BME494s2013 Project Template

Home        People        Course Projects        Course Materials        Schedule        Photos        Wiki Editing Help

      

Overview & Purpose Text describing the image Background Fracking Hydraulic fracturing or “fracking” is a way that allows for the retrieval of natural gases or oil from below the surface that were unsalvageable through the use of drilling. The process begins when a hole has been drilled into the surface containing the desired substance, and then a pipe with holes where the target substances are is placed into the cavity and flushed with fracturing fluid or gas, which cause the rock formations containing the natural resources to break. Once the surrounding earth crumbles due to the increasing pressure, the fracturing fluid flow is cut off and proppants (sand or ceramic beads) that were pumped in with the fracturing fluid hold the crevices open and the target materials flow up to the surface. Fracturing fluids that are commonly used include chemicals that can do a lot of harm due to their toxicity, such as diesel, which contains a lot of carcinogenic substances such as benzene and other dangerous materials like ethylbenzene, xylene and toluene. It has been observed that approximately 20 to 85 percent of these chemicals stay beneath the surface after they are pumped in and that these chemicals can then find their way into water sources which can result in harm to farms that use those water sources for their animals. [1] Proof of Concept Design New Natural Part: In the pseudomonas putida F1 bacterium, the regulatory protein XylR activates the promoter Pu of the TOL (toluene degradation) plasmid pWW0 in the presence of toluene, xylenes and other structural analogues. Xylr is a regulatory protien that is under constituative expression of the Pr promoter. When no toluene or benzene- compounds are present, the xylR protein represses the Pr promoter. When toluene is present it binds with the toluene to activate the Pu promoter. This part is being used because toulene/benzene like compounds bind to the protein and therefore can be used as a biosensor. The NCBI database was used to find the genome for the xylr protein, but journal articles were also explored to find a natural part that could be used for our project. Our project is very similar to the Michigan 2009 iGEM team. Key Pre-existing Part: We are currently using biobrick parts that was used for a similar project. The Pu and Pr promoters was created by the Michigan 2009 iGEM team. Because the projects are very similar, we hope to differentiate our project in the long-term by incorporating our constructed biobrick into a plant. When toulene or other aromatic compounds bind to the xylr protein, the plant would turn red. Right now, we are just testing our proof-of-concept in E.coli. Primers: Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’ Reverse Primer: 3’->TCGAACTGGGGTCGAATAGA TACTAGTAGCGGCCGCTGCAG->5’ Silent Mutagenesis Primer: 5’->TACGAGCTACAGACCCAG->3 Assembly Scheme Testing Measurement For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene. Expected Observations [4] Tuning Our System For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system. Human Practices Danger of Chemicals in Farmlands The human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced. Our Team Brady Laughlin My name is Brady Laughlin, and I am a freshman majoring in biomedical engineering. I am taking BME 494 because I am interested in synthetic biology and its many applications. I'm also a member of the Haynes Lab at ASU and I have my own research project. An interesting fact about me is that I have a twin brother. Christina Forrey Hello, I am Christina and I am a sophomore in biomedical engineering. I decided to sign up for this course because synthetic biology is truly interesting to me and I wanted to further enhance my education on the subject. An interesting fact about me is that I am a tae-kwon-do black belt. David Medina My name is David Medina, I am a senior biomedical engineering major at Arizona State University. I decided to take this introductory course to synthetic biology because it sounded like an interesting topic and I wanted to learn more about this up and coming field. An interesting fact about me is that me and my youngest brother were born on the same day, five years apart. Benjamin Schmitz Hey all, I'm Ben Schmitz. I am a mega-senior nearing completion of my biomedical engineering bachelors at ASU. I am taking this course as the penultimate technical elective course of my educational career. An interesting fact about me is that I am getting married in Oregon in September. Works Cited [1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>. [2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>. [3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>. [4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>. [5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>.