BME103:W930 Group7 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 141: Line 141:
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers --->
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers --->
 +
 +
[[Image:BME103 anencephaly.jpg‎|thumb|frame|left|An anencephalactic fetus]]
'''Background on Disease Markers'''
'''Background on Disease Markers'''

Revision as of 00:35, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Jake TurnerPCR Machine Engineer
Name: Jake Turner
PCR Machine Engineer
Name: Tyler AllenPCR Machine Engineer, Graphic Designer
Name: Tyler Allen
PCR Machine Engineer, Graphic Designer
Name: Khalil PathanExperimental Protocol Planner
Name: Khalil Pathan
Experimental Protocol Planner
Name: Pahul SinghExperimental Protocol Planner
Name: Pahul Singh
Experimental Protocol Planner
Name: Frea MehtaResearch and Development Specialist
Name: Frea Mehta
Research and Development Specialist
Name: Paul SongResearch and Development Specialist
Name: Paul Song
Research and Development Specialist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

Description of image Description of image Description of image

System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
Open PCR 1
Primers
USB Cable 1
Standardized Mat with Measurements 1
Fluorimeter 1
Phone Holder 1
Light Box 1
Hydrophobic Glass slides 3
Positive Control DNA 5 mL
SYBR Gene Dye 5 mL


Supplied by User Amount
Micropipettes 1
Micropipette tips 200
Lab Coats 2
Template DNA 3.2 μL
Smart Phone(with camera) 1


PCR Protocol



DNA Measurement Protocol

Research and Development

An anencephalactic fetus
An anencephalactic fetus

Background on Disease Markers

The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]


Anencephaly is a relatively common neural tube defect that occurs during early fetal development; it causes parts of the brain and skull to not develop and results in fetal mortality in almost all cases. Although most occurrences of anencephaly are attributed to environmental toxins or low folic acid intake during pregnancy [2], but has also been affiliated with Meckel syndrome, a rare genetic disorder that affects the RPGRIP1L gene [3]. The most severe phenotypes of Meckel syndrome are present with complete inactivation of the RPGRIP1L gene.

The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is

ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA

Forward Primer: taatatgtaattttattttcattttagctg

Reverse Primer: gttaattttctaaatcattaattctatcct


Primer Design

Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.



Illustration


Personal tools