OUR TEAM
Name: Andrea Carpenter Role(s): Experimental Protocol Planner
| Name: Malik McLaurin Role(s): Open PCR Machine Engineer
| Name: Dana McElwain Role(s): Open PCR Machine Engineer
| Name: Chris Anastos Roles(s): R&D Scientist
| Name: Michelle Nguyen Role(s): R&D Scientist
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Key Features
The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid:
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them.
Instructions
Protocols
Materials
Supplied in Kit
| Supplies
| Amount
|
| Micro Test Tubes | 50
|
| glass slides | 25
|
| Transfer Pipettes | 50
|
| PCR Master Mix | 6 samples (598.8μL total)
|
| Positive Control Solution* | 1 sample (100.0μL***)
|
| Negative Control Solution** | 1 sample (100.0μL***)
|
| PCR Machine | 1
|
| Fluorimeter | 1
|
(*)Positive control consists of calf thymus DNA
(**)Negative control simply consists of a blank solution of water
(***)Already mixed with PCR master mix
Included in Fluorimeter Package:
| Supplies
| Amount
|
| Smart phone stand | 1
|
| LCD Box | 1
|
| Light box | 1
|
| Sybr green solution | 500.0μL
|
Components of PCR master mix:
| DNA Solution Component
| Amount
|
| Patient’s Template DNA* | 0.2μL
|
| 10μM forward primer | 1.0μL
|
| 10μM reverse primer | 1.0μL
|
| Promega GoTaq master mix | 50.0μL
|
| dH2O | 47.8μL
|
| Total | 100.0μL
|
(*)Not actually included in kit, but must be added to the master mix by the user.
Supplied by User
| Supplies
| Amount
|
| Smart Phone with Camera | 1
|
| Patient's Template DNA | 6 samples (0.2μL each)
|
| External Computer | 1
|
| Image J Software | 1
|
| Open PCR Software | 1
|
| Gloves | 1 pair
|
| Fine Point Sharpie | 1
|
| Lab Coat | 1
|
PCR Protocol
-
DNA Measurement Protocol
- Remove the 2 controls and the 6 samples (or more if the user added more of their own samples) from the PCR tray after the PCR protocol has finished.
- Using a fine point sharpie, label each
Research and Development
Background on Disease Markers
For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
The pathogenic allele origin for AML is a C-germline to A-germline mutation. In other words, cytosine is changed to adenine at chromosomal position 36259238 on chromosome 21. Also, it is important to mention that the gene associated with AML is RUNX1; a mutation in RUNX1 can even be associated with breast cancer. The DNA we are concerned with is GCAGCATGGTGGAGGTGCTGGCCGAC[A/C]ACCCGGGCGAGCTGGTGCGCACCGA.
Another form of leukemia, transient myeloproliferative leukemia, is identified with a heterozygous C to A transversion as well. In a 2002 leukemia journal written by Taketani et al., the RUNX1 gene was screened and studied in a sample group of 46 patients with down syndrome. These patients all had hematologic malignancies, meaning they were all affected by different cancers associated with bone marrow. Out of these patients, was identified with this C to A transversion and diagnosed with transient myeloproliferative leukemia 5 days after birth. However, the newborn patient died 12 months after birth. The newborn was never screened for acute myeloid leukemia. The conclusion here is that if there is an identified C-A mutation regarding the RUNX1 gene, then AML should be screened and tested for. An amniotic fluid test should be given to pregnant women in order to determine if their children carry the mutated gene associated with acute myeloid leukemia. http://omim.org/entry/151385#0008
Primer Design
In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation.
Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): TCAGCCGGTCGTGGAGGTGG
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC
The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
Illustration
|