BME103:W930 Group8

From OpenWetWare

Revision as of 12:32, 28 November 2012 by Naomi Welch (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

Group 8 PCR Gurus

David BarclayR&D Specialist
David Barclay
R&D Specialist
Alison Van PuttenR&D Specialist
Alison Van Putten
R&D Specialist
Naomi WelchProtocol Planner
Naomi Welch
Protocol Planner
Paige StokesProtocol Planner
Paige Stokes
Protocol Planner
Suzi BadgettMachine Engineer
Suzi Badgett
Machine Engineer
James BeauchampMachine Eng
James Beauchamp
Machine Eng

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design

Image:OpenPCRMachine.jpg

The device depicted above is an open PCR(Polymerase Chain Reaction), and is used for the amplification of DNA. It works by heating and cooling the DNA samples allowing for the splitting and recombination of the DNA with the primers located in the solution. To accomplish this, the device connects to the USB port of a computer where the format of the cycles are inputted. From there the device repeatedly heats and cools via the heated lid, heat sink, and fan. The information is then fed to the Arduino board which controls the heating and cooling as well as transferring the information to the LCD screen.

Experimenting With the Connections

When we unplugged part the LCD screen(part 3) from the Arduino(part 6), the LCD display went black and ceased to work.

When we unplugged the white wire that connects the Arduino(part 6) to the PCR block (part 2), the machine relayed a temperature reading of -40˚C, indicating a malfunction and the temperature could not be accurately determined.


Test Run We first tested the Open PCR(Machine #8) on October 24, 2012. Upon testing the Open PCR, many problems with the device were encountered. The device would not communicate with the computer, meaning that none of the information about the cycles were able to be displayed on the computer. The next problem encountered was that the LCD screen ceased to function. These problems with the device were pinned on a malfunctioning Arduino board and a new Open PCR was obtained and tested. No problems were encountered with the new device.


Protocols

Part 1: PCR Protocol Polymerase Chain Reaction

Polymerase Chain Reaction is used to amplify DNA. In order for this process to be successful, Template DNA must be replicated. A template of DNA consists of a strand in which the order of the nucleotides (bases) is known. With this information, it is possible to replicate the DNA strand by using heat, primers, and polymerase. The process begins by combining the DNA and the master mix. The master mix is composed of all of the necessary ingredients for the completion of the PCR process. The DNA is then placed into a PCR machine, or thermal cycler. The DNA is heated in the thermal cycler, allowing it to denature, or separate into two strands. The primers are then added to the template strand. They mark the start and end points of the specific sequence that is being targeted for replication. Next, the cycler is once again heated. This allows for the polymerase enzyme to activate and to begin adding nucleotides to the DNA strand. At the end of this process, two strands are created (essentially each strand of DNA has one side composed of new nucleotides that are added by the polymerase and the other composed of the original nucleotides, thus allowing for a total product of two strands). The machine is then cooled and re-heated again. This cycle is generally repeated for 20-30 cycles, or until the desired amount of target DNA sequence strands is reached. The composition of the master mix is listed below.

Steps to Run PCR

  1. Plug PCR machine into the computer.
  2. Open the 'OpenPCR' program on the computer.
  3. Label the tubes. This information should include the patient number (1 or 2) as well as the replication number. The positive and negative control should also be labeled.
  4. Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine.
  5. Close the lid of the chamber.
  6. Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees Celcius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds.
  7. Press start on the program to begin running the PCR.
  8. Collect and record data at the end of the trial.


Master Mix Components
a)TaqDNA polymerase (non-recombinant modified form)
b)MgCl2
c)dNTP's
d)reaction buffers (at optimal concentration for DNA template amplification)


Reagent Volume
Template DNA (20 ng) 0.2 μL
10 μM Forward Primer 1.0μL
10 μM Reverse Primer 1.0μL
GoTaq master mix 50μL
dH2O 47.8 μL
Total Volume 100.0 μL


The Patient Information
Patient Identification Number Gender Age
85158 Female 50
17818 Female 50


Part 2: Flourimeter Protocol

Image:Flourimeter121.jpg

Flourimeter Measurements

The flourimeter is used to measure the amount,or intensity of fluorescence. The blue LED light is turned on to begin using the device. A camera phone is placed onto the designated tray. In order for the process to work, the flash settings on the camera phone must be turned off. Also the ISO must be 800 or higher and exposure must be set to its maximum. It helps to turn off auto focus as well. A slide is placed onto the flourimeter. On this slide a drop of water is inserted in the middle of the first two rows using a pipette. Two more drops are added to the first drop. The LED light is aligned with the drop and the flourimeter is then covered using a light box. The light box will remove excess light, allowing for images of the drop of water to be taken. The drop is then removed from the slide.The process of putting drops into the slide is then repeated using the next set of holes on the slide (Move the slide so that the new set of holes is in line with the blue light before putting the next drop onto the slide. For both parts of the process, each drop should be between 130 and 160 micro-liters.) The process of taking photos of the drop is then repeated using the same method previously presented. About three photos should be taken for each drop.


Steps to Save Picture from Phone as Jpeg

  1. Email the picture to an email address.
  2. Open the email up on the computer.
  3. Click to download the image.
  4. Click "save", then "save as" on the screen.
  5. Save the image anywhere on the computer.

Note: The computer will recognize that it is a picture file and save it as Jpeg, unless otherwise specified.

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

This experiment uses PCR (polymerase chain reaction) to amplify DNA strands to detect certain base pair sequences. First, the Template DNA, DNA primers, salts (MgCl2 or Magnesium Chloride), Taq Polymerase and deoxynucleotide triphosphates (dNTPs) are added together into a tube. PCR starts with a heating that breaks apart the DNA bonding and creates two single strand DNA molecules. The process then cools and allows the primers to bind to the specific region on the single strand DNA. The Taq polymerase then takes the dNTPs (base pairs) and adds them onto the DNA single strand in the 3' direction of the primer. This creates two DNA strands out of the one that was first added into the solution. The heating and cooling process that occurs is called thermal cycling. This cycling is done 30-35 times to amplify the DNA to a point where it is easy to detect. The process of duplicating these DNA strands means that by the end of 30-35 cycles, there would be a clear amplification. Syber-Green dye was used to show double-stranded DNA as it fluoresces only when attached to double binded DNA.

Our certain sequence rs17879961 is related to the susceptibility to Breast and Colorectal Cancer. This is a mutation in the CHEK2 gene. The CHEK2 gene is related to fixing DNA damage that occurs. These mutations cause the ability for DNA strands damaged to continue to create proteins when damaged. This creates a higher susceptibility to prostate and breast cancer. PCR would be able to find this mutation by using the primers shown below which are tailored for the rs17879961 mutation in the CHEK2 gene. This would allow for the test to predict susceptibility to certain cancers. The way PCR would do this would be that the primers would bind onto the mutation during the cooling process. This would then amplify the DNA as the primers would bind. If the primers didn't bind because the mutation didn't exist, then the DNA would not amplify and a negative result would occur. The DNA sequence for the Single Nucleotide Polymorphism is shown below, it is a mutation in the CHEK2 gene which is found on chr22:29083730-29137821 or Chromosome 22- base pairs 29083730 to 29137821. The mutation of the gene is the addition of a Cytosine rather than a Thymine. This is shown in the SNP below.

Primer Development: With the DNA sequence (SNP) below:

5' GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC 3'

The forward primer would be:

3' CAGGATTTTTGTGAATGTGAG 5'


The backward primer would be:

3' CACTGCATACATAGAAGATCA 5'

This is within the accepted bp primer length (18-22), follows the GC concentration rule (40-60%), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and has an annealing temperature of 61 degrees Celsius forward and 59 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence.

Bayes Analysis

Bayes analysis accounts for probabilities behind a test. In this example, Bayes rule is use to calculate the probability that a test will give a positive result for cancer when cancer is present:

p(C | T) = p(T | C) * p(C) / p(T | C) * p(C) + p(T | nC) * p(nC)

This is where:

   p(C|T)= probability that cancer present when positive test
   p(T|C)= probability that positive test when cancer present
   p(C)= probability of cancer
   p(T|nC)= probability that positive test when cancer not present
   p(nC)= probability that cancer not present

Meijers-Heijboer et al. (2002) showed that having the CHEK2 gene creates a higher risk, but not always cancer. 1.1% have the gene, but do not have the cancer. 5.1% have the gene and have breast cancer. This was done from 718 families that did not have BRCA1 or BRCA2 mutations. This shows that the cancer gene could be present but still would not mean cancer is present.

Dong et al. (2003) measured that 28 out of 578 men (4.8%) have a CHEK2 gene mutation and have prostate cancer.

Cybulski et al. (2004) found that in Poland, variants of the CHEK2 gene have a strong link to increase risk of prostate cancer. In Poland, the prevalence of the alleles in 4008 cancer cases and 4000 controls shows the importance in the link between the CHEK2 gene variants and prostate cancer.

These variables are found from the OMIM entry Checkpoint Kinase 2.

Other factors would be inherent in experimental errors. However, the limited amount of data found through PCR done in this experiment does not allow for a calculated percentage.



All images borrowed from Virtual Lab via the University of Utah.

First, at 90 degrees Celsius, the DNA splits to show the target area of the gene.
Image:PCR1.JPG

Second, the primers come in and attach to the ends of the target gene at 50 degree Celsius.
Image:PCR2.JPG
Then the rest of the DNA fills out on the target area at 72 degrees Celsius.
Image:Pcr3.JPG
The DNA splits up again at 95 degrees Celsius with four target sequences and repeats until the target sequence is easy to detect. Image:Pcr4.JPG



Results

Calf Thymus Result
Calf Thymus Result
Water Drop Result
Water Drop Result
Sample Integrated Density DNA μg/mL Conclusion
PCR: Positive Control 12121228 2.1521 Yes
PCR: Negative Control 5059597 0.89833 No Signal
PCR: Patient(1) 85158, rep 1 (P11) 6980329 1.2395 No Signal
PCR: Patient(1) 85158, rep 2 (P12) 5392765 0.95748 No Signal
PCR: Patient(1) 85158, rep 3 (P13) 2214030 0.39789 No Signal
PCR: Patient(2) 17818, rep 1 (P21) 2125937 0.37746 No Signal
PCR: Patient(2) 17818, rep 2 (P22) 4027455 0.71507 No Signal
PCR: Patient(2) 17818, rep 3 (P23) 4118595 0.73125 No Signal


KEY

  • Sample = Sample is referring to the gene sample that is taken from each Patient. For example, Sample P12 refers to the first patient's second sample. This delineates to which patient and sample is being referred. Positive and Negative Control are just the control samples that we know do and do not, respectively, have the cancer gene.
  • Integrated Density = Integrated Density is the "brightness" that is calculated through Image J. This is done by summing up the pixels in the image and the "mean gray value" of each pixel. This gives the overall brightness of the area selected. The two measurements that are taken are of the water drop and the background. This is done so that the integrated density of the background can be subtracted from the integrated density of the water drop to compensate for the noise (gravel and pixelation) caused by the camera.
  • DNA μg/mL = The concentration of DNA was found through an equation: 2*(INTDEN sample with subtracted background)/(INTDEN of Calf Thymus with subtracted background). INTDEN refers to integrated density. This gives the sample concentration because we use the calibration of a sample where we know the concentration of and translate that to a certain integrated density. This gives an easy way to calculate the concentrations of other water drops.
  • Conclusion = Conclusion is whether or not the patient has the cancer due to the concentration found. This was negative for each sample because our concentrations were underneath the positive control value by a great deal.
Personal tools