OUR TEAM
Name: Andrea Carpenter Role(s): Experimental Protocol Planner
| Name: Malik McLaurin Role(s): Open PCR Machine Engineer
| Name: Dana McElwain Role(s): Open PCR Machine Engineer
| Name: Chris Anastos Roles(s): R&D Scientist
| Name: Michelle Nguyen Role(s): R&D Scientist
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along as the important parts included in this week's lab, are all diagramed.
Key Features
The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid:
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them.
Another change made on the machine was the hinge/lock of the heating lid:
Instructions
Protocols
Materials
Supplied in Kit
| Supplies
| Amount
|
| Micro Test Tubes | 50
|
| glass slides | 25
|
| Transfer Pipettes | 50
|
| PCR Master Mix | 6 samples (598.8μL total)
|
| Positive Control Solution* | 1 sample (100.0μL***)
|
| Negative Control Solution** | 1 sample (100.0μL***)
|
| PCR Machine | 1
|
| Fluorimeter | 1
|
(*)Positive control consists of calf thymus DNA
(**)Negative control simply consists of a blank solution of water
(***)Already mixed with PCR master mix
Included in Fluorimeter Package:
| Supplies
| Amount
|
| Smart phone stand | 1
|
| LCD Box | 1
|
| Light box | 1
|
| Sybr green solution | 500.0μL
|
Components of PCR master mix:
| DNA Solution Component
| Amount
|
| Patient’s Template DNA* | 0.2μL
|
| 10μM forward primer | 1.0μL
|
| 10μM reverse primer | 1.0μL
|
| Promega GoTaq master mix | 50.0μL
|
| dH2O | 47.8μL
|
| Total | 100.0μL
|
(*)Not actually included in kit, but must be added to the master mix by the user.
Supplied by User
| Supplies
| Amount
|
| Smart Phone with Camera | 1
|
| Patient's Template DNA | 6 samples (0.2μL each)
|
| External Computer | 1
|
| Image J Software | 1
|
| Open PCR Software | 1
|
| Gloves | 1 pair
|
| Fine Point Sharpie | 1
|
| Lab Coat | 1
|
PCR Protocol
- Make sure to have the Open PCR software downloaded onto your computer.
- Place PCR machine onto a sturdy surface and turn on machine. Plug the machine into an electrical outlet and connect the machine to your computer's USB port.
- Perform a Pre-Flight test by going under re-run an experiment; click on the list and select "a simple test"
- After reviewing the protocol click "start" and witness OpenPCR go through the procedure.
- Once the machine has gone through he simple test, create a new program in the program by clicking on "Add a New Experiment"
- Click on "more options"
- Click on the plus symbol next to the initial step and put 95°C for temperature and 180 seconds for time.
- In the third section, put in 30 for the number of cycles.
- Set the denaturing temperature to 95°C and time to 30 seconds.
- Set the annealing temperature to 57°C and time to 30 seconds.
- Set the extending temperature to 72°C and time to 30 seconds.
- Add a final step. Set the temperature to 72°C and the time to 180 seconds.
- Set the final hold to 4°C.
- Transfer each extracted DNA sample into separate PCR micro test tubes.
- Add the 99.8μL of the PCR master mix to each DNA sample.
- Place each micro test tube in the PCR machine, including the provided positive and negative controls.
- Use a fine point Sharpie to label each test tube.
- Close the lid of the machine and tighten the screw on the lid clockwise to the marked red line, so that the lid barely touches the top of the test tubes.
- Click on "Plug in Open PCR to start" to being amplifying the DNA samples.
- Allow the machine to run thorough the program (this should take about two hours) to allow the PCR machine to amplify DNA 30 times.
DNA Measurement Protocol
- Open the lid of the PCR machine and remove the 2 controls and the 6 samples (or more if the user added more of their own samples) from the PCR tray after the PCR protocol has finished.
- Using a fine point sharpie, label each transfer pipette and micro test tube to avoid contamination.
- Using one of the pipettes, place two drops of Sybr green solution in the middle of the first two rows of the slide.
- Fill a different pipette with one of the samples from the micro test tube and carefully place two additional drops on the glass slide so that the drops combine to form one drop that should then be pinned and look like a beach ball.
- Unbutton one side of the black light box and fold over flap so that it is resting on top of the box.
- Turn on the excitation light on the LED box using the switch for the blue LED.
- Place your smart phone on the cradle at a right angle from the slide and make the following adjustments:
- Turn on the camera setting
- TURN OFF THE FLASH
- set the ISO to 800 (or higher if possible)
- increase the exposure to maximum
- increase the saturation to maximum
- decrease the contrast setting to minimum
- if possible, turn off auto focus and make sure that you can take an image where the drop on the slide will be in focus.
- Adjust the distance between the smartphone on its cradle and the first two rows of the glass slide so that it is as close as you can get without having a blurry image.
- Align the drop by moving the slide so that the blue LED light is focused by the drop to the middle of the blak fiber optic fitting on the other side of the drop (you will see that it has a small opening that is used for spectral measurement).
- Close the flap of the light box, but make sure you can still access your smart phone to take the image. The light box should be used to remove as much light from the image as possible, but some light is still okay.
- Take three images of the drop of water, be sure the photo is focused and you do not move the smart phone.
- Open the flap to the light box.
- Use a clean labeled (as waste) pipette to remove the drop from the slide surface. Push the slide in further so that you are now using the next set of two holes.
- Repeat steps 3, 4, 8-11 for each sample. When you run out of holes on the slide, put the used slide aside and bring out a new glass slide to use.
- Make sure you have the Image J software downloaded onto your computer.
- Once you have taken all the pictures, download them onto a computer (you can do this many different ways, using a USB 2.0 cord, email, etc.).
- Open the photos (you must do this image analysis one at a time) in the Image J program by going under File and selecting Open and choosing the desired images.
- In Image J, select analyze>set measurements and choose the area, integrated density, and the mean grey value.
- Select Image>Color>Split channels and three images should open. Choose the image named green.
- Draw an oval surrounding the drop and choose analyze and measure. Record the necessary measurements.
- Obtain the background reading by moving the oval over the dark area surrounding the drop and record the INTDEN and RAWINTDEN.
- Do the Image J processing for each photo.
- Subtract the INTDEN background measurement from the INTDEN drop measurement.
- Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL.
- Using a graphing program, generate a plot of INTDEN (with the background measurement subtracted) versus concentration. Display the linear regression.
- Using the linear regression information, and the INTDEN values of the samples to determine their concentrations.
- When DNA concentrations of the positive and negative controls are known, use this information to determine whether samples have a positive or negative result for the disease.
Research and Development
Background on Disease Markers
For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
The pathogenic allele origin for AML is a C-germline to A-germline mutation. In other words, cytosine is changed to adenine at chromosomal position 36259238 on chromosome 21. Also, it is important to mention that the gene associated with AML is RUNX1; a mutation in RUNX1 can even be associated with breast cancer. The DNA we are concerned with is GCAGCATGGTGGAGGTGCTGGCCGAC[A/C]ACCCGGGCGAGCTGGTGCGCACCGA.
Another form of leukemia, transient myeloproliferative leukemia, is identified with a heterozygous C to A transversion as well. In a 2002 leukemia journal written by Taketani et al., the RUNX1 gene was screened and studied in a sample group of 46 patients with down syndrome. These patients all had hematologic malignancies, meaning they were all affected by different cancers associated with bone marrow. Out of these patients, was identified with this C to A transversion and diagnosed with transient myeloproliferative leukemia 5 days after birth. However, the newborn patient died 12 months after birth. The newborn was never screened for acute myeloid leukemia. The conclusion here is that if there is an identified C-A mutation regarding the RUNX1 gene, then AML should be screened and tested for. An amniotic fluid test should be given to pregnant women in order to determine if their children carry the mutated gene associated with acute myeloid leukemia. http://omim.org/entry/151385#0008
Primer Design
In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation.
Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): TCAGCCGGTCGTGGAGGTGG
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC
The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
Illustration
|