BME494s2013 Project Template: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(14 intermediate revisions by the same user not shown)
Line 26: Line 26:
==Overview & Purpose==
==Overview & Purpose==
<!-- Below is the code for making a thumbnail image to embed in your text. See BME494_Wiki_Help for help with uploading images to OpenWetWare and using them on your page.-->
<!-- Below is the code for making a thumbnail image to embed in your text. See BME494_Wiki_Help for help with uploading images to OpenWetWare and using them on your page.-->
[[Image:oww.jpg|thumb|140px||left|xylR protein structure]]  
[[Image:CirEmblemHandwriteLogo2.png|thumb|140px||left|Text describing the image]]  


<!-- This is where you can get creative. Think of a practical application for a genetic input/ output switch that is based on the Lac switch you designed. Perhaps it can generate some useful compound instead of RFP/ GFP? Perhaps you could replace the Lac Repressor/ promoter part with something that binds to a different compound to make a sensor? Type a "10,000 foot" overview of your project below this comment line. What is your project's impact on the world? -->
<!-- This is where you can get creative. Think of a practical application for a genetic input/ output switch that is based on the Lac switch you designed. Perhaps it can generate some useful compound instead of RFP/ GFP? Perhaps you could replace the Lac Repressor/ promoter part with something that binds to a different compound to make a sensor? Type a "10,000 foot" overview of your project below this comment line. What is your project's impact on the world? -->


<!-- In the next paragraph, explain how the IPTG-input/ fluorescent protein-output Lac switch you proposed to build (in Unit 2) serves as a roof-of-concept for the practical application you just described -->
<!-- In the next paragraph, explain how the IPTG-input/ fluorescent protein-output Lac switch you proposed to build (in Unit 2) serves as a roof-of-concept for the practical application you just described -->
<br><br><br><br><br><br><br><br>
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->


==Background==
==Background==
[[Image:group1background2.jpg|thumb|frame|left|Fracking]]  
[[Image:CirEmblemHandwriteLogo2.png|thumb|140px||left|Text describing the image]]


Hydraulic fracturing or “fracking” is a way that allows for the retrieval of natural gases or oil from below the surface that were unsalvageable through the use of drilling. The process begins when a hole has been drilled into the surface containing the desired substance, and then a pipe with holes where the target substances are is placed into the cavity and flushed with fracturing fluid or gas, which cause the rock formations containing the natural resources to break. Once the surrounding earth crumbles due to the increasing pressure, the fracturing fluid flow is cut off and proppants (sand or ceramic beads) that were pumped in with the fracturing fluid hold the crevices open and the target materials flow up to the surface.
<!-- Background information on the natural Lac operon. This should be based on Group Presentation 2 -->
Fracturing fluids that are commonly used include chemicals that can do a lot of harm due to their toxicity, such as diesel, which contains a lot of carcinogenic substances such as benzene and other dangerous materials like ethylbenzene, xylene and toluene. It has been observed that approximately 20 to 85 percent of these chemicals stay beneath the surface after they are pumped in and that these chemicals can then find their way into water sources which can result in harm to farms that use those water sources for their animals. [1]


<br>


==Proof of Concept Design==
<br><br><br><br><br><br><br><br><br><br><br><br>
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->
 
==Design: Our genetic circuit==


<!--Delete the line items that do not apply to your project -->
<!--Delete the line items that do not apply to your project -->


* '''New Natural Part''':  In the pseudomonas putida F1 bacterium, the regulatory protein XylR activates the promoter Pu of the TOL (toluene degradation) plasmid pWW0 in the presence of toluene, xylenes and other structural analogues. Xylr is a  regulatory protien  that is under constituative expression of the Pr promoter. When no toluene or benzene- compounds are present, the xylR protein represses the Pr promoter. When toluene is present it binds with the toluene to activate the Pu promoter. This part is being used because toulene/benzene like compounds bind to the protein and therefore can be used as a biosensor. The NCBI database was used to find the genome for the xylr protein, but journal articles were also explored to find a natural part that could be used for our project. Our project is very similar to the Michigan 2009 iGEM team.
'''OUR GENE SWITCH''':   
 
<!-- Show a network/ circuit diagram of your team's Lac switch. Include a paragraph to explain how it works (i.e., how to switch the system from on to off and vice versa, and what happens to each component as the system switches between states) -->
 
[[Image:CirEmblemHandwriteLogo2.png|300px|Text describing the image]]
 
 
 
 
<br><br><br><br><br><br><br><br><br>
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->
 
==Building: Assembly Scheme==
 
<!-- Illustrate and describe how you will build your lac switch. Incorporate information from Group Presentation 2 -->
 


* '''Key Pre-existing Part''': We are currently using biobrick parts that was used for a similar project. The Pu and Pr promoters was created by the Michigan 2009 iGEM team. Because the projects are very similar, we hope to differentiate our project in the long-term by incorporating our constructed biobrick into a plant. When toulene or other aromatic compounds bind to the xylr protein, the plant would turn red. Right now, we are just testing our proof-of-concept in E.coli.


*'''Primers''':
Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’
<br>
Reverse Primer: 3’->TCGAACTGGGGTCGAATAGA TACTAGTAGCGGCCGCTGCAG->5’
<br>
Silent Mutagenesis Primer: '''5’->TACGAGCTACAGACCCAG->3'''


[[Image:group1proofofconcept.jpg|300px]]
<br>


<!--Draw out plasmids, restriction digests, antibiotics used, etc. -->


'''Assembly Scheme'''


[[Image:group1assembly001.jpg|400px]] [[Image:group1assembly02.jpg|400px]]


<br>
<br><br><br><br><br><br><br><br><br><br><br><br>
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->


==Testing==
==Testing: Modeling and GFP Imaging==


<br>
<br>
'''Measurement'''
'''A LAC SWITCH MODEL'''
<br>
<br>
<!--How are you measuring function? Which fluorescence system? Describe procedure-->
We used a previously published synthetic switch, developed by Ceroni et al., to understand how our system could potentially be modeled and simulated.
<!-- Continue this paragraph by explaining to a non-specialist what a mathematical model is and what parameter values are, in general. Include your network diagram illustration of the Ceroni et al. model and list all of the parameters you were able to map onto the model -->


For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene.


'''AN INTERACTIVE MODEL'''
<br>
<br>
'''Expected Observations [4]'''
We used a model of the natural Lac operon to understand how changing the parameter values changes the behavior of the system.
<!-- Continue this paragraph by explaining how you interacted with the MatLab model. Include two or more images showing different output curves that were generated when you altered the IPTG concentration -->
 
 
'''COLLECTING EMPIRICAL VALUES TO IMPROVE THE MODEL'''
<br>
<br>
<!--Make some "mock data" to demonstrate sound experimental design (controls, significance, etc.)-->
We explored how one technique, imaging via microscopy could be used to determine the production rate of an output protein, in this case GFP in yeast, could be used to determine a "real" value for maximum GFP production rate under our own laboratory conditions.
[[Image:group1testing01.jpg|400px]] [[Image:group1testing02.jpg|400px]]
 
<!-- Describe summarize how you measured GFP intensities, plotted charts in MatLab, make a curve of best fit, and tried to determine the maximum rate of GFP production. You don't have to include your raw values, just the graphs and equations. You may include some small images of the GFP-expressing yeast. If you didn't get a nice peak, explain how your image analysis might be changed to improve your outcome. -->


<br>
<br>
'''Tuning Our System'''
Ideally, the GFP production rate measured by this method could be entered as a value for [which parameter] in the Ceroni et al. model.
 
 
 


For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system.
<br>
<!--Explain how you have built in "tunability". Explain expected changes in data. Draw how the graphs would change -->
[[Image:group1testing2.jpg|400px]]  [[Image:group1testing03.jpg|400px]]


<br>
<br><br><br><br><br><br><br><br>


==Human Practices==
==Human Practices==
Line 96: Line 113:


<!--Wait until Unit 3 to fill this in. Demonstrate that you have considered the societal aspects of your project - what could go wrong? Is it implementable? Etc.-->
<!--Wait until Unit 3 to fill this in. Demonstrate that you have considered the societal aspects of your project - what could go wrong? Is it implementable? Etc.-->
The human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced.
 
 
<br><br><br><br><br><br><br><br><br><br><br><br>


==Our Team==
==Our Team==
Line 102: Line 121:


<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
[[Image:bradylaughlin.jpg|thumb|noframe|130px|left|'''Brady Laughlin''']]  
[[Image:BME194_profile.jpg |thumb|noframe|130px|left|'''Your Name''']]  
 




*My name is Brady Laughlin, and I am a freshman majoring in biomedical engineering. I am taking BME 494 because I am interested in synthetic biology and its many applications. I'm also a member of the Haynes Lab at ASU and I have my own research project. An interesting fact about me is that I have a twin brother.  
* My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.  


</div>
</div>
Line 114: Line 132:


<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
[[Image:christinaforrey.jpg|thumb|noframe|140px|left|'''Christina Forrey''']]
[[Image:BME194_profile.jpg |thumb|noframe|130px|left|'''Your Name''']]  
 


* My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.


* Hello, I am Christina and I am a sophomore in biomedical engineering.  I decided to sign up for this course because synthetic biology is truly interesting to me and I wanted to further enhance my education on the subject.  An interesting fact about me is that I am a tae-kwon-do black belt.</div>
</div>
<br>
<br>


<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
[[Image:davidmedina.jpg|thumb|noframe|140px|left|'''David Medina''']]
[[Image:BME194_profile.jpg |thumb|noframe|130px|left|'''Your Name''']]  




* My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.
</div>
<br>


* My name is David Medina, I am a senior biomedical engineering major at Arizona State University. I decided to take this introductory course to synthetic biology because it sounded like an interesting topic and I wanted to learn more about this up and coming field. An interesting fact about me is that me and my youngest brother were born on the same day, five years apart.




<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px">
[[Image:benjaminschmitz.jpg|thumb|noframe|130px|left|'''Benjamin Schmitz''']]  
[[Image:BME194_profile.jpg |thumb|noframe|130px|left|'''Your Name''']]  


* Hey all, I'm Ben Schmitz. I am a mega-senior nearing completion of my biomedical engineering bachelors at ASU. I am taking this course as the penultimate technical elective course of my educational career. An interesting fact about me is that I am getting married in Oregon in September.


* My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.
</div>
<br>




</div>
<br><br><br>
<br><br><br>


==Works Cited==
==Works Cited==
[1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>.
[1] Full reference.


[2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>.
[2] Full reference.


[3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>.
[3] Full reference.


[4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>.


[5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>.
|}

Latest revision as of 15:36, 22 April 2013


Home        People        Course Projects        Course Materials        Schedule        Photos        Wiki Editing Help

      

Overview & Purpose

Text describing the image












Background

Text describing the image














Design: Our genetic circuit

OUR GENE SWITCH:


Text describing the image












Building: Assembly Scheme













Testing: Modeling and GFP Imaging


A LAC SWITCH MODEL
We used a previously published synthetic switch, developed by Ceroni et al., to understand how our system could potentially be modeled and simulated.


AN INTERACTIVE MODEL
We used a model of the natural Lac operon to understand how changing the parameter values changes the behavior of the system.


COLLECTING EMPIRICAL VALUES TO IMPROVE THE MODEL
We explored how one technique, imaging via microscopy could be used to determine the production rate of an output protein, in this case GFP in yeast, could be used to determine a "real" value for maximum GFP production rate under our own laboratory conditions.



Ideally, the GFP production rate measured by this method could be entered as a value for [which parameter] in the Ceroni et al. model.











Human Practices

Danger of Chemicals in Farmlands














Our Team

Your Name


  • My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.



Your Name


  • My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.



Your Name


  • My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.



Your Name


  • My name is ###, and I am a ### majoring in ###. I am taking BME 494 because ###. An interesting fact about me is that ###.






Works Cited

[1] Full reference.

[2] Full reference.

[3] Full reference.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=BME494s2013_Project_Template&oldid=693517"