BME103:W930 Group4 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Christian Vargas Protocol(s) Name: Jake Krammer Research and Development Name: Jan Simper Research and Development Name: Renaad Mohammed Protocol(s) Name: Lauren Allison Open PCR Machine Engineer(s) Name: Justus Vangor Open PCR Machine Engineer(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Case: The new casing will become larger to implement a set of two drawers in the front. They will be placed near the top of the case and in the middle of the front panel. These will hold the additional sample plates being added to the design, providing for higher testing numbers and easier separation of sample groups. Heat Sinks/Fans/Mounting Plates: The new design will have two of heaters attached to two fans, one corresponding to each drawer of sample plates and placed beneath them, just as they were placed beneath the original heat lid. Adding additional heating and cooling elements will allow the machine to adjust the temperature of more samples, more quickly. Similarly, another mounting plate will be added to correct for the increase in sample plate size. The new, larger mounting plate will accommodate all the additional PCR blocks. PCR Blocks/Square Aluminum Adapter Plates/Thermal Pads: As the main component of the new design, sample plates have been added. Within the framework of each drawer, and placed atop the mounting plate which has been adjusted for size, four square aluminum adapter plates will be laid down. On top of them, four ceramic peltier heaters, followed by four PCR blocks (each of which contains 16 wells). All these elements will be lined with thermal padding. This expands the sample number from 16 to 128 spread across two drawers, while still maintaining accuracy in temperature fluctuation between sample sets. Insulation: Once the new sample plates have been placed within the mounting plate, along with all the thermal padding and heating elements, additional insulation will need to be added. Around the perimeter of the four consecutive plates, white insulation strips will be placed just as before around the single plate to ensure that the temperature of the samples is not lost through the PCR block. Instructions All instructions from the original PCR design will be followed with these new-design exceptions: The Core: Find these parts- Heat Sinks (2) and Fans (2) Small screws (16) Metal Arms (4 left, 4 right) 1) The 8 heat sink arms have plastic clips. These clips need to be removed. 2) Find your pliers and break off 4 of the black plastic tabs. Avoid bending the metal arm. 3) Remove the stickers on top of the heat sinks that read "Please peel off label". 4) Use 4 aluminum screw to mount the arms onto the heat sinks. Make sure all the arms angle down. 5) Repeat for the remaining arms. Now find these parts- Aluminum Mounting Plates (8) Square Aluminum Adapter Plates (8) Ceramic Peltier Heaters (8) 16 well PCR Blocks (8 - Note: Fragile) Metal short screws 5 mm diameter (32) Black plastic spacers 10 mm diameter (32) Small button head screws (32) Plastic washers (32) Insulation strips (16) Gray thermal pads (24) Thermal Paste 1) Working with one heat sink and one mounting plate, align the mounting plate. 2) Using a 5 mm screw and a 10 mm black plastic washer, screw the mounting plate into the heat sink. Repeat with the other 3 screws. 3) Repeat steps 1 and 2 with the second heat sink and mounting plate. 1) Find one square aluminum adapter plate. Take one thermal pad, ensuring it does not touch or rub against anything. Remove the adhesive backing from the thermal pad and stick it to the adapter plate. 2) Find one peltier heater and another thermal pad. Stick a thermal pad to the heater and set aside. 3) Find one PCR block and another thermal pad. Attach the thermal pad to the underside. Set aside carefully. 4) Repeat steps 1 through 3 to create 7 more thermal-pad lined adapters/heaters/PCR blocks. 1) Squirt a small amount of the thermal paste onto the copper-aluminum parts of the heat sink. Do not cover the whole surface. 2) Stack one aluminum plate, peltier, and block with all thermal pads facing down into one corner notch of the mounting plate. 3) Using the tiny screws, mount the heat block to the notches in the mounting plate. 4) Repeat with the 7 additional sets, creating and mounting 7 heat blocks. 5) Remove the backing from the insulation strips and attach them to the perimeter of the heat blocks. Protocols Materials Supplied in the Kit Amount Template DNA (20 ng) 0.2 µL 10 µM Forward Primer 1.0 µL 10 µM Reverse Primer 1.0 µL GoTaq Master Mix 50.0 µL dH2O 47.8 µL PCR Machine 1 Power Adapter 1 Sample Tubes 128 Disposable Pipettes 128 Black Box 1 Camera Holder 1 Glass Slides 26 Supplied by the User Amount Computer 1 Android Phone w/ Camera 1 Gloves 2 pairs ImageJ Software 1 Open PCR Software 1 PCR Protocol 1. Open your computer and download the OpenPCR software. 2. Place the OpenPCR machine next to the computer; make sure that it wont gets disturbed. 3. Open the PCR machine by using the power adapter provided and plugging it into an electrical outlet. 4. Connect the Open PCR machine to your computer you can do that by using the USB 2.0 cable. 5. Create a new program on OpenPCR and Program the following: • Go to the “more options” button • Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time • Input 30 for the number of cycles • Set the denaturing temperature to 95°C and time to 30 seconds. • Set the annealing temperature to 57°C and time to 30 seconds. • Set the extending temperature to 72°C and time to 30 seconds. • Add a final step. Set the temperature to 72°C and the time to 180 seconds. • Set the final hold to 4°C. 6. Use one pipette to transfer one of the extracted DNA samples into one of the PCR test tubes. 7. By using different pipettes for each add the forward and reverse primers to the test tube. 8. use another pipette to transfer GoTaq master mix into the DNA/primer mixture. 9. Dilute the contents of the test tube by filling its remainder with deionized water. 10. Place the 128 test tubes including the positive and negative controls into the Open PCR machine. 11. Close the lid 12. Click on “Plug in Open PCR to start” to begin amplifying DNA samples. 13. After amplifying is complete, open the lid and remove tubes for signal reading DNA Measurement Protocol 1. Open the lid of the PCR machine (by releasing the catch) and remove the 8 samples from the PCR machine. 2. Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide. 3. Label each pipette so that you don't use the same one for each sample. 4. Place the glass slide with the drops on the device. 5. Turn on the blue LED light. 6. Place the smartphone on the holder provided and position them in front of the device. 7. Place a box on top of the device and smartphone to create a dark environment. 8. Take a close clear picture of the drop. 9. 8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the device also make sure the phone is at the same position each time. 10. Using the android phone, email the pictures taken from the phone to the email of the ImageJ Software Operator. 11. Open the email of the ImageJ Operator and save the pictures onto the computer of the ImageJ Software Operator. 12. Open up the ImageJ Software. 13. Click File > Open. 14. Then select the images from wherever they were saved on the computer. 15. Click open and the image should appear in the program. Research and Development Background on Disease Markers Our group decided to look at two different diseases, metabolic syndrome and cardiovascular disease. Metabolic syndrome is a name for a group of risk factors that occur together and increase the risk for coronary artery disease, stroke, and type 2 diabetes. Cardiovascular disease refers to any disease that affects the cardiovascular system, principally cardiac disease, vascular diseases of the brain and kidney, and peripheral arterial disease. The associated mutation for metabolic syndrome was rs1800206, and for cardiovascular disease it was rs1801253. The mutation for metabolic syndrome is found on the 22nd chromosome in position 46614274, changing the normal cytosine to a guanine base, as seen in the sequence TTGTCGATTTCACAAGTGC[C/G]TT. The codon is thus changed from leucine to valine. Among 632 men, Robitaille et al. (2004) found increased frequency of the mutation among those with abdominal obesity, hypertriglyceridemia, high plasma apoB, and low HDL plasma levels, which are components of the metabolic syndrome. The frequency of the mutation was approximately 10% in their group. The mutation for cardiovascular disease is found on the tenth chromosome in position 115805056, changing the guanine base to a cytosine base, as seen in the sequence CTTCCGCAAGGCCTTCCAG[C/G]GA. The codon is changed from glycine to arginine. Among black subjects, Small et al. (2002) found an adjusted odds ratio for heart failure in persons who were homozygous for both the mutation and for a 4-bp deletion (322-325del; 104250.0001) in the ADRA2C gene. Small et al. reasoned that the increased function of the mutation of the beta-1-adrenergic receptor on myocytes would in combination result in increased synaptic norepinephrine release and enhanced receptor function at the myocyte, thus predisposing persons to heart failure. They found no increased risk with the mutation alone. In addition, there is evidence that the mutation affects a person's response to medication. Liggett et al. (2006) found that people with the mutation treated with the beta-blocker bucindolol had an age-, sex-, and race-adjusted 38% reduction in mortality (p = 0.03) and a 34% reduction in mortality or hospitalization (p = 0.004) versus the placebo group. The patients without the mutation had no clinical response to bucindolol compared with the placebo group. Primer Design The primers for rs1800206, or the metabolic syndrome mutation, would be: Forward Primer: 5'GAAACAATAAATGAGCAACA3' Reverse Primer: 3'AGTGTTCACGCAAAGACAGC5' The primers for rs1801253, or the cardiovascular disease mutation, would be: Forward Primer: 5'GAGCAGAAGGCGCTCAAGAC3' Reverse Primer: 3'CCGGAAGGTCGCTGACGAGA5' The reason the disease allele gives off a product while the non-disease allele does not centers on the presence of the mutation. A disease allele will give a PCR product due to it containing the mutation in a single base pair. The primer has the complementary base pair to the mutation. Without the mutation, the primer cannot bind with the DNA sequence. Therefore, when the mutation is not present, such as in the non-disease allele, there will be no PCR product and the DNA sequence will not be copied. Illustration