BME103:W930 Group7 l2
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the device. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.
Key Features The key features involved with the newly designed PCR machine can be easily renovated at a low cost to immensely improve the quality. No new pieces will need to be added to the design, just a few altercations to the machine's current design. A few extra holes drilled into the housing block can reduce the number of trials by maximizing the amount of DNA samples in each trial with a few simple incisions. Simple slots can be cut through the wooden walls for added ventilation to prevent over heating. And finally, the old lid was a hassle. There are many other ways to secure the vials in the housing block all while providing easy access to open when needed.
The best feature about our improvements to the PCR machine is the unchanged design from the original machine. Each improved piece can individually replace certain parts of the device without altering the original design. For example, a few slits can be excised from the walls of the machine. Extra DNA holes can be drilled in the current housing block so more samples can be read during one simple trial. As stated earlier, a magnetic hinge securely protects the DNA samples while the test is in progress, and can also be easily opened when minimal pressure is applied to open the lid. Instruction to use the PCR machine is as simple as its original design, all while maximizing efficiency.
ProtocolsMaterials
1. Obtain a computer and PCR machine. 2. Download the Open PCR software onto the computer. 3. Connect the laptop and PCR machine using a USB cable. 4. Open the Open PCR program and create a new experiment. 5. In the options menu select 30 number of cycles and the specific temperatures. 6. Obtain PCR test tubes and label them. Put on a lab coat and gloves. 7. Using the pipet, transfer the DNA into the PCR test tubes. 8. Add a micropipette tip to the micropipette. 9. Add the primers to the PCR test tubes, making sure to change out the micropipette every time. 10. Then, place the samples (which include the positive and negative controls) into the Open PCR machine. 11. From the laptop, start the program so the DNA amplification can start.
DNA Measurement Protocol
2. Obtain a new set of test tubes and label them appropriately. 3. Using a fresh pipet, transfer the samples to the new test tubes. 4. Using a fresh pipet every time, add SYBR Green and the Calf Thymus. 5. Set up the flourometer as follows. 5a. Remove all contents from the black box. 5b. After removing the lid, flip the box upside down. 5c. One side of the box will detach. Fold this side up and create a cave like opening (as seen above). 5d. Place the Fluorometer device within the upside down box. 5e. Lastly, place the smartphone in the black stand with the camera facing into the box. 6. Place the Standardized Mat with Measurements inside the box with the contents on top of it. This ensures that all the tools stay the same distances, allowing for less error and more uniformed results. 7. Using a fresh pipet, add a drop of the sample and a drop of water to the hydrophobic glass slide. 8. Place this on the fluorometer, making sure the drop is aligned with the light source. 9. Turn of surrounding lights, then turn on the device and record the results. Research and DevelopmentBackground on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAT5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Anencephaly : Alleles: [C/T] Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
Bayes Analysis of Anencephaly P(A│B)= (P(B│A)P(A))/P(B) Where P(A|B) is the probability that Meckel syndrome will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B|A) is the probability that a Meckel fetus will test positive for the disease, P(A) is the probability of having the Meckel syndrome mutation, and P(B) is the probability of people without the Meckel mutation that yield positive results.
|