BME103:W930 Group7 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Jake Turner PCR Machine Engineer Name: Tyler Allen PCR Machine Engineer, Graphic Designer Name: Khalil Pathan Experimental Protocol Planner Name: Pahul Singh Experimental Protocol Planner Name: Frea Mehta Research and Development Specialist Name: Paul Song Research and Development Specialist LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the device. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size. The heating block on the machine only allowed for 16 vials to be tested at a time. For our purposes in the previous lab, this proved to be enough but this may not be the case in other experiments. However to increase the sample size dramatically, a larger heating block, heat sink, and housing would be required. It was necessary to compromise by adding a marginal amount to the sample size in order to keep the important aspects of the original design. By arranging the blocks in a more hexagonal pattern, this allowed two additional vials without any external changes. This design maintains the same distance between each vial as the original so the heating can occur at the same rate. While the addition of more fans could cool the system faster, this would add cost as well as complicate the assembly process. The simpler solution we found was to increase the amount of ventilation surrounding the heat sink. This is achieved by adding vents to the front and back housing panels like those on the side. While there was no noticeable problems with the circuit overheating, it was still a concern due to the high temperatures the device reaches. The added vents will allow more hot air to be diverted from the circuitry. Though it seemed to be a trivial problem at first, the original latch for the device's lid proved to be extremely difficult to open. Repeated use indicated that this could lead to damage to the lid hinge from the amount of force required to open it. It was also within possibility to spill or tip the vials in the machine from an over-zealous opening of the lid. The latch could easily be replaced with a magnetic latch to eliminate these problems. Key Features The key features involved with the newly designed PCR machine can be easily renovated at a low cost to immensely improve the quality. No new pieces will need to be added to the design, just a few altercations to the machine's current design. A few extra holes drilled into the housing block can reduce the number of trials by maximizing the amount of DNA samples in each trial with a few simple incisions. Simple slots can be cut through the wooden walls for added ventilation to prevent over heating. And finally, the old lid was a hassle. There are many other ways to secure the vials in the housing block all while providing easy access to open when needed. Instructions The best feature about our improvements to the PCR machine is the unchanged design from the original machine. Each improved piece can individually replace certain parts of the device without altering the original design. For example, a few slits can be excised from the walls of the machine. Extra DNA holes can be drilled in the current housing block so more samples can be read during one simple trial. As stated earlier, a magnetic hinge securely protects the DNA samples while the test is in progress, and can also be easily opened when minimal pressure is applied to open the lid. Instruction to use the PCR machine is as simple as its original design, all while maximizing efficiency. Protocols Materials Supplied in the Kit Amount Open PCR 1 USB Cable 1 Standardized Mat with Measurements 1 Fluorimeter 1 Phone Holder 1 Light Box 1 Hydrophobic Glass slides 3 Positive Control DNA 5 mL SYBR Gene Dye 5.2 mL Supplied by User Amount Micropipettes 1 Micropipette tips 200 Lab Coats 2 Template DNA 3.3 μL Smart Phone(with Camera) 1 PCR Protocol 1. Obtain a computer and PCR machine. 2. Download the Open PCR software onto the computer. 3. Connect the laptop and PCR machine using a USB cable. 4. Open the Open PCR program and create a new experiment. 5. In the options menu select 30 number of cycles and the specific temperatures. 6. Obtain PCR test tubes and label them. Put on a lab coat and gloves. 7. Using the pipet, transfer the DNA into the PCR test tubes. 8. Add a micropipette tip to the micropipette. 9. Add the primers to the PCR test tubes, making sure to change out the micropipette every time. 10. Then, place the samples (which include the positive and negative controls) into the Open PCR machine. 11. From the laptop, start the program so the DNA amplification can start. DNA Measurement Protocol 1. Once the Open PCR machine has completed its cycles, remove the tubes. 2. Obtain a new set of test tubes and label them appropriately. 3. Using a fresh pipet, transfer the samples to the new test tubes. 4. Using a fresh pipet every time, add SYBR Green and the Calf Thymus. 5. Set up the flourometer as follows. 5a. Remove all contents from the black box. 5b. After removing the lid, flip the box upside down. 5c. One side of the box will detach. Fold this side up and create a cave like opening (as seen above). 5d. Place the Fluorometer device within the upside down box. 5e. Lastly, place the smartphone in the black stand with the camera facing into the box. 6. Place the Standardized Mat with Measurements inside the box with the contents on top of it. This ensures that all the tools stay the same distances, allowing for less error and more uniformed results. 7. Using a fresh pipet, add a drop of the sample and a drop of water to the hydrophobic glass slide. 8. Place this on the fluorometer, making sure the drop is aligned with the light source. 9. Turn off surrounding lights, then turn on the device and record the results. 10. Take a picture of the drop with the light passing through it with the smartphone. Repeat this for all samples. 11. Once all the pictures are taken, they must be uploaded into ImageJ as follows: 11a. Obtain a computer and install the ImageJ software. 11b. After taking the pictures needed, connect the smartphone to the computer with a USB cable. 11c. Once connected, open the folder containing the smartphone (found in My Computer or Devices). 11d. Create a folder on the desktop (this will be used to temporarily store the pictures). 11e. Copy and paste the pictures form the smartphone folder (DCIM) to the desktop one. 11f. Open the ImageJ software and click File and the Open. 11g. From this Open menu, select the preferred picture from the folder on the desktop containing the pictures. This will transfer the data into ImageJ Research and Development An anencephalactic fetus Alzheimer's Disease Background on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1] Anencephaly is a relatively common neural tube defect that occurs during early fetal development; it causes parts of the brain and skull to not develop and results in fetal mortality in almost all cases. Although most occurrences of anencephaly are attributed to environmental toxins or low folic acid intake during pregnancy [2], but has also been affiliated with Meckel syndrome, a rare genetic disorder that affects the RPGRIP1L gene [3]. The most severe phenotypes of Meckel syndrome are present with complete inactivation of the RPGRIP1L gene. The disease is a Finnish heritage disease, with an incidence of 1.1 defects per 10,000 births as opposed to the general rate of incidence of 0.2 defects per 10,000 births [4]. The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA Primer Design Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAT5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Anencephaly : Alleles: [C/T] Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Illustration Bayes Analysis of Anencephaly P(A│B)= (P(B│A)P(A))/P(B) Where P(A|B) is the probability that Meckel syndrome will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B|A) is the probability that a Meckel fetus will test positive for the disease, P(A) is the probability of having the Meckel syndrome mutation, and P(B) is the probability of people without the Meckel mutation that yield positive results.