OUR TEAM
Name: James Beauchamp Open PCR Machine Engineer
| Name: Paige Stokes Protocol Planner
| Name: David Barclay R&D Specialist(s)
| Name: Alison Van Putten R & D Specialist
|
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block the heated lid was elongated and the LCD screen was moved to the front.

To increase the sample size to forty, four rows were added upon the bottom and one column was added on the right. Also labels were added to the rows and columns to help keep the operator organized, thus reducing the chance of making a mistake.

To allow for the larger heated lid and block, the LCD screen and pcr board was moved to the front
Key Features
Heated Lid/PCR Block:
In the new design the Pcr Block is enlarged to include forty sample slots, this will stretch across the majority of the top of the machine. To ensure accuracy alphabetical labels have been added to the rows and numerical labels have been added to the columns; Doing this allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block the mounting plate and thermal pads have been adjusted to fit the new block. To help the machine accurately keep the temperature of the heated lid at the correct temperature another layer of insulation will be added around the mounting plate. This will help the machine reach the exact temperature needed more accurately.
Heat Sink/Fan:
The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly(towards the LCD Screen). This simple change will allow for a more even distribution of heat across the forty sample slots by allowing the heat to spread evenly across the new block.
LCD Screen:
In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front the pcr board will also move to the front, behind the LCD Screen just as it was before.
Instructions
In the new design all of the assembly instructions remain the same besides the following:
Heated Lid/PCR Block
To Assemble the heated lid first locate these parts:
Wood sides(5)
16mm black metal screws(7)
Metal Nuts(7)
Allen Wrench
Lid Plate
Lid Heater
Heated lid mounting plate
1.Snap one of the pieces into the top piece
2.Slide the metal nut into the cross section
3.Slide Metal 16mm screw through the hole on the top piece
4.Tighten with allen wrench
5.Repeat steps 1-4 for both side pieces
6.Snap front and back pieces into place and insert the 16mm screws and nuts into hole touching side pieces
7.Tighten with allen wrench
Heat Sink/Fan
LCD Screen
Protocols
Materials
|
|
| Supplied in Kit | | Amount
|
| 10 μM Forward Primer | | 2.5 μL
|
| 10 μM Reverse Primer | | 2.5 μL
|
| GoTaq master mix | | 119.5 μL
|
| dH2O | | 119.5 μL
|
| Total Volume | | 250 μL
|
|
|
| Supplied by User | | Amount
|
| DNA Sample (20ng) | | .5 μL
|
PCR Protocol
- Plug PCR machine into the computer.
- Open the 'OpenPCR' program on the computer.
- Label the tubes. This information should include the patient number (1 or 2) as well as the replication number. The positive and negative control should also be labeled.
- Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine.
- Close the lid of the chamber.
- Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees Celcius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
- Press start on the program to begin running the PCR.
- Collect and record data at the end of the trial.
DNA Measurement Protocol
Research and Development
Background on Disease Markers
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus they do not function as they should and result in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is rs193922916. The sequence for this gene is:
GGAGATCTCTGAAGTGAAGATGGATG[C/T]AGAATTCCGACATGACTCAGGATAT.
This gene is located on the 21st chromosome, with the Gene ID of APP. The allele change is from a C to a T.
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is:
AGAGCTTGTAGGGAAAGGAAAACGCC[A/G]TCCTTTGAATAACAATTCTGAAATT.
The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.
Primer Design
For our first gene dealing with Alzheimer's, the primer design would be:
Forward Primer
3' CACTTCTACCTACATCT 5'
Reverse Primer
3' CTTCATCCATCTTCAGAGA 5'.
The second primer design would be:
Forward Primer
3' CCTTTCCTTTTGCGGTAGG 5'
Reverse Primer
3' CCATCCTTTGAATAACAAT 5'
Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.
Illustration
|