BME103:W930 Group9 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Tyler Ray Research and development scientist Name: Seth Howell R&D Name: Ryan Open PCR machine engineer Name: Hamas Protocol Name: Deanna Open PCR machine engineer Name: Daniela R&D Everyone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design The image above portrays the main heating block located inside the OpenPCR. Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block. An example is shown in the image above, indicating that the lid of the device will increase to accommodate the new heating block. The KeyPad will be detachable, and will be connected through the USB connection. This KeyPad will help the user to better control the cycles and and other factors such as time and temperature. Key Features The key features of the new design include a larger main heating block and a detachable KeyPad. The larger heating block will allow the user to test nine more samples at a time. By adding a detachable KeyPad, the user has greater control over many of the factors that affect the device. This KeyPad will connect directly to the arduino chip through the USB connection already located on the side of the OpenPCR. The screen on top will display the questions, asking the user to enter the amount of time and temperature desired per cycle. It will also ask when to initiate the first cycle, main cycles, and last cycles. Instructions The new OpenPCR will be assembled and operated almost identical to the old OpenPCR. The only difference is that the user will have to attach the KeyPad to the USB connection before starting to operate the device. Protocols Materials PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([1]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [2]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [3]. Primer Design Forward primer 5'AAAAAAACAATCTTTTAAACAC3' Reverse Primer 3'TGTTTACTTACCGTAGCTTC5' The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible. Illustration