BME103:W930 Group5

From OpenWetWare
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Andrea Carpenter
Role(s): Experimental Protocol Planner & DNA Measurement Operator: Smartphone
Name:Dana McElwain
Role(s): Open PCR Machine Engineer & ImageJ Software Processor
Name: Michelle Nguyen
Role(s): R&D Scientist & Protocol Person: Sample Prep & Application
Name: Nathan Holman
Role(s): Experimental Protocol Planner & Data Compiler & Analyzer
Name: MalikMclaurin
Roles(s): Open PCR Machine Engineer
Name: Chris Anastos
Roles(s): R&D Scientist & R&D Scientist: Open Wet Ware

LAB 1 WRITE-UP

Initial Machine Testing

. The Original Design
http://openwetware.org/images/3/36/PCR_group_5_labeled_diagram.png
This is a diagram of the inside of the OpenPCR Machine. By connecting this machine through a USB port to a computer, it allows you to amplify DNA to later analyze different markings and base pairs within the sequence.


Experimenting With the Connections

When the LCD screen was unplugged from the Open PCR brains Board, the feeder information was no longer available on the screen.

When we unplugged the white wire that connects the brain board to the 16 tube PCR block, the machine temperature was unable to be regulated.


Test Run

The initial test date of the Open PCR Machine was October 24, 2012. Our experience with the machine was rather time consuming, with the experiment taking an hour and a half to complete. However, the machine was very straightforward and easy to use.




Protocols

Polymerase Chain Reaction

The Polymerase Chain Reaction is a process controlled by thermal cycling; a system of repeatedly heating and cooling the sample. It is simple and inexpensive, as PCR allows you to make millions of copies of DNA to better analyze data. First you need a small amount of DNA and a small amount of some PCR reaction mix. A program on the machine needs to be created consisting of three stages. During the three stages, the DNA is first heated to separate the DNA double helix, creating two single stranded DNA molecules. The thermal cycler is now cooled and primers match up to the DNA strands before they naturally attempt to pair up. As the cycles progress, DNA is replicated and used as a template to create additional copies. There are several components of a PCR reaction. The template DNA amplifies millions of copies to determine if they are cancerous. The many primers start the binding of complentary strands (specific primers) and they bind to cancer sequences. The taq polymerase is a protein that catalyzes the DNA assembly. There is also a cofactor, which binds to Taq to enable optimal binding speed. Lastly, there are deoxynucleotide tri-phosphates, which builds a new strand of DNA.

Steps to Describe How to Amplify a Patient's DNA Sample:

Step 1: Initiation
During this step the reaction needs to be heated to around 95 degrees Celsius and held there for about three minutes.

Step 2: Heat Denaturation
A DNA molecule carrying a target sequence is denatured by heat (90-95 degrees Celsius) and the two strands are separated.

Step 3: Primer Annealing
As the mixture cools, each strand of DNA molecule becomes annealed with an oligonucleotide primer conplementary to either end of the target sequence.

Step 4: Primer Extension
DNA polymerase is added and complementary strands are synthesized at a temperature of 60-75 degrees Celsius.

Step 5: Termination
During this step, the final hold, the reaction is held at 4 degrees Celsius to stabilize the reaction.

Reagent Volume
Template DNA (20ng) 0.2 μL
10 μM forward primer 1.0 μL
10 μM reverse primer 1.0μL
GoTaq Master Mix 50.0 μL
dH2O 47.8 μL
Total Volume 100.0 μL

Flourimeter Measurements

http://openwetware.org/images/3/33/Results.xls

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

CHEK 2, code rs17879961, is a single nucleotide polymorphism (SNP) that is linked to cancer. It is a symbol for CHK2 Checkpoint Homolog and is located on chromosome 22. Mutations of the CHEK2 gene are related to increased risk of breast cancer. In week three's class, it was concluded that PCR can be used to bind specific DNA primers to the cancerous DNA bases--resulting in cancerous DNA amplification. As a result, the PCR reaction will form normal DNA sequences and the supposed cancerous CHEK2 strain. Possible primers for supposed amplification were used in the experiment and were compared to sample sequences to determine if the DNA in question was amplified.

Extra information: Gene missense, T mutates to cancer associated C for the specific allele. Cancer sequence binding primer: AACTCTTACACTGCATACAT



Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control E6 F6 G6
PCR: Positive Control E7 F7 G7
PCR: Patient 1 ID #####, rep 1 E8 F8 G8
PCR: Patient 1 ID #####, rep 2 E9 F9 G9
PCR: Patient 1 ID #####, rep 3 E10 F10 G10
PCR: Patient 2 ID #####, rep 1 E11 F11 G11
PCR: Patient 2 ID #####, rep 2 E12 F12 G12
PCR: Patient 2 ID #####, rep 3 E13 F13 G13


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =