BME103:W930 Group7

From OpenWetWare

Revision as of 03:23, 14 November 2012 by Seong Song (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Jake TurnerPCR Machine Engineer
Name: Jake Turner
PCR Machine Engineer
Name: Tyler AllenPCR Machine Engineer, Graphic Designer
Name: Tyler Allen
PCR Machine Engineer, Graphic Designer
Name: Khalil PathanExperimental Protocol Planner
Name: Khalil Pathan
Experimental Protocol Planner
Name: Pahul SinghExperimental Protocol Planner
Name: Pahul Singh
Experimental Protocol Planner
Name: Frea MehtaResearch and Development Specialist
Name: Frea Mehta
Research and Development Specialist
Name: Paul SongResearch and Development Specialist
Name: Paul Song
Research and Development Specialist


<gflash>560 315 http://www.youtube.com/embed/x5yPkxCLads?rel=0</gflash>

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
Open PCR Machine

This is a solidworks rendering of the OpenPCR machine. The OpenPCR is an affordable alternative to costly clinical machines used to amplify particular DNA sequences. This interfaces with any computer with the proper software downloaded and the process of thermal cycling to conduct a variety of tests. This could be anything from paternity tests to test for genetic markings of cancer.


Experimenting With the Connections

Description of image

When we unplugged the display (part 3) from the power supply (part 6), the machine did not have power. The blue display screen did not turn on and appeared completely black.

When we unplugged the white wire that connects the power supply (part 6) to the heat block (part 2), the machine temperature on the display screen appeared incorrectly. Part 6 is responsible for recording the the internal temperature of the machine throughout the test.


Test Run

Our first Open PCR test was conducted on Wednesday, October 24, 2012. While running our open PCR test, we experienced nothing but problems. We set the cycles to the appropriate temperatures and time intervals; the Initial cycle on 95°C for 30 seconds, the Denaturing cycle on 95°C for 30 seconds, the Annealing cycle on 55°C for 30 seconds, the Extending cycle on 72°C for 30 seconds, the final cycle on 72°C for 180 seconds, and the final hold at 20°C. Initially, our open PCR appeared to be running correctly for the desired two hour time interval. However, due to a cycling error, our timer extended to nearly three hours. Not only did our test exceed the desired time interval, but our time would not wind down. Our test constantly moved up and down between the times of two hours thirty minutes and two hours and fifty minutes. When our time got close to two thirty, more time would be added to our test. Also, our laptop was experiencing errors. Our laptop received an application error notice multiple times, each time disrupting our process. As a result of these complications, when the two hours elapsed we only reached step seventeen of thirty. We were forced to prematurely end our test. Therefore, we could not receive sufficient results.


Improving The OpenPCR

One way to improve on the quality and production of the Open PCR machine is to maximize the number of loading wells and shorten the cycle time. The Open PCR machine takes too long to test only 16 samples of DNA. Also, the latch to get to the loading wells served as a hassle. It was tough to open while being careful with the expensive machine at the same time. If you are using the Open PCR as a learning tool, as we have, the machine should be transparent or constructed to be easily disassembled so students can get a better view of the job and responsibility each part completes. However, the machine is constructed with some positive qualities. The machine is affordable, and it is light weight and compact making it easily transportable. The bright glowing screen can easily be read, and the test runs very quietly. While the machine is testing, no extra work needs to be done. It is very easy to start the test and patiently wait for it to end.




Protocols

Polymerase Chain Reaction

(

1. Within a polymerase chain reaction everything is controlled by temperature. The high temperature(95 C) causes melting of DNA templates and primers by disrupting the hydrogen bonds. Next is annealing. The temperature is dropped down to 65 temporarily(20 seconds) to allow a piece of DNA to bind to your product from the initial step. The polymerase binds to the DNA template and DNA synthesis begins. Next is elongation, the DNA polymerase synthesizes a new DNA strand. This process is repeated to replicate numerous strands of DNA.

2.

     1. Heat denaturation-
               a. Heat the reactant , which causes melting of the DNA
               b. A DNA molecule sequence is targeted which is then separated into two strands
               c. Separation is because of hydrogen bonds breaking
     2. Primer annealing 
               a. Then you lower the temperature to 65 which allows a piece of the DNA to bind to the initial step product. 
               b. Each strand of DNA molecule becomes annealed with an oligonucleotide primer complementary to either end of the target sequence.
     3. Primers extension
               a. DNA polymerase is added and complementary strands are synthesized at 65-75 C
               b. Causes synthesis of a new strand in the direction of 5 to 3 direction

4.



Reagent Volume
Template DNA (20ng) .2 µL
10 µM forward primer 1.0 µL
10 µM reverse primer 1.0 µL
GoTaq master mix 50.0 µL
dH20 47.8 µL
Total volume 100.0 µL




)


Flourimeter Measurements

Flourimeter Setup

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology
Underlying Theories PCR produces amplification in the presence of cancer SNP by creating around 100 billion copies of certain sequences found in the DNA. This process can take only a couple hours. During the process, Primers are added to the extracted DNA, where it attaches to the ends of specific DNA segments. Nucleotides are added so that they can create new copies of the DNA. Finally, DNA polymerase is added and works to make new DNA copies by attaching matching nucleotides. With increased temperatures, the double helix of the target sequence separates. Primers attach onto targeted regions on the separated strands and the polymerase attaches free floating nucleotides on the new strands. The process of separating and reattaching of the targeted sequence is repeated and in the end, around a billion of DNA present will be those of the DNA segments that has been targeted and contains the SNP.

The gene we are looking at is rs17879961, a gene that indicates susceptibility to breast and colorectal cancer. It is located on chromosome 22 and codes for a cell-cycle regulatory kinase responsible for DNA repair processes in BRCA1, a gene that is responsible for breast cancer.

In normal patients, the gene sequence is as follows:

GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC

But in patients susceptible to cancer, the gene sequence undergoes a slight change:

GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC

This is a change from an ATT codon to an ACT, a switch from isoleucine to threonine.

The NCBI database is used to isolate the sequence used and determine specific primers.

(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)




Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 267793 0 Negative
PCR: Positive Control 27409968 2 Positive
PCR: Patient 1 ID 91562, rep 1 3511064 0.238984 Negative
PCR: Patient 1 ID 91562, rep 2 15099598 1.09290 Positive
PCR: Patient 1 ID 91562, rep 3 8451848 0.603051 Negative
PCR: Patient 2 ID 25235, rep 1 17311845 1.25591 Positive
PCR: Patient 2 ID 25235, rep 2 9289657 0.200563 Negative
PCR: Patient 2 ID 25235, rep 3 28825322 2.10429 Positive


KEY

  • Sample = Sample denotes the sample of DNA used in a given trial. Each sample represents one extraction of DNA from one of two patients. The multiple trials per patient guarantee accurate results that a single trial could not, for example false positives and false negatives can impact the results and multiple trials will somewhat eliminate the error of one trial.
  • Integrated Density =
  • DNA μg/mL = To calculate the concentration of DNA, we created a calibration curve using the given concentrations of DNA for the negative and positive control samples - 0 μg/mL and 2 μg/mL, respectively. This yielded the equation y = (X-267793)/(13571087.5) where y = the concentration of DNA in μg/mL and X = the integrated density for a given sample.
  • Conclusion = DNA concentrations of over 1 μg/mL yielded positive results; if the concentration was less than 1 μg/mL, the sample yielded negative results




Personal tools