BME103:W930 Group7 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Jake Turner PCR Machine Engineer Name: Tyler Allen PCR Machine Engineer, Graphic Designer Name: Khalil Pathan Experimental Protocol Planner Name: Pahul Singh Experimental Protocol Planner Name: Frea Mehta Research and Development Specialist Name: Paul Song Research and Development Specialist LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions Protocols Materials Supplied in the Kit Amount Open PCR 1 Primers USB Cable 1 Standardized Mat with Measurements 1 Fluorimeter 1 Phone Holder 1 Light Box 1 Hydrophobic Glass slides 3 Positive Control DNA 5 mL SYBR Gene Dye 5 mL Supplied by User Amount Micropipettes 1 Micropipette tips 200 Lab Coats 2 Template DNA 3.2 μL Smart Phone(with camera) 1 PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. More information on this gene can be found on this link. [1] Primer Design Alzheimer- Alleles: [A/C] Forward Primer:5'cgtggctcatcttggctgtgattt3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Illustration