BME103:W930 Group5 l2
From OpenWetWare
(→Research and Development) |
(→Research and Development) |
||
| Line 185: | Line 185: | ||
'''Illustration''' | '''Illustration''' | ||
<br><center> | <br><center> | ||
| - | [[Image:DNA-1.png| | + | [[Image:DNA-1.png|700px]] |
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
Revision as of 13:03, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. Instructions
ProtocolsMaterials
(*)Positive control consists of calf thymus DNA Included in Fluorimeter Package:
Components of PCR master mix:
(*)Not actually included in kit, but must be added to the master mix by the user. Supplied by User
PCR Protocol
DNA Measurement Protocol
Research and DevelopmentBackground on Disease Markers For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


