BME494s2013 Project Template

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Genetic Switch Designs)
Line 48: Line 48:
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed -->
-
==Genetic Switch Designs==
+
==Design: Our genetic circuit==
<!--Delete the line items that do not apply to your project -->
<!--Delete the line items that do not apply to your project -->
'''OUR GENE SWITCH''':   
'''OUR GENE SWITCH''':   
-
<!-- Show a network/ circuit diagram of your team's Lac switch. Include a paragraph to explain how it works -->
+
 
 +
<!-- Show a network/ circuit diagram of your team's Lac switch. Include a paragraph to explain how it works (i.e., how to switch the system from on to off and vice versa, and what happens to each component as the system switches between states) -->
[[Image:CirEmblemHandwriteLogo2.png|300px|Text describing the image]]
[[Image:CirEmblemHandwriteLogo2.png|300px|Text describing the image]]
-
* '''Key Pre-existing Part''': We are currently using biobrick parts that was used for a similar project. The Pu and Pr promoters was created by the Michigan 2009 iGEM team. Because the projects are very similar, we hope to differentiate our project in the long-term by incorporating our constructed biobrick into a plant. When toulene or other aromatic compounds bind to the xylr protein, the plant would turn red. Right now, we are just testing our proof-of-concept in E.coli.
 
-
 
-
*'''Primers''':
 
-
Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’
 
-
<br>
 
-
Reverse Primer: 3’->TCGAACTGGGGTCGAATAGA TACTAGTAGCGGCCGCTGCAG->5’
 
-
<br>
 
-
Silent Mutagenesis Primer: '''5’->TACGAGCTACAGACCCAG->3'''
 
-
 
-
[[Image:group1proofofconcept.jpg|300px]]
 
-
<br>
 
-
 
-
<!--Draw out plasmids, restriction digests, antibiotics used, etc. -->
 
-
 
-
'''Assembly Scheme'''
 
-
 
-
[[Image:group1assembly001.jpg|400px]] [[Image:group1assembly02.jpg|400px]]
 
-
<br>
 
<br><br><br><br><br><br><br><br><br><br><br><br>
<br><br><br><br><br><br><br><br><br><br><br><br>

Revision as of 17:46, 22 April 2013


Image:BME494Sp2013_banner.png
Image:BME494_Asu_logo.png

Home        People        Course Projects        Course Materials        Schedule        Photos        Wiki Editing Help

      

Contents

Overview & Purpose

Text describing the image
Text describing the image












Background

Text describing the image
Text describing the image














Design: Our genetic circuit

OUR GENE SWITCH:


Text describing the image















Building: Assembly Scheme

Testing: Modeling and GFP Imaging


Measurement

For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene.


Expected Observations [4]


Tuning Our System

For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system.


Human Practices

Danger of Chemicals in Farmlands
Danger of Chemicals in Farmlands

The human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced.

Our Team

Brady Laughlin
Brady Laughlin


  • My name is Brady Laughlin, and I am a freshman majoring in biomedical engineering. I am taking BME 494 because I am interested in synthetic biology and its many applications. I'm also a member of the Haynes Lab at ASU and I have my own research project. An interesting fact about me is that I have a twin brother.



Christina Forrey
Christina Forrey


  • Hello, I am Christina and I am a sophomore in biomedical engineering. I decided to sign up for this course because synthetic biology is truly interesting to me and I wanted to further enhance my education on the subject. An interesting fact about me is that I am a tae-kwon-do black belt.


David Medina
David Medina


  • My name is David Medina, I am a senior biomedical engineering major at Arizona State University. I decided to take this introductory course to synthetic biology because it sounded like an interesting topic and I wanted to learn more about this up and coming field. An interesting fact about me is that me and my youngest brother were born on the same day, five years apart.


Benjamin Schmitz
Benjamin Schmitz
  • Hey all, I'm Ben Schmitz. I am a mega-senior nearing completion of my biomedical engineering bachelors at ASU. I am taking this course as the penultimate technical elective course of my educational career. An interesting fact about me is that I am getting married in Oregon in September.





Works Cited

[1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>.

[2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>.

[3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>.

[4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>.

[5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>.