BME103:W930 Group9 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Thermal Cycler Engineering)
Line 51: Line 51:
-
The key features of the new design include  
+
The key features of the new design include a larger main heating block and a <br>
 +
detachable KeyPad. The larger heating block will allow the user to test <br>
 +
nine more samples at a time. By adding a detachable KeyPad, the user has greater <br>
 +
control over many of the factors that affect the device. This KeyPad will connect <br>
 +
directly to the arduino chip through the USB connection already located on the side <br>
 +
of the OpenPCR. The screen on top will display the questions, asking the user to enter <br>
 +
the amount of time and temperature desired per cycle. It will also ask when to initiate <br>
 +
the first cycle, main cycles, and last cycles.
'''Instructions'''<br>
'''Instructions'''<br>
 +
 +
The new OpenPCR will be assembled and operated almost identical to the old OpenPCR. <br>
 +
The only difference is that the user will have to attach the KeyPad to the USB<br>
 +
connection before starting to operate the device.

Revision as of 12:50, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png


Contents

OUR TEAM

Name: Tyler RayResearch and development scientist
Name: Tyler Ray
Research and development scientist
Name: Seth HowellR&D
Name: Seth Howell
R&D
Name: Ryan Open PCR machine engineer
Name: Ryan
Open PCR machine engineer
Name: HamasProtocol
Name: Hamas
Protocol
Name: DeannaOpen PCR machine engineer
Name: Deanna
Open PCR machine engineer
Name: DanielaR&D
Name: Daniela
R&D

Everyone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

New OpenPCR Design


The image above portrays the main heating block located inside the OpenPCR.
Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block.
An example is shown in the image above, indicating that the lid of the device
will increase to accommodate the new heating block.


The KeyPad will be detachable, and will be connected through the USB connection.
This KeyPad will help the user to better control the cycles and
and other factors such as time and temperature.

Key Features


The key features of the new design include a larger main heating block and a
detachable KeyPad. The larger heating block will allow the user to test
nine more samples at a time. By adding a detachable KeyPad, the user has greater
control over many of the factors that affect the device. This KeyPad will connect
directly to the arduino chip through the USB connection already located on the side
of the OpenPCR. The screen on top will display the questions, asking the user to enter
the amount of time and temperature desired per cycle. It will also ask when to initiate
the first cycle, main cycles, and last cycles.

Instructions

The new OpenPCR will be assembled and operated almost identical to the old OpenPCR.
The only difference is that the user will have to attach the KeyPad to the USB
connection before starting to operate the device.





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers
The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([1]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [2]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [3].



Primer Design

Forward primer
5'AAAAAAACAATCTTTTAAACAC3'
Reverse Primer
3'TGTTTACTTACCGTAGCTTC5'
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.




Illustration

DNA Amplification


Personal tools