BME103:W930 Group5 l2: Difference between revisions
m (→Protocols) |
|||
Line 148: | Line 148: | ||
<u>'''PCR Protocol'''</u><br> | <u>'''PCR Protocol'''</u><br> | ||
# | #Make sure to have the Open PCR software downloaded onto your computer.<br> | ||
#Place PCR machine onto a sturdy surface and turn on machine. Plug the machine into an electrical outlet and connect the machine to your computer's USB port. <br> | |||
#Perform a Pre-Flight test by going under re-run an experiment; click on the list and select "a simple test"<br> | |||
#After reviewing the protocol click "start" and witness OpenPCR go through the procedure. <Br> | |||
#Once the machine has gone through he simple test, create a new program in the program by clicking on "Add a New Experiment"<br> | |||
#*Click on "more options"<br> | |||
#*Click on the plus symbol next to the initial step and put 95°C for temperature and 180 seconds for time.<br> | |||
#*In the third section, put in 30 for the number of cycles. <br> | |||
#*Set the denaturing temperature to 95°C and time to 30 seconds.<br> | |||
#*Set the annealing temperature to 57°C and time to 30 seconds.<br> | |||
#*Set the extending temperature to 72°C and time to 30 seconds.<br> | |||
#*Add a final step. Set the temperature to 72°C and the time to 180 seconds.<br> | |||
#*Set the final hold to 4°C.<br> | |||
#Transfer each extracted DNA sample into separate PCR micro test tubes.<br> | |||
#Add the 99.8μL of the PCR master mix to each DNA sample.<br> | |||
#Place each micro test tube in the PCR machine, including the provided positive and negative controls. <br> | |||
#Use a fine point Sharpie to label each test tube.<br> | |||
#Close the lid of the machine and tighten the screw on the lid clockwise to the marked red line, so that the lid barely touches the top of the test tubes.<br> | |||
#Click on "Plug in Open PCR to start" to being amplifying the DNA samples. <br> | |||
#Allow the machine to run thorough the program (this should take about two hours) to allow the PCR machine to amplify DNA 30 times. | |||
Line 174: | Line 192: | ||
#Use a clean labeled (as waste) pipette to remove the drop from the slide surface. Push the slide in further so that you are now using the next set of two holes. <br> | #Use a clean labeled (as waste) pipette to remove the drop from the slide surface. Push the slide in further so that you are now using the next set of two holes. <br> | ||
#Repeat steps 3, 4, 8-11 for each sample. When you run out of holes on the slide, put the used slide aside and bring out a new glass slide to use. <br> | #Repeat steps 3, 4, 8-11 for each sample. When you run out of holes on the slide, put the used slide aside and bring out a new glass slide to use. <br> | ||
#Make sure you have the Image J software downloaded onto your computer.<br> | |||
#Once you have taken all the pictures, download them onto a computer (you can do this many different ways, using a USB 2.0 cord, email, etc.).<br> | #Once you have taken all the pictures, download them onto a computer (you can do this many different ways, using a USB 2.0 cord, email, etc.).<br> | ||
#Open the photos (you must do this image analysis one at a time) in the Image J program by going under <b>File</b> and selecting <b>Open</b> and choosing the desired images.<br> | #Open the photos (you must do this image analysis one at a time) in the Image J program by going under <b>File</b> and selecting <b>Open</b> and choosing the desired images.<br> |
Revision as of 10:54, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. Instructions
ProtocolsMaterials
(*)Positive control consists of calf thymus DNA Included in Fluorimeter Package:
Components of PCR master mix:
(*)Not actually included in kit, but must be added to the master mix by the user. Supplied by User
PCR Protocol
Research and DevelopmentBackground on Disease Markers For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
|