BME103:W930 Group7 l2
From OpenWetWare
(→Research and Development) |
(→Thermal Cycler Engineering) |
||
| Line 34: | Line 34: | ||
While the system proved to be useful in [http://openwetware.org/wiki/BME103:W930_Group7 previous experiments], many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size. | While the system proved to be useful in [http://openwetware.org/wiki/BME103:W930_Group7 previous experiments], many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size. | ||
| - | [[Image:Bme_103_group7_redesign_heating_block.png|450px|Heating Block Improvements]] | + | [[Image:Bme_103_group7_redesign_heating_block.png|450px|Heating Block Improvements]]<br> |
| + | The heating block on the machine only allowed for 16 vials to be tested at a time. For our purposes in the previous lab, this proved to be enough but this may not be the case in other experiments. However to increase the sample size dramatically, a larger heating block, heat sink, and housing would be required. It was necessary to compromise by adding a marginal amount to the sample size in order to keep the important aspects of the original design. By arranging the blocks in a more hexagonal pattern, this allowed two additional vials without any external changes. This design maintains the same distance between each vial as the original so the heating can occur at the same rate. | ||
| + | [[Image:Bme_103_group7_redesign_housing.png|450px|Device Housing Improvements]]<br> | ||
| + | While the addition of more fans could cool the system faster, this would add cost as well as complicate the assembly process. The simpler solution we found was to increase the amount of ventilation surrounding the heat sink. This is achieved by adding vents to the front and back housing panels like those on the side. While there was no noticeable problems with the circuit overheating, it was still a concern due to the high temperatures the devise reaches. The added vents will allow more hot air to be diverted from the circuitry. | ||
| - | + | [[Image:Bme_103_group7_redesign_latch.png|450px|Latch Design Improvements]]<br> | |
| - | + | ||
| - | + | ||
| - | [[Image:Bme_103_group7_redesign_latch.png|450px|Latch Design Improvements]] | + | |
Though it seemed to be a trivial problem at first, the original latch for the device's lid proved to be extremely difficult to open. Repeated use indicated that this could lead to damage to the lid hinge from the amount of force required to open it. It was also within possibility to spill or tip the vials in the machine from an over-zealous opening of the lid. The latch could easily be replaced with a magnetic latch to eliminate these problems. | Though it seemed to be a trivial problem at first, the original latch for the device's lid proved to be extremely difficult to open. Repeated use indicated that this could lead to damage to the lid hinge from the amount of force required to open it. It was also within possibility to spill or tip the vials in the machine from an over-zealous opening of the lid. The latch could easily be replaced with a magnetic latch to eliminate these problems. | ||
Revision as of 02:03, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.
Key Features Uh... doesn't cost more money? No new assembly instructions?
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAT5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Anencephaly : Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
| ||||||||||||||||||||||||||||||||||||||||||




