BME103:W930 Group8 l2: Difference between revisions
Line 131: | Line 131: | ||
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus they do not function as they should and result in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is: | One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus they do not function as they should and result in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is: | ||
<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT. | <br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT. | ||
<br>This gene is located on the 21st chromosome, with the Gene ID of APP. The allele change is from a C to a T | </center> | ||
<br>This gene is located on the 21st chromosome, with the Gene ID of APP. The allele change is from a C to a T. | |||
<br><br> | |||
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number [http://omim.org/entry/176807 176807]. The sequence for this phenotype is: | There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number [http://omim.org/entry/176807 176807]. The sequence for this phenotype is: | ||
Line 142: | Line 145: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
For our first gene dealing with Alzheimer's, the primer design would be: <br> | |||
The primer design would be: | Forward Primer | ||
<br> | |||
<center> 3' CACTTCTACCTAC'''A'''TCT 5'</center> | |||
<br> | |||
Reverse Primer<br> | |||
<center> | |||
3' CT'''T'''CATCCATCTTCAGAGA 5'. | |||
The second primer design would be: | |||
Forward Primer | Forward Primer | ||
Line 152: | Line 162: | ||
<center> 3' CC'''A'''TCCTTTGAATAACAAT 5' </center> | <center> 3' CC'''A'''TCCTTTGAATAACAAT 5' </center> | ||
Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify. | |||
Revision as of 23:16, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Heated Lid/PCR Block: Heat Sink/Fan: LCD Screen: Instructions Heat Sink/Fan LCD Screen
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is: The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.
For our first gene dealing with Alzheimer's, the primer design would be:
3' CTTCATCCATCTTCAGAGA 5'. The second primer design would be: Forward Primer Reverse Primer Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.
Illustration
|