BME103:W930 Group9 l2: Difference between revisions
m (BME103:W930 Group9 9 moved to BME103:W930 Group9 l2: To make BME103 Lab Write-up 2 page names consistent with the rest of the class.) |
Seth Howell (talk | contribs) |
||
Line 78: | Line 78: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers'''<br> | ||
The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br> | |||
'''Primer Design''' | '''Primer Design'''<br><br> | ||
Forward primer<br> | |||
5'AAAAAAACAATCTTTTAAACAC3'<br> | |||
Reverse Primer<br> | |||
3'TGTTTACTTACCGTAGCTTC5'<br> | |||
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | |||
Revision as of 10:23, 19 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design
|