BME103:W930 Group9 l2
From OpenWetWare
(→Thermal Cycler Engineering) |
Current revision (21:07, 28 November 2012) (view source) (→Research and Development) |
||
| (23 intermediate revisions not shown.) | |||
| Line 34: | Line 34: | ||
<br> | <br> | ||
[[Image:BME103_Group9_Assembly.png|500px|New OpenPCR Design]] | [[Image:BME103_Group9_Assembly.png|500px|New OpenPCR Design]] | ||
| - | + | ||
| - | + | ||
| - | + | ||
The image above portrays the main heating block located inside the OpenPCR. <br> | The image above portrays the main heating block located inside the OpenPCR. <br> | ||
Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block.<br> | Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block.<br> | ||
An example is shown in the image above, indicating that the lid of the device <br> | An example is shown in the image above, indicating that the lid of the device <br> | ||
| - | will increase to accommodate the new heating block. | + | will increase to accommodate the new heating block.<br> |
| + | <br> | ||
| + | [[Image:KeyPad2.png|200px|]]<br> | ||
| + | |||
| + | The KeyPad will be detachable, and will be connected through the USB connection. <br> | ||
| + | This KeyPad will help the user to better control the cycles and <br> | ||
| + | and other factors such as time and temperature.<br> | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
| Line 47: | Line 51: | ||
| - | The key features of the new design include | + | The key features of the new design include a larger main heating block and a <br> |
| + | detachable KeyPad. The larger heating block will allow the user to test <br> | ||
| + | nine more samples at a time. By adding a detachable KeyPad, the user has greater <br> | ||
| + | control over many of the factors that affect the device. This KeyPad will connect <br> | ||
| + | directly to the arduino chip through the USB connection already located on the side <br> | ||
| + | of the OpenPCR. The screen on top will display the questions, asking the user to enter <br> | ||
| + | the amount of time and temperature desired per cycle. It will also ask when to initiate <br> | ||
| + | the first cycle, main cycles, and last cycles. <br> | ||
| + | The beauty of this new design is that there are no difficult directions to operate <br> | ||
| + | the device, and absolutely no other technology is necessary to run it. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
| + | |||
| + | The new OpenPCR will be assembled and operated almost identical to the old OpenPCR. <br> | ||
| + | The only difference is that the user will have to attach the KeyPad to the USB<br> | ||
| + | connection before starting to operate the device. | ||
| Line 71: | Line 88: | ||
---> | ---> | ||
| - | '''Materials''' | + | '''Materials'''<br> |
| + | '''Supplied in the Kit'''<br> | ||
| + | -Newly Designed PCR with additional 2 heating trays <br> | ||
| + | -Key Pad attachment<br> | ||
| + | -Flourimeter box<br> | ||
| + | -Smart phone stand<br> | ||
| + | -Teflon coated slides<br> | ||
| + | -470 nm wavelength diode laser<br> | ||
| + | -100 mL cyber green<br> | ||
| + | -15 5 piece test tubes<br> | ||
| + | - I quart of DNA priming mixture including the following per 100 microliters( 10 micro liters forward primer and reverse primer, 50 micro liters of GoTag master mix and 47.8 micro liters of distliled water.) <br><br> | ||
| + | '''Supplied by the User'''<br> | ||
| + | -Pipets(100)<br> | ||
| + | -Smart Phone<br> | ||
| + | -Distilled Water<br> | ||
| + | -Micro pipets to add the DNAv | ||
| + | -.2 microliters DNA<br> | ||
| + | -image J software | ||
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | <!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | ||
| - | '''PCR Protocol''' | + | '''PCR Protocol'''<br> |
| + | 1. Put 0.2 micro liters of DNA in each test tube. <br> | ||
| + | 2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing 0.2 micro liters of DNA.<br> | ||
| + | *important* Use one pipet for each transfer do not reuse the pipet.<br> | ||
| + | *The DNA priming mixture consists of the forward and back primers, nucleotides, and DNA polymerase.*<br> | ||
| + | 3. After the DNA priming mixture is transferred move each tube into the PCR machine.<br> | ||
| + | 4. Plug PCR machine in and attach the keypad to USB. <br> | ||
| + | 5. Programming the PCR heating procedure:<br> | ||
| + | a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).<br> | ||
| + | b. Enter the number of cycles for each part in order<br> | ||
| + | c. Enter temperature of each cycle in order. <br> | ||
| + | d. place all the test tubes prepared in steps 1-3 in heating pad<br> | ||
| + | e. press * to begin the heating program and wait until the process is complete. <br> | ||
| + | '''Flourimeter instructions'''<br> | ||
| + | 1. Place the flourimeter on the table and turn on the blue light.<br> | ||
| + | 2. Place provided glass slide on flourimeter track so that the first row of dots is even with the light.<br> | ||
| + | 3. Place phone cradle in front of the flourimeter with a smart phone facing perpendicular to the beam of light. (as seen in the picture). <br> | ||
| + | 4. Add two drops of green dye on the dots that are even with the light.<br> | ||
| + | 5. Place two drops of DNA sample on top of the green dye.<br> | ||
| + | 6. Cover the flourimeter and phone by turning the large box over and placing it above both of them.<br> | ||
| + | 7. Take a picture of the droplet with the camera.<br> | ||
| + | 8. Save the picture and send it to the imageJ operator.<br><br> | ||
| + | I'''nstructions for opening images in imageJ'''<br> | ||
| - | + | 1. Take a picture of the fluorimeter assembly with a smartphone.<br> | |
| - | + | 2. Transfer the picture to a laptop equipped with imageJ via icloud or email.<br> | |
| - | + | 3. Open imageJ and select file, then hit open.<br> | |
| - | + | 4. Find the file on the computer and select it.<br> | |
| + | 5. The image is now open and can be analyzed.<br> | ||
| + | 6. The image can be split into three images (blue, green, and red) for better analysis by selecting: image-color-split channels.<br> | ||
==Research and Development== | ==Research and Development== | ||
| Line 95: | Line 153: | ||
| - | + | '''Primer Design'''<br> | |
| - | + | ||
| - | + | ||
| - | '''Primer Design''' | + | |
Forward primer<br> | Forward primer<br> | ||
5'AAAAAAACAATCTTTTAAACAC3'<br> | 5'AAAAAAACAATCTTTTAAACAC3'<br> | ||
| Line 105: | Line 160: | ||
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | ||
| + | '''Illustration''' | ||
| + | <br> | ||
| + | [[Image:Cf1.png|250px|DNA Amplification]] | ||
| + | <br> | ||
| - | + | The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||
| | ||||||||
|
OUR TEAMEveryone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The KeyPad will be detachable, and will be connected through the USB connection. Key Features
The key features of the new design include a larger main heating block and a Instructions The new OpenPCR will be assembled and operated almost identical to the old OpenPCR.
ProtocolsMaterials
PCR Protocol *important* Use one pipet for each transfer do not reuse the pipet. 3. After the DNA priming mixture is transferred move each tube into the PCR machine. a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).
1. Place the flourimeter on the table and turn on the blue light. 1. Take a picture of the fluorimeter assembly with a smartphone. Research and DevelopmentBackground on Disease Markers
Illustration
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | ||||||||



