BME103:W930 Group9 l2 - Revision history

Seth Howell: /* Research and Development */

Seth Howell — Thu, 29 Nov 2012 01:07:20 GMT

Research and Development

←Older revision		Revision as of 01:07, 29 November 2012
Line 161:		Line 161:

	'''Illustration'''		'''Illustration'''
		+	<br>

	[[Image:Cf1.png‎\|250px\|DNA Amplification]]		[[Image:Cf1.png‎\|250px\|DNA Amplification]]

		+	<br>
		+
		+	The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR.

	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}

Hamas Asaad: /* Research and Development */

Hamas Asaad — Thu, 29 Nov 2012 00:01:41 GMT

Research and Development

←Older revision		Revision as of 00:01, 29 November 2012
Line 159:		Line 159:
	3'TGTTTACTTACCGTAGCTTC5'<br>		3'TGTTTACTTACCGTAGCTTC5'<br>
	The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>		The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>
-

	'''Illustration'''		'''Illustration'''

Hamas Asaad: /* Research and Development */

Hamas Asaad — Thu, 29 Nov 2012 00:01:13 GMT

Research and Development

←Older revision		Revision as of 00:01, 29 November 2012
Line 153:		Line 153:


-	'''Primer Design'''~~<br>~~<br>	+	'''Primer Design'''<br>
	Forward primer<br>		Forward primer<br>
	5'AAAAAAACAATCTTTTAAACAC3'<br>		5'AAAAAAACAATCTTTTAAACAC3'<br>
Line 159:		Line 159:
	3'TGTTTACTTACCGTAGCTTC5'<br>		3'TGTTTACTTACCGTAGCTTC5'<br>
	The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>		The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>
-
-

Hamas Asaad: /* Research and Development */

Hamas Asaad — Thu, 29 Nov 2012 00:00:47 GMT

Research and Development

←Older revision		Revision as of 00:00, 29 November 2012
Line 151:		Line 151:
	'''Background on Disease Markers'''<br>		'''Background on Disease Markers'''<br>
	The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br>		The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br>
		+

	'''Primer Design'''<br><br>		'''Primer Design'''<br><br>
Line 158:		Line 159:
	3'TGTTTACTTACCGTAGCTTC5'<br>		3'TGTTTACTTACCGTAGCTTC5'<br>
	The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>		The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br>
-
-

Hamas Asaad: /* Research and Development */

Hamas Asaad — Thu, 29 Nov 2012 00:00:21 GMT

Research and Development

←Older revision		Revision as of 00:00, 29 November 2012
Line 151:		Line 151:
	'''Background on Disease Markers'''<br>		'''Background on Disease Markers'''<br>
	The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br>		The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br>
-
-
-
-

	'''Primer Design'''<br><br>		'''Primer Design'''<br><br>

Hamas Asaad: /* Protocols */

Hamas Asaad — Wed, 28 Nov 2012 23:55:58 GMT

Protocols

←Older revision		Revision as of 23:55, 28 November 2012
Line 139:		Line 139:
	1. Take a picture of the fluorimeter assembly with a smartphone.<br>		1. Take a picture of the fluorimeter assembly with a smartphone.<br>
	2. Transfer the picture to a laptop equipped with imageJ via icloud or email.<br>		2. Transfer the picture to a laptop equipped with imageJ via icloud or email.<br>
-	3. Open imageJ and select file, then open.<br>	+	3. Open imageJ and select file, then hit open.<br>
	4. Find the file on the computer and select it.<br>		4. Find the file on the computer and select it.<br>
	5. The image is now open and can be analyzed.<br>		5. The image is now open and can be analyzed.<br>

Hamas Asaad: /* Protocols */

Hamas Asaad — Wed, 28 Nov 2012 23:49:38 GMT

Protocols

←Older revision		Revision as of 23:49, 28 November 2012
Line 111:		Line 111:

	'''PCR Protocol'''<br>		'''PCR Protocol'''<br>
-	1. Put .2 micro liters of DNA in each test tube. <br>	+	1. Put 0.2 micro liters of DNA in each test tube. <br>
-	2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing .2 micro liters of DNA.<br>	+	2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing 0.2 micro liters of DNA.<br>
	important Use one pipet for each transfer do not reuse the pipet.<br>		important Use one pipet for each transfer do not reuse the pipet.<br>
	The DNA priming mixture consists of the forward and back primers, nucleotides, and DNA polymerase.<br>		The DNA priming mixture consists of the forward and back primers, nucleotides, and DNA polymerase.<br>
Line 118:		Line 118:
	4. Plug PCR machine in and attach the keypad to USB. <br>		4. Plug PCR machine in and attach the keypad to USB. <br>
	5. Programming the PCR heating procedure:<br>		5. Programming the PCR heating procedure:<br>
-	a. Enter in the number of parts the heating portion will have(example First ~~cyle~~, ~~main~~ cycle and ~~last~~ cycle=3).<br>	+	a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).<br>
	b. Enter the number of cycles for each part in order<br>		b. Enter the number of cycles for each part in order<br>
	c. Enter temperature of each cycle in order. <br>		c. Enter temperature of each cycle in order. <br>

Hamas Asaad: /* Protocols */

Hamas Asaad — Wed, 28 Nov 2012 23:47:45 GMT

Protocols

←Older revision		Revision as of 23:47, 28 November 2012
Line 114:		Line 114:
	2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing .2 micro liters of DNA.<br>		2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing .2 micro liters of DNA.<br>
	important Use one pipet for each transfer do not reuse the pipet.<br>		important Use one pipet for each transfer do not reuse the pipet.<br>
-	*The DNA priming consists of the forward and back primers, nucleotides, and DNA polymerase.<br>	+	The DNA priming mixture consists of the forward and back primers, nucleotides, and DNA polymerase.<br>
	3. After the DNA priming mixture is transferred move each tube into the PCR machine.<br>		3. After the DNA priming mixture is transferred move each tube into the PCR machine.<br>
	4. Plug PCR machine in and attach the keypad to USB. <br>		4. Plug PCR machine in and attach the keypad to USB. <br>

Hamas Asaad: /* Protocols */

Hamas Asaad — Wed, 28 Nov 2012 23:46:28 GMT

Protocols

←Older revision		Revision as of 23:46, 28 November 2012
Line 111:		Line 111:

	'''PCR Protocol'''<br>		'''PCR Protocol'''<br>
-	1. Plug PCR machine in and attach the keypad to USB. <br>	+	1. Put .2 micro liters of DNA in each test tube. <br>
-	2. Programming the PCR heating procedure:<br>	+	2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing .2 micro liters of DNA.<br>
		+	important Use one pipet for each transfer do not reuse the pipet.<br>
		+	*The DNA priming consists of the forward and back primers, nucleotides, and DNA polymerase.<br>
		+	3. After the DNA priming mixture is transferred move each tube into the PCR machine.<br>
		+	4. Plug PCR machine in and attach the keypad to USB. <br>
		+	5. Programming the PCR heating procedure:<br>
	a. Enter in the number of parts the heating portion will have(example First cyle, main cycle and last cycle=3).<br>		a. Enter in the number of parts the heating portion will have(example First cyle, main cycle and last cycle=3).<br>
	b. Enter the number of cycles for each part in order<br>		b. Enter the number of cycles for each part in order<br>
	c. Enter temperature of each cycle in order. <br>		c. Enter temperature of each cycle in order. <br>
-	d. place all the test tubes prepared in steps 3-5 in heating pad<br>	+	d. place all the test tubes prepared in steps 1-3 in heating pad<br>
	e. press * to begin the heating program and wait until the process is complete. <br>		e. press * to begin the heating program and wait until the process is complete. <br>
-	~~3. Put .2 micro liters of DNA in each test tube. <br>~~
-	~~4. Use a pipet and transfer the 98.8 micro liters DNA priming mixture to each test tube .2 micro liters of DNA.<br>~~
-	important Use one pipet for each transfer do not reuse the pipet.<br>
-	~~5. After the mixture is transferred move the tube into the PCR machine.<br>~~
-

Tyler Ray: /* Protocols */

Tyler Ray — Wed, 28 Nov 2012 18:22:17 GMT

Protocols

←Older revision		Revision as of 18:22, 28 November 2012
Line 120:		Line 120:
	3. Put .2 micro liters of DNA in each test tube. <br>		3. Put .2 micro liters of DNA in each test tube. <br>
	4. Use a pipet and transfer the 98.8 micro liters DNA priming mixture to each test tube .2 micro liters of DNA.<br>		4. Use a pipet and transfer the 98.8 micro liters DNA priming mixture to each test tube .2 micro liters of DNA.<br>
-	a. Use one pipet for each transfer do not reuse the pipet.<br>	+	important Use one pipet for each transfer do not reuse the pipet.<br>
	5. After the mixture is transferred move the tube into the PCR machine.<br>		5. After the mixture is transferred move the tube into the PCR machine.<br>