BME103:W930 Group8 l2: Difference between revisions
Paige Stokes (talk | contribs) |
|||
(63 intermediate revisions by 6 users not shown) | |||
Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- | ||
| [[Image: | | [[Image:040112 16.jpg|100px|thumb|Name: James Beauchamp<br>Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:Paige Lab Pic.jpg|100px|thumb|Paige Stokes<br>Protocol Planner]] | ||
| [[Image: | | [[Image:David Lab Pic copy.jpg|100px|thumb|David Barclay<br>R&D Specialist]] | ||
| [[Image: | | [[Image:2012-10-11 08.37.02.jpg|100px|thumb|Name: Alison Van Putten<br> R & D Specialist]] | ||
| [[Image: | | [[Image:Suzannah Badgett2.jpg|100px|thumb|Name: Suzannah Badgett<br>Open PCR Machine Engineer]] | ||
| [[Image:Stick figure 1.jpg|100px|thumb|Naomi Welch<br>Protocol Planner]] | |||
|} | |} | ||
Line 30: | Line 31: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:PCRchanges.jpg]]<br> | [[Image:PCRchanges.jpg]]<br> | ||
The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block the heated lid was elongated and the LCD screen was moved to the front. | The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block, the heated lid was elongated and the LCD screen was moved to the front. | ||
Line 37: | Line 38: | ||
[[Image:LCDchanges.jpg]]<br> | [[Image:LCDchanges.jpg]]<br> | ||
To allow for the larger heated lid and block, the LCD screen and | To allow for the larger heated lid and block, the LCD screen and PCR board was moved to the front. | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
'''Heated Lid/PCR Block:'''<br> | '''Heated Lid/PCR Block:'''<br> | ||
In the new design the | In the new design, the PCR Block is enlarged to include forty sample slots that will stretch across the majority of the top of the machine. To ensure accuracy, alphabetical labels have been added to the rows and numerical labels have been added to the columns. The labeling system allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block, the mounting plate and thermal pads have been adjusted to fit the new block. Another layer of insulation will be added around the mounting plate to help the machine reach the exact temperature needed more accurately. <br> | ||
'''Heat Sink/Fan''':<br> | '''Heat Sink/Fan''':<br> | ||
The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly(towards the LCD Screen). This simple change will | The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly (towards the LCD Screen). This simple change will require no extra work from what was done before, due to the fact that the heat sink and fan attached to the face plate by the PCR block. <br> | ||
'''LCD Screen:'''<br> | '''LCD Screen:'''<br> | ||
In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front the | In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front, the PCR board will also move to the front, behind the LCD Screen just as it was before. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
In the new design all of the assembly instructions remain the same besides the following:<br> | |||
Heated Lid/PCR Block<br> | |||
To Assemble the heated lid first locate these parts:<br> | |||
Wood sides(5)<br> | |||
16mm black metal screws(7)<br> | |||
Black metal 8mm screws(4)<br> | |||
Metal Nuts(7)<br> | |||
Allen Wrench<br> | |||
Lid Plate<br> | |||
Lid Heater<br> | |||
Insulation Pad<br> | |||
Heated lid handle<br> | |||
Heated lid mounting plate<br> | |||
40 sample PCR Block<br> | |||
5 mm diameter screws(8)<br> | |||
5 mm diameter washers (8)<br> | |||
Thermal pad<br> | |||
'''1'''.Snap one of the side pieces into the top piece<br> | |||
'''2'''.Slide the metal nut into the cross section <br> | |||
'''3'''.Slide Metal 16mm screw through the hole on the top piece<br> | |||
'''4'''.Tighten with allen wrench<br> | |||
'''5'''.Repeat steps 1-4 for both side pieces<br> | |||
'''6'''.Snap front and back pieces into place and insert the 16mm screws and nuts into hole touching side pieces<br> | |||
'''7'''.Tighten with allen wrench<br> | |||
'''8'''.Apply the larger lid heater in middle of the larger lid plate<br> | |||
'''9'''.Locate insulation and apply to top of lid heater<br> | |||
'''10'''.Screw Together the lid heater and mountin plate with allen wrench and black metal 8mm screws<br> | |||
'''11'''.Screw the latch to the larger lid bracket with black metal 8mm screws<br> | |||
'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br> | |||
'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br> | |||
'''14'''.Thread and connect wires through hole in back of the heated lid.<br> | |||
'''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br> | |||
'''16'''.Screw heated lid handle into top of the lid<br> | |||
'''17'''.Attach hinge on back of the new and improved heated lid to the face plate using black metal 8mm screws<br> | |||
'''18'''.Attach enlarged thermal pad to 40 sample PCR block<br> | |||
'''19'''.Attach the following parts from top to bottom in the order as follows: 40 sample PCR Block - Thermal pad - peltier - adapter plate - thermal pad - heat sink.<br> | |||
'''20'''.Mount the PCR Block to the enlarge mounting plate using eight (instead of four as before) 5mm diameter screws and washers<br> | |||
Heat Sink/Fan<br> | |||
The heat sink and fan assembly is exaclty the same as before, just moved slightly forward. There is no change required due to the fact that the heat sink and fan attach to the face plate through the PCR Block. <br> | |||
LCD Screen/PCR Board<br> | |||
The assembly for the LCD Screen and PCR Board is exactly the same as before. The only change is when mounting the LCD Screen and PCR Board it no longer mounts on the top, but instead through the new slot in the front panel. The LCD screen is still mounted using the 16 mm long black screws (4)and Metal nuts (4).<br> | |||
Line 72: | Line 117: | ||
---> | ---> | ||
'''Materials''' | '''Materials for PCR''' | ||
{| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;" | {| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;" | ||
| | | | ||
|- | |- | ||
| Supplied | | Supplied In Kit |||| Amount | ||
|- | |- | ||
| 10 μM Forward Primer |||| 2.5 μL | | 10 μM Forward Primer |||| 2.5 μL | ||
Line 107: | Line 152: | ||
# Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine. | # Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine. | ||
# Close the lid of the chamber. | # Close the lid of the chamber. | ||
# Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees | # Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees Celsius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds. | ||
# Press start on the program to begin running the PCR. | # Press start on the program to begin running the PCR. | ||
# Collect and record data at the end of the trial. | # Collect and record data at the end of the trial. | ||
'''DNA Measurement Protocol''' | |||
'''Materials For DNA Measurement''' | |||
{| class="wikitable" style="font-style:italic; font-size:120%; border:3px dashed red;" | |||
| | |||
|- | |||
| Material |||| Amount | |||
|- | |||
| Flourimeter |||| 1 | |||
|- | |||
| Phone/digital imaging device |||| 1 | |||
|- | |||
| GoTaq master mix |||| 1 | |||
|- | |||
|} | |||
'''DNA Measurement Protocol (Flourimeter Protocol)''' | |||
To use the flourimeter in order to obtain DNA measurements, a set of steps were followed. First, the machine was set up. The device used to take photographs of the DNA, a phone, was set in place. The flourimeter was lined up in a position so that accurate photographs of the drops could be taken. A glass slide was put in place on the flourimeter so that light would be able to reach the sample and pass through it. A single drop of the DNA sample was then placed onto a slide. It is important to note that each drop (of each sample) was placed on the slide separately (one at a time). From there, the green dye (GoTaq Master Mix) was added. A photo was taken of the first DNA sample. The sample was removed and disposed of properly before the next sample was put in place on the slide. The slide was moved slightly so that the drop would not be contaminated with the DNA from the previous sample. For each sample, two drops of green dye were added and a photo was taken. this process was repeated until an image was taken of every sample. Note that it was important to keep track of which photo was of which sample. | |||
'''Image J Protocol''' | |||
The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample. | |||
==Research and Development== | ==Research and Development== | ||
Line 123: | Line 192: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur resulting in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is: | |||
<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT. | |||
</center> | |||
<br>This gene is located on the 21st chromosome, with the Gene ID of APP. The allele change is from a C to a T. | |||
<br><br> | |||
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number [http://omim.org/entry/176807 176807]. The sequence for this phenotype is: | |||
<center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center> | |||
The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer. | |||
Line 129: | Line 208: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
For our first gene dealing with Alzheimer's, the primer design would be: <br> | |||
Forward Primer | |||
<br> | |||
<center> 3' CACTTCTACCTAC'''A'''TCT 5'</center> | |||
<br> | |||
Reverse Primer<br> | |||
<center> | |||
3' CT'''T'''CATCCATCTTCAGAGA 5'.<br><br> </center> | |||
The second primer design would be: | |||
Forward Primer | |||
<center> 3' CCTTTCCTTTTGCGG'''T'''AGG 5' </center> | |||
Reverse Primer | |||
<center> 3' CC'''A'''TCCTTTGAATAACAAT 5' </center> | |||
Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify. | |||
Line 136: | Line 232: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
<center><br>[[Image:DNA Illustration.jpg]]<br></center> | |||
Prostate Cancer PCR Illustration | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 11:42, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Heated Lid/PCR Block: Heat Sink/Fan: LCD Screen: Instructions 1.Snap one of the side pieces into the top piece Heat Sink/Fan LCD Screen/PCR Board
ProtocolsMaterials for PCR
Materials For DNA Measurement
DNA Measurement Protocol (Flourimeter Protocol) To use the flourimeter in order to obtain DNA measurements, a set of steps were followed. First, the machine was set up. The device used to take photographs of the DNA, a phone, was set in place. The flourimeter was lined up in a position so that accurate photographs of the drops could be taken. A glass slide was put in place on the flourimeter so that light would be able to reach the sample and pass through it. A single drop of the DNA sample was then placed onto a slide. It is important to note that each drop (of each sample) was placed on the slide separately (one at a time). From there, the green dye (GoTaq Master Mix) was added. A photo was taken of the first DNA sample. The sample was removed and disposed of properly before the next sample was put in place on the slide. The slide was moved slightly so that the drop would not be contaminated with the DNA from the previous sample. For each sample, two drops of green dye were added and a photo was taken. this process was repeated until an image was taken of every sample. Note that it was important to keep track of which photo was of which sample. Image J Protocol The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample. Research and DevelopmentBackground on Disease Markers
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is: The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.
For our first gene dealing with Alzheimer's, the primer design would be:
The second primer design would be: Forward Primer Reverse Primer Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.
Illustration
Prostate Cancer PCR Illustration
|