BME103:W930 Group5 l2: Difference between revisions
Line 175: | Line 175: | ||
In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation. | In the above sequence for the acute myeloid leukemia disease allele, the mutation occurs at the A/C mutation site. For a non-disease bearing allele, C will be coded in the sequence. For the disease bearing allele, A will be coded in place of C, resulting in a missense mutation. | ||
Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): | Forward primer sequence (while reading left to right, 5'-3', position indicated is 36259238 to 36259238): TCAGCCGGTCGTGGAGGTGG | ||
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC | |||
The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine. | The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine. | ||
Revision as of 09:34, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
(*)Positive control consists of calf thymus DNA Included in Fluorimeter Package:
Components of PCR master mix:
(*)Not actually included in kit, but must be added to the master mix by the user. Supplied by User
PCR Protocol
DNA Measurement Protocol
Research and DevelopmentBackground on Disease Markers For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
|