forward, “R” for reverse (Blank if no match found, blank for single-read analysis) | |||
# Filtering—Did the read pass quality filtering? “Y” for yes, “N” for no | |||
'''''_eland_results.txt'''''<br>'''obsolete!''' | '''''_eland_results.txt'''''<br>'''obsolete!''' | ||
Line 175: | Line 206: | ||
. | . | ||
[[BioMicroCenter:DataArchiving]] |
Latest revision as of 12:14, 13 January 2011
HOME -- | SEQUENCING -- | LIBRARY PREP -- | HIGH-THROUGHPUT -- | COMPUTING -- | OTHER TECHNOLOGY |
Basics
We are currently using the Illumina Pipeline version RTA 2.8.0 / OLB 1.8.0 / CASAVA 1.7.0
An older version of the pipeline manual is available (v1.0) HERE.
The Genome Analyzer Pipeline Software (Pipeline) is a set of utilities designed to perform a complete data analysis of a sequencing run. It is supplied as source code and scripts. Data analysis consists of three steps: image analysis, base calling, and sequence analysis.
1. Image analysis (Firecrest)—Uses the raw TIF files to locate clusters on the image, and outputs the cluster intensity, X,Y positions, and an estimate of the noise for each cluster. The output from image analysis provides the input for base calling.
2. Base calling (Bustard)—Uses cluster intensities and noise estimate to output the sequence of bases read from each cluster, along with a confidence level for each base.
3. Sequence analysis (Gerald and Eland)—Allows for alignment to a reference sequence, filtering of data based on predefined criteria, and visualization of the result.
Base Calling
Firecrest is the module used for image analysis. Firecrest identifies cluster positions and extracts intensities. Through image filtering, it sharpens and enhances clusters, removes background noise, and detects clusters based on morphological features on the image. Firecrest also adjusts the scale and registration of an image. Firecrest is currently performed in real time with the sequencing process on a dedicated IPARR server as part of the 1.0 pipeline.
Bustard is the module used for base calling. Bustard deconvolves the signal from the clusters and applies correction for cross-talk, phasing, and prephasing.
- Frequency cross-talk—The Genome Analyzer uses two lasers and four filters to detect four dyes attached to the four types of nucleotide, respectively. The frequency emission of these four dyes overlaps so that the four images are not independent. The frequency cross-talk is deconvolved using a frequency cross-talk matrix.
- Phasing/Prephasing—Depending on the efficiency of the fluidics and the sequencing reactions, a small number of molecules in each cluster may run ahead (prephasing) or fall behind (phasing) of the current incorporation cycle. This effect is mitigated by applying corrections during the base calling step.
- All of these corrections are based on an assumption of equal base frequency. For this reason, Illumina recommends the inclusion of the PhiX control sample in all runs (7+1). Work is currently under way at the [Broad Institute] to create defined spiked in DNA templates with equal base frequency that can act as control reads, however, this has not yet been incorporated into the pipeline.
Alignment
Generation of Recursive Analyses Linked by Dependency (GERALD) is the module used for sequence alignment, data visualization, filtering, and alignment. The following two alignment programs work within the GERALD module:
- Efficient Large-Scale Alignment of Nucleotide Databases (ELAND) is very fast and aligns for up to two errors from a reference for the first 32 bases. This algorithm is used for any reference larger than 100 kb.
- PhageAlign does an exhaustive alignment (all possible alignments up to arbitrary edit distances), but is slow.
Software Options
While ELAND is extremely fast, it suffers from some significant deficiencies. The largest is the lack of tolerance of errors. Read failure is typically a function of length and it is likely that many nucleotides will have been successfully read before the phasing/pre-phasing or some other error becomes large enough to cause read failure. However, because ELAND is an all or nothing algorithm, it is incapable of handling 'short' reads. Numerous researchers have made significant efforts to create improved versions of ELAND. Some of the options:
- MAQ http://maq.sourceforge.net/ - Maq maps short reads to a reference genome and calls the genotypes from the alignment. It is specificially designed for Illumina-Solexa/AB-SOLiD reads, not for 454 or capillary ones. Key facts about Maq: 1) Maq maps a repeat read randomly, and 2) it gives a probability score (mapping quality) to each alignment. More information is available on the MAQ page.
- Bowtie - The Burge Lab is currently analyzing the quality of reads mapped using Bowtie. Bowtie is believed to be MUCH faster then ELAND.
Interpreting your results
Summary.htm
The Summary.htm file is the basic quality control file associated with your run. The information in the lane results summary section is the best place to begin. The key pieces of informaiton are:
- Clusters (raw): The number of clusters detected by the image analysis module of the Pipeline software
- Clusters (PF): The number of clusters detected that meet the filtering parameters. These filtering parameters are adjustable *** add info on filtering parameters ***
- % Align (PF): The percentage of filtered reads that were uniquely aligned to the reference genome.
- % Error Rate (PF): The percentage of called bases in aligned reads that do not match the reference. This does not mean the base calls are incorrect, simply that they are not aligned.
Note that the intensity scores have lost most of their utility with the 1.3.2 Pipeline software.w
If you are running a paired end run, some additional parameters are useful further down.
- Relative orientation statistics. Here, you want to look at the > and < signs. "><" reads are pointing to each other while all other configurations (<<,>>,<>) suggest some type of rearangement has caused the reads to point either in parallel or become divergent.
- Insert statistics: The software calculates the median insert size (of the >< reads) and the std. deviation. The software then calculates out reads that are statistically too large or too small to be expected from the distribution. these reads have the possibility of representing IN/DEL regions.
- Reads that fail these thresholds are reported in the s_N_anomaly.txt file
We will be working on additional QC metrics that can be reported in the coming months.
Output Files
_sequence.txt
Fastq format sequence information
Example File:
@HWI-EAS413_4:1:5:1004:56 <= Sequence name - lane:read(1|2):tile:X:Y GTTTCATTTCTAAACCTGTTTCATTACAAAATGCC <= Sequence +HWI-EAS413_4:1:5:1004:56 <= repeat of name ZVZZVZZZZZVZSZZLZFZZZVVZLSZSZZQVLVT <= ASCII quality score. A = low, Z(or other symbol) = high. @HWI-EAS413_4:1:5:1350:118 GACCTTTTGCTTGTTTTGAGAGTGAGGGAAAAGGA +HWI-EAS413_4:1:5:1350:118 ZZZZZZZZZZZZZZZZZYZZZUZZZYZUZUVVVSV
_export.txt and _sorted.txt Export.txt files include all clusters. Sorted.txt file includes only reads passing filter and mapping uniquely to the genome.
HWI-EAS413 24 8 82 1319 1073 0 1 AACTGCCAGTTGTGCCAGCTCCATTTTGAAAAAGG a`a`_``W]Y^_Y]a][\_]__^\^_\^VY^Z\^Y chr10.fa3004659 F 35 5 HWI-EAS413 24 8 30 1221 382 0 1 TCCACAAAATAGAAGCAGAAGGGACTCTACCCTTC abbbbbabbb_b^`bbab`_a`aabaaabaaaaaa chr10.fa3005954 R 35 11 HWI-EAS413 24 8 66 1593 1942 0 1 TCCAGAGCCTGATGCTCGTCACAACTCTGCTCACT abab[`[aa_aa[Ua[_PTaaaa\\YZTRXU`[[U chr10.fa3012198 R 35 112 HWI-EAS413 24 8 74 745 561 0 1 AGTCTCTGCTCCATTTTCATCCCTGCATTTCCTTT abbbbbbbbbbaZabbba^aaababaaabaaaaab chr10.fa3020132 R 35 15 HWI-EAS413 24 8 65 1587 440 0 1 AGTCATCCATCTGAGAACACCTTCCAGGTCCTGGA `]`baabba`ba_a^_Za_ba_aaa][XUba_TZY chr10.fa3023984 R 35 67 HWI-EAS413 24 8 99 224 363 0 1 TGTGTAATGCCCAAATATCAGTTCTAAATAGGTCA aa`a``_aaaaa^^^`Z``^a_`_`YWW_W``]_X chr10.fa3026498 F 35 113 HWI-EAS413 24 8 15 1636 1926 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA aaaaaaaaaaaaaaaaa_a__^a_a``^_a````X chr10.fa3026790 F 35 52 HWI-EAS413 24 8 33 622 1685 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA aababaaabaaaaaaaa^aaaaa`a`a`aaa``aa chr10.fa3026790 F 35 53 HWI-EAS413 24 8 84 237 1877 0 1 AAACATTTATGAAATTGTCAAAGAACAAAAAACAA ^aaababa_aabaaaaaaaa^R^`aaaaaaaa_aa chr10.fa3026790 F 35 39 HWI-EAS413 24 8 60 1470 635 0 1 TCGTGACGAGTAAAGCAGTCTCTCTTAGCTCTGTC aba^`bb``a`_P`^]XX[aaa`a`]]U``a\TT_ chr10.fa3031823 F 35 113
FIELDS
- Machine (Parsed from Run Folder name)
- Run Number (Parsed from Run Folder name)
- Lane
- Tile
- X Coordinate of cluster
- Y Coordinate of cluster
- Index string (Bland for a non-indexed run)
- Read number (1 or 2 for paired-read analysis, blank for a single-read analysis)
- Read
- Quality string—In symbolic ASCII format (ASCII character code = quality value + 64. B-F = low)
- Match chromosome—Name of chromosome match OR code indicating why no match resulted
- Match Contig—Gives the contig name if there is a match and the match chromosome is split into contigs (Blank if no match found)
- Match Position—Always with respect to forward strand, numbering starts at 1 (Blank if no match found)
- Match Strand—“F” for forward, “R” for reverse (Blank if no match found)
- Match Descriptor—Concise description of alignment (Blank if no match found). A numeral denotes a run of matching bases and a letter denotes substitution of a nucleotide. For a 35 base read, “35” denotes an exact match and “32C2” denotes substitution of a “C” at the 33rd position
- Single-Read Alignment Score—Alignment score of a single-read match, or for a paired read, alignment score of a read if it were treated as a single read. Blank if no match found; any scores less than 4 should be considered as aligned to a repeat
- Paired-Read Alignment Score—Alignment score of a paired read and its partner, taken as a pair. Blank if no match found; any scores less than 4 should be considered as aligned to a repeat
- Partner Chromosome—Name of the chromosome if the read is paired and its partner aligns to another chromosome (Blank for single-read analysis)
- Partner Contig—Not blank if read is paired and its partner aligns to another chromosome and that partner is split into contigs (Blank for single-read analysis)
- Partner Offset—If a partner of a paired read aligns to the same chromosome and contig, this number, added to the Match Position, gives the alignment position of the partner (Blank for single-read analysis)
- Partner Strand—To which strand did the partner of the paired read align? “F” for forward, “R” for reverse (Blank if no match found, blank for single-read analysis)
- Filtering—Did the read pass quality filtering? “Y” for yes, “N” for no
_eland_results.txt
obsolete!
Alignment information for reads.
Sequence ID Sequence Read SCORE #0mm #1mm #2mm CHR HIT POS HIT STRND unk. MISMATCH
>HWI-EAS413_4:1:100:825:1989 CTAGAAGCAGAAGCAGGTATTTGGGGGGAGGGTTG R0 3 0 0 >HWI-EAS413_4:1:100:1076:1671 AACTGCTTTGAGATAGGGTCTCTCTTGTTCACTTT NM 0 0 0 >HWI-EAS413_4:1:100:573:1957 TCGAGACGTAAACTAGCTAACCTACATTATCCCCT NM 0 0 0 >HWI-EAS413_4:1:100:1784:660 AATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA R0 204 255 255 >HWI-EAS413_4:1:100:133:987 CGCGATGATGTCTCAATACACCCCCCCGCTACCAG NM 0 0 0 >HWI-EAS413_4:1:100:1361:1636 CATGTCATGCGCTCTAATCTCTGGGCATCTTGAGA NM 0 0 0 >HWI-EAS413_4:1:100:1733:932 CCGAACTTCTGACAGGTTTGAGCCTTCTGCTCAAG U1 0 1 0 chr9.fa 110761807 F DD 13A >HWI-EAS413_4:1:100:992:1902 CAATTAAATAATAATAAACTAACACACAATACAAA NM 0 0 0 >HWI-EAS413_4:1:100:1230:1718 TCAGCAAACAAACCCCCAACATAAAATCCATTATG NM 0 0 0 >HWI-EAS413_4:1:100:324:130 TCATCGAGAGGGGACTGAAGTGGAAGCTAGTCAGC U0 1 0 0 chr14.fa 33191761 F DD
Sequence ID: From the sequence.txt file
Sequence Read: self explanatory
Score: 8 possible scores:
- U0,U1,U2 - unique hit in the genome with 0, 1, or 2 mismatches
- R0,R1,R2 - multiple hit in the genome with 0, 1, or 2 mismatches
- NM - No match
- QC - failed quality score
0,1,2mm: Number of times the sequence was found in the genome with 0, 1 or 2 mismatches. max=255
Chr/Pos Hit: Location of the read in the genome (low number based on 36nt). Only reported for U0, U1, U2.
Strand: Strand hit (F or R) Note: a hit a pos 1000 with a R actually has its 5' end at 1035!
Mismatch: Position of the mismatch (eg 13A = pos13 should be an A). listed as in sequence.
_realign.txt
obsolete!
Final quality-filtered sequence alignments
sequence read score #hit Chr:Pos Strd best match next best score CCACAAAGTTCAGATGAGGGTGGGTGTTGCTTGTT 17500 1 chrX:116488401 F CCACAAAGTTCAGATGAGGGTGGGTGTTGCTTGTT 14359 AGACTGGCCTGCCTCTGCCTCCTGAGTACTGAGAC 17500 1 chr8:73831045 R GTCTCAGTACTCAGGAGGCAGAGGCAGGCCAGTCT 16453 CTTGGGCTACCAGGCCTGGTTAGCCCACTCCCGCT 17500 1 chrX:95524949 R AGCGGGAGTGGGCTAACCAGGCCTGGTAGCCCAAG 14359 CAGAAAGGAGCAAGAATCCGCTAAGCAGGGCCGGG 17500 1 chr11:119057429 R CCCGGCCCTGCTTAGCGGATTCTTGCTCCTTTCTG 14359 ACTATTTCACAAAATAGAAGTAGAAGGTACTCTAC 17500 255 GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGC 0 0 CTATTGTGAATCATACTTCAATGAACATGAGTATG 0 0 CTAGAAGCAGAAGCAGGTATTTGGGGGGAGGGTTG 17500 3 CCGAACTTCTGACAGGTTTGAGCCTTCTGCTCAAG 16453 1 chr9:110761807 F CCGAACTTCTGAAAGGTTTGAGCCTTCTGCTCAAG 14359 TCATCGAGAGGGGACTGAAGTGGAAGCTAGTCAGC 17500 1 chr14:33191761 F TCATCGAGAGGGGACTGAAGTGGAAGCTAGTCAGC 14359
Executing the Pipeline
Parameter File
The parameter file contains information about the pipeline for GERALD. This is an example file:
12345678:ANALYSIS eland_extended 12345678:ELAND_SEED_LENGTH 25 123:ELAND_GENOME /data/Genome/Eland/RefGenome_Eland_sacCersgd 5:ELAND_GENOME /data/Genome/Eland/RefGenome_Eland_PhiX 4678:ELAND_GENOME /data/Genome/Eland/RefGenome_Eland_mm9 USE_BASES Y*n ELAND_MULTIPLE_INSTANCES 4
ANALYSIS TYPES = eland_extended (>32nt), eland_paired, eland_tag, sequence (no alignment), or none (failed lanes only)
- "eland" is no longer supported in 1.3.2, so keep 1.0 around if you want to keep iterative ELAND.
USE_BASE = Y*n is the standard, using every base except the last but is mutable. For example, if you must omit the first two bases, you could insert nnY*n instead.
- Multiplex: Using multiplex can be done with the I tag. For example Y*nI6n would take all bases upto the final 8 with the middle 6 being used as the index.
ELAND_MULTIPLE_INSTANCES can only be 1,2,4,8. Using any other value will default to 1.
Pipeline Execution
The following commands will execute the pipeline on the BMC servers.
$ cd /mnt/bmc-store/current/run<1-4>/<DATE_HWI->/ $ /data/apps/pkg/GAPipeline/GAPipeline-1.0/Goat/goat_pipeline.py --GERALD=<parameter file> --control-lane=<phiX> Images/ or IPARR/ or $ /data/apps/pkg/GAPipeline/GAPipeline-1.3.2/bin/goat_pipeline.py --GERALD=<parameter file> --control-lane=<phiX> Images/ or $ /data/apps/pkg/GAPipeline/GAPipeline-1.3.2/bin/bustard.py --GERALD=<parameter file> --control-lane=<phiX> Data/IPAR_1.3/
Use "--control-lane=" to select a lane <n> that is to be used to estimate phasing and matrix correction for all other lanes. Control lanes are necessary for samples with skewed base compositions.
if you execute without errors, proced to make the pipeline
$ /data/apps/pkg/GAPipeline/GAPipeline-1.0/Goat/goat_pipeline.py --GERALD=<parameter file> --control-lane=<phiX> --make Images/ or IPARR/ or $ /data/apps/pkg/GAPipeline/GAPipeline-1.3.2/bin/goat_pipeline.py --GERALD=<parameter file> --control-lane=<phiX> --make Images/ or $ /data/apps/pkg/GAPipeline/GAPipeline-1.3.2/bin/bustard.py --GERALD=<parameter file> --control-lane=<phiX> Data/IPAR_1.3/
Move to the Firecrest Directory (for 1.0) or Bustard directory (for 1.3.2):
$ cd Data/C1-36_Firecrest.... or $ cd Data/IPAR_1.3/Bustard... then $ make recursive -j8 >& <DATE>_Analysis.log &
.