BME103:W930 Group8 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
Current revision (13:42, 28 November 2012) (view source)
(Thermal Cycler Engineering)
 
(43 intermediate revisions not shown.)
Line 13: Line 13:
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|-
|-
-
| [[Image:BME103student.jpg|100px|thumb|Name: James Beauchamp<br>Open PCR Machine Engineer]]
+
| [[Image:040112 16.jpg|100px|thumb|Name: James Beauchamp<br>Open PCR Machine Engineer]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Paige Stokes<br>Protocol Planner]]
+
| [[Image:Paige Lab Pic.jpg|100px|thumb|Paige Stokes<br>Protocol Planner]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: David Barclay<br>R&D Specialist(s)]]
+
| [[Image:David Lab Pic copy.jpg|100px|thumb|David Barclay<br>R&D Specialist]]
| [[Image:2012-10-11 08.37.02.jpg|100px|thumb|Name: Alison Van Putten<br> R & D Specialist]]
| [[Image:2012-10-11 08.37.02.jpg|100px|thumb|Name: Alison Van Putten<br> R & D Specialist]]
-
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
+
| [[Image:Suzannah Badgett2.jpg|100px|thumb|Name: Suzannah Badgett<br>Open PCR Machine Engineer]]
 +
| [[Image:Stick figure 1.jpg|100px|thumb|Naomi Welch<br>Protocol Planner]]
|}
|}
Line 30: Line 31:
'''System Design'''<br>
'''System Design'''<br>
[[Image:PCRchanges.jpg]]<br>
[[Image:PCRchanges.jpg]]<br>
-
The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block the heated lid was elongated and the LCD screen was moved to the front.  
+
The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block, the heated lid was elongated and the LCD screen was moved to the front.  
Line 37: Line 38:
[[Image:LCDchanges.jpg]]<br>
[[Image:LCDchanges.jpg]]<br>
-
To allow for the larger heated lid and block, the LCD screen and pcr board was moved to the front  
+
To allow for the larger heated lid and block, the LCD screen and PCR board was moved to the front.
'''Key Features'''<br>
'''Key Features'''<br>
'''Heated Lid/PCR Block:'''<br>
'''Heated Lid/PCR Block:'''<br>
-
In the new design the Pcr Block is enlarged to include forty sample slots, this will stretch across the majority of the top of the machine. To ensure accuracy alphabetical labels have been added to the rows and numerical labels have been added to the columns; Doing this allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block the mounting plate and thermal pads have been adjusted to fit the new block. To help the machine accurately keep the temperature of the heated lid at the correct temperature another layer of insulation will be added around the mounting plate. This will help the machine reach the exact temperature needed more accurately. <br>
+
In the new design, the PCR Block is enlarged to include forty sample slots that will stretch across the majority of the top of the machine. To ensure accuracy, alphabetical labels have been added to the rows and numerical labels have been added to the columns. The labeling system allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block, the mounting plate and thermal pads have been adjusted to fit the new block. Another layer of insulation will be added around the mounting plate to help the machine reach the exact temperature needed more accurately. <br>
'''Heat Sink/Fan''':<br>
'''Heat Sink/Fan''':<br>
-
The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly(towards the LCD Screen). This simple change will allow for a more even distribution of heat across the forty sample slots by allowing the heat to spread evenly across the new block. <br>
+
The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly (towards the LCD Screen). This simple change will require no extra work from what was done before, due to the fact that the heat sink and fan attached to the face plate by the PCR block. <br>
'''LCD Screen:'''<br>
'''LCD Screen:'''<br>
-
In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front the pcr board will also move to the front, behind the LCD Screen just as it was before.  
+
In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front, the PCR board will also move to the front, behind the LCD Screen just as it was before.  
'''Instructions'''<br>
'''Instructions'''<br>
Line 56: Line 57:
Wood sides(5)<br>
Wood sides(5)<br>
16mm black metal screws(7)<br>
16mm black metal screws(7)<br>
 +
Black metal 8mm screws(4)<br>
Metal Nuts(7)<br>
Metal Nuts(7)<br>
Allen Wrench<br>
Allen Wrench<br>
Lid Plate<br>
Lid Plate<br>
Lid Heater<br>
Lid Heater<br>
 +
Insulation Pad<br>
 +
Heated lid handle<br>
Heated lid mounting plate<br>
Heated lid mounting plate<br>
-
1.Snap one of the pieces into the top piece<br>
+
40 sample PCR Block<br>
-
2.Slide the metal nut into the cross section <br>
+
5 mm diameter screws(8)<br>
-
3.Slide Metal 16mm screw through the hole on the top piece<br>
+
5 mm  diameter washers (8)<br>
-
4.Tighten with allen wrench<br>
+
Thermal pad<br>
-
5.Repeat steps 1-4 for both side pieces<br>
+
-
6.Snap front and back pieces into place and insert the 16mm screws and nuts into hole touching side pieces<br>
+
-
7.Tighten with allen wrench<br>
+
-
Heat Sink/Fan
+
-
LCD Screen
+
'''1'''.Snap one of the side pieces into the top piece<br>
 +
'''2'''.Slide the metal nut into the cross section <br>
 +
'''3'''.Slide Metal 16mm screw through the hole on the top piece<br>
 +
'''4'''.Tighten with allen wrench<br>
 +
'''5'''.Repeat steps 1-4 for both side pieces<br>
 +
'''6'''.Snap front and back pieces into place and insert the 16mm screws and nuts into hole touching side pieces<br>
 +
'''7'''.Tighten with allen wrench<br>
 +
'''8'''.Apply the larger lid heater in middle of the larger lid plate<br>
 +
'''9'''.Locate insulation and apply to top of lid heater<br>
 +
'''10'''.Screw Together the lid heater and mountin plate with allen wrench and black metal 8mm screws<br>
 +
'''11'''.Screw the latch to the larger lid bracket with black metal 8mm screws<br>
 +
'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br>
 +
'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br>
 +
'''14'''.Thread and connect wires through hole in back of the heated lid.<br>
 +
'''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br>
 +
'''16'''.Screw heated lid handle into top of the lid<br>
 +
'''17'''.Attach hinge on back of the new and improved heated lid to the face plate using black metal 8mm screws<br>
 +
'''18'''.Attach enlarged thermal pad to 40 sample PCR block<br>
 +
'''19'''.Attach the following parts from top to bottom in the order as follows: 40 sample PCR Block - Thermal pad - peltier - adapter plate - thermal pad - heat sink.<br>
 +
'''20'''.Mount the PCR Block to the enlarge mounting plate using eight (instead of four as before) 5mm diameter screws and washers<br>
 +
 
 +
Heat Sink/Fan<br>
 +
The heat sink and fan assembly is exaclty the same as before, just moved slightly forward. There is no change required due to the fact that the heat sink and fan attach to the face plate through the PCR Block. <br>
 +
 
 +
LCD Screen/PCR Board<br>
 +
The assembly for the LCD Screen and PCR Board is exactly the same as before. The only change is when mounting the LCD Screen and PCR Board it no longer mounts on the top, but instead through the new slot in the front panel. The LCD screen is still mounted using the 16 mm long black screws (4)and Metal nuts (4).<br>
Line 92: Line 117:
--->
--->
-
'''Materials'''
+
'''Materials for PCR'''
{| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;"
{| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;"
|
|
|-
|-
-
| Supplied in Kit||||    Amount
+
| Supplied In Kit ||||    Amount
|-
|-
| 10 μM Forward Primer ||||    2.5 μL
| 10 μM Forward Primer ||||    2.5 μL
Line 127: Line 152:
# Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine.
# Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine.
# Close the lid of the chamber.
# Close the lid of the chamber.
-
# Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it  the reactancts will heat up to 95 degrees Celcius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
+
# Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it  the reactancts will heat up to 95 degrees Celsius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
# Press start on the program to begin running the PCR.
# Press start on the program to begin running the PCR.
# Collect and record data at the end of the trial.
# Collect and record data at the end of the trial.
-
'''DNA Measurement Protocol'''
+
 
 +
'''Materials For DNA Measurement'''
 +
 
 +
{| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;"
 +
|
 +
|-
 +
| Material ||||    Amount
 +
|-
 +
| Flourimeter ||||  1
 +
|-
 +
| Phone/digital imaging device ||||  1
 +
|-
 +
| GoTaq master mix ||||    1
 +
|-   
 +
|}
 +
 
 +
 
 +
 
 +
'''DNA Measurement Protocol (Flourimeter Protocol)'''
 +
 
 +
To use the flourimeter in order to obtain DNA measurements, a set of steps were followed. First, the machine was set up. The device used to take photographs of the DNA, a phone, was set in place. The flourimeter was lined up in a position so that accurate photographs of the drops could be taken. A glass slide was put in place on the flourimeter so that light would be able to reach the sample and pass through it. A single drop of the DNA sample was then placed onto a slide. It is important to note that each drop (of each sample) was placed on the slide separately (one at a time). From there, the green dye (GoTaq Master Mix) was added. A photo was taken of the first DNA sample. The sample was removed and disposed of properly before the next sample was put in place on the slide. The slide was moved slightly so that the drop would not be contaminated with the DNA from the previous sample. For each sample, two drops of green dye were added and a photo was taken. this process was repeated until an image was taken of every sample. Note that it was important to keep track of which photo was of which sample.
 +
 
 +
'''Image J Protocol'''
 +
 
 +
The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample.
==Research and Development==
==Research and Development==
Line 143: Line 192:
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
-
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus they do not function as they should and result in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:
+
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur resulting in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:
<br><center>  GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.
<br><center>  GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.
</center>
</center>
Line 153: Line 202:
  <center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center>
  <center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center>
-
The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.  
+
The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.  
Line 184: Line 233:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
-
[[Image:DNA Illustration.jpg|700px|thumb|DNA Illustration Prostate Cancer]]
 
 +
<center><br>[[Image:DNA Illustration.jpg]]<br></center>
 +
Prostate Cancer PCR Illustration
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Current revision

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: James BeauchampOpen PCR Machine Engineer
Name: James Beauchamp
Open PCR Machine Engineer
Paige StokesProtocol Planner
Paige Stokes
Protocol Planner
David BarclayR&D Specialist
David Barclay
R&D Specialist
Name: Alison Van Putten R & D Specialist
Name: Alison Van Putten
R & D Specialist
Name: Suzannah BadgettOpen PCR Machine Engineer
Name: Suzannah Badgett
Open PCR Machine Engineer
Naomi WelchProtocol Planner
Naomi Welch
Protocol Planner

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Image:PCRchanges.jpg
The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block, the heated lid was elongated and the LCD screen was moved to the front.


Image:BlockChanges.jpg
To increase the sample size to forty, four rows were added upon the bottom and one column was added on the right. Also labels were added to the rows and columns to help keep the operator organized, thus reducing the chance of making a mistake.

Image:LCDchanges.jpg
To allow for the larger heated lid and block, the LCD screen and PCR board was moved to the front.

Key Features

Heated Lid/PCR Block:
In the new design, the PCR Block is enlarged to include forty sample slots that will stretch across the majority of the top of the machine. To ensure accuracy, alphabetical labels have been added to the rows and numerical labels have been added to the columns. The labeling system allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block, the mounting plate and thermal pads have been adjusted to fit the new block. Another layer of insulation will be added around the mounting plate to help the machine reach the exact temperature needed more accurately.

Heat Sink/Fan:
The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly (towards the LCD Screen). This simple change will require no extra work from what was done before, due to the fact that the heat sink and fan attached to the face plate by the PCR block.

LCD Screen:
In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front, the PCR board will also move to the front, behind the LCD Screen just as it was before.

Instructions
In the new design all of the assembly instructions remain the same besides the following:
Heated Lid/PCR Block
To Assemble the heated lid first locate these parts:
Wood sides(5)
16mm black metal screws(7)
Black metal 8mm screws(4)
Metal Nuts(7)
Allen Wrench
Lid Plate
Lid Heater
Insulation Pad
Heated lid handle
Heated lid mounting plate
40 sample PCR Block
5 mm diameter screws(8)
5 mm diameter washers (8)
Thermal pad

1.Snap one of the side pieces into the top piece
2.Slide the metal nut into the cross section
3.Slide Metal 16mm screw through the hole on the top piece
4.Tighten with allen wrench
5.Repeat steps 1-4 for both side pieces
6.Snap front and back pieces into place and insert the 16mm screws and nuts into hole touching side pieces
7.Tighten with allen wrench
8.Apply the larger lid heater in middle of the larger lid plate
9.Locate insulation and apply to top of lid heater
10.Screw Together the lid heater and mountin plate with allen wrench and black metal 8mm screws
11.Screw the latch to the larger lid bracket with black metal 8mm screws
12.Screw hinge to the back of the larger heated lid with black metal 8mm screws
13.Screw all four shoulder bolts into the underside of the heated lid.
14.Thread and connect wires through hole in back of the heated lid.
15.Attach larger lid casing to larger heated lid using four black metal 8mm screws
16.Screw heated lid handle into top of the lid
17.Attach hinge on back of the new and improved heated lid to the face plate using black metal 8mm screws
18.Attach enlarged thermal pad to 40 sample PCR block
19.Attach the following parts from top to bottom in the order as follows: 40 sample PCR Block - Thermal pad - peltier - adapter plate - thermal pad - heat sink.
20.Mount the PCR Block to the enlarge mounting plate using eight (instead of four as before) 5mm diameter screws and washers

Heat Sink/Fan
The heat sink and fan assembly is exaclty the same as before, just moved slightly forward. There is no change required due to the fact that the heat sink and fan attach to the face plate through the PCR Block.

LCD Screen/PCR Board
The assembly for the LCD Screen and PCR Board is exactly the same as before. The only change is when mounting the LCD Screen and PCR Board it no longer mounts on the top, but instead through the new slot in the front panel. The LCD screen is still mounted using the 16 mm long black screws (4)and Metal nuts (4).





Protocols

Materials for PCR

Supplied In Kit Amount
10 μM Forward Primer 2.5 μL
10 μM Reverse Primer 2.5 μL
GoTaq master mix 119.5 μL
dH2O 119.5 μL
Total Volume 250 μL


Supplied by User Amount
DNA Sample (20ng) .5 μL


PCR Protocol

  1. Plug PCR machine into the computer.
  2. Open the 'OpenPCR' program on the computer.
  3. Label the tubes. This information should include the patient number (1 or 2) as well as the replication number. The positive and negative control should also be labeled.
  4. Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine.
  5. Close the lid of the chamber.
  6. Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees Celsius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
  7. Press start on the program to begin running the PCR.
  8. Collect and record data at the end of the trial.


Materials For DNA Measurement

Material Amount
Flourimeter 1
Phone/digital imaging device 1
GoTaq master mix 1


DNA Measurement Protocol (Flourimeter Protocol)

To use the flourimeter in order to obtain DNA measurements, a set of steps were followed. First, the machine was set up. The device used to take photographs of the DNA, a phone, was set in place. The flourimeter was lined up in a position so that accurate photographs of the drops could be taken. A glass slide was put in place on the flourimeter so that light would be able to reach the sample and pass through it. A single drop of the DNA sample was then placed onto a slide. It is important to note that each drop (of each sample) was placed on the slide separately (one at a time). From there, the green dye (GoTaq Master Mix) was added. A photo was taken of the first DNA sample. The sample was removed and disposed of properly before the next sample was put in place on the slide. The slide was moved slightly so that the drop would not be contaminated with the DNA from the previous sample. For each sample, two drops of green dye were added and a photo was taken. this process was repeated until an image was taken of every sample. Note that it was important to keep track of which photo was of which sample.

Image J Protocol

The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample.

Research and Development

Background on Disease Markers


One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur resulting in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is rs193922916. The sequence for this gene is:


GGAGATCTCTGAAGTGAAGATGGATG[C/T]AGAATTCCGACATGACTCAGGATAT.


This gene is located on the 21st chromosome, with the Gene ID of APP. The allele change is from a C to a T.

There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is:

AGAGCTTGTAGGGAAAGGAAAACGCC[A/G]TCCTTTGAATAACAATTCTGAAATT.

The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.


Primer Design

For our first gene dealing with Alzheimer's, the primer design would be:
Forward Primer

3' CACTTCTACCTACATCT 5'


Reverse Primer

3' CTTCATCCATCTTCAGAGA 5'.

The second primer design would be: Forward Primer

3' CCTTTCCTTTTGCGGTAGG 5'

Reverse Primer

3' CCATCCTTTGAATAACAAT 5'

Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.


Illustration



Image:DNA Illustration.jpg

Prostate Cancer PCR Illustration


Personal tools