BME103:W930 Group4 l2
From OpenWetWare
(→Research and Development) |
(→Research and Development) |
||
| Line 169: | Line 169: | ||
'''Primer Design''' | '''Primer Design''' | ||
| + | The primers for rs1800206, or the metabolic syndrome mutation, would be: | ||
| - | Forward Primer: | + | Forward Primer: 5'GAAACAATAAATGAGCAACA3' |
| - | Reverse Primer: 5' | + | Reverse Primer: 3'AGTGTTCACGCAAAGACAGC5' |
| + | |||
| + | The primers for rs1801253, or the cardiovascular disease mutation, would be: | ||
| + | |||
| + | Forward Primer: 5'GAGCAGAAGGCGCTCAAGAC3' | ||
| + | |||
| + | Reverse Primer: 3'CCGGAAGGTCGCTGACGAGA5' | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Revision as of 18:25, 27 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||
| | ||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Case: The new casing will become larger to implement a set of two drawers in the front. They will be placed near the top of the case and in the middle of the front panel. These will hold the additional sample plates being added to the design, providing for higher testing numbers and easier separation of sample groups. Heat Sinks/Fans/Mounting Plates: The new design will have two of heaters attached to two fans, one corresponding to each drawer of sample plates and placed beneath them, just as they were placed beneath the original heat lid. Adding additional heating and cooling elements will allow the machine to adjust the temperature of more samples, more quickly. Similarly, another mounting plate will be added to correct for the increase in sample plate size. The new, larger mounting plate will accommodate all the additional PCR blocks. PCR Blocks/Square Aluminum Adapter Plates/Thermal Pads: As the main component of the new design, sample plates have been added. Within the framework of each drawer, and placed atop the mounting plate which has been adjusted for size, four square aluminum adapter plates will be laid down. On top of them, four ceramic peltier heaters, followed by four PCR blocks (each of which contains 16 wells). All these elements will be lined with thermal padding. This expands the sample number from 16 to 128 spread across two drawers, while still maintaining accuracy in temperature fluctuation between sample sets. Insulation: Once the new sample plates have been placed within the mounting plate, along with all the thermal padding and heating elements, additional insulation will need to be added. Around the perimeter of the four consecutive plates, white insulation strips will be placed just as before around the single plate to ensure that the temperature of the samples is not lost through the PCR block.
All instructions from the original PCR design will be followed with these new-design exceptions:
2) Find your pliers and break off 4 of the black plastic tabs. Avoid bending the metal arm. 3) Remove the stickers on top of the heat sinks that read "Please peel off label". 4) Use 4 aluminum screw to mount the arms onto the heat sinks. Make sure all the arms angle down. 5) Repeat for the remaining arms.
2) Using a 5 mm screw and a 10 mm black plastic washer, screw the mounting plate into the heat sink. Repeat with the other 3 screws. 3) Repeat steps 1 and 2 with the second heat sink and mounting plate.
2) Find one peltier heater and another thermal pad. Stick a thermal pad to the heater and set aside. 3) Find one PCR block and another thermal pad. Attach the thermal pad to the underside. Set aside carefully. 4) Repeat steps 1 through 3 to create 7 more thermal-pad lined adapters/heaters/PCR blocks.
2) Stack one aluminum plate, peltier, and block with all thermal pads facing down into one corner notch of the mounting plate. 3) Using the tiny screws, mount the heat block to the notches in the mounting plate. 4) Repeat with the 7 additional sets, creating and mounting 7 heat blocks. 5) Remove the backing from the insulation strips and attach them to the perimeter of the heat blocks.
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers Our group decided to look at two different diseases, metabolic syndrome and cardiovascular disease. Metabolic syndrome is a name for a group of risk factors that occur together and increase the risk for coronary artery disease, stroke, and type 2 diabetes. Cardiovascular disease refers to any disease that affects the cardiovascular system, principally cardiac disease, vascular diseases of the brain and kidney, and peripheral arterial disease. The associated mutation for metabolic syndrome was rs1800206, and for cardiovascular disease it was rs1801253. The mutation for metabolic syndrome is found on the 22nd chromosome in position 46614274, changing the normal cytosine to a guanine base, as seen in the sequence TTGTCGATTTCACAAGTGC[C/G]TT. The codon is thus changed from leucine to valine. Among 632 men, Robitaille et al. (2004) found increased frequency of the mutation among those with abdominal obesity, hypertriglyceridemia, high plasma apoB, and low HDL plasma levels, which are components of the metabolic syndrome. The frequency of the mutation was approximately 10% in their group. The mutation for cardiovascular disease is found on the tenth chromosome in position 115805056, changing the guanine base to a cytosine base, as seen in the sequence CTTCCGCAAGGCCTTCCAG[C/G]GA. The codon is changed from glycine to arginine. Among black subjects, Small et al. (2002) found an adjusted odds ratio for heart failure (10.11) in persons who were homozygous for both arg389 of the ADRB1 gene and for a 4-bp deletion (322-325del; 104250.0001) in the ADRA2C gene. Small et al. (2002) reasoned that the increased function of the arg389 form of the beta-1-adrenergic receptor on myocytes would in combination result in increased synaptic norepinephrine release and enhanced receptor function at the myocyte, thus predisposing persons to heart failure. They found no increased risk with the arg389 allele alone. In addition, there is evidence that the mutation affects a person's response to medication. Liggett et al. (2006) found that people with the mutation treated with the beta-blocker bucindolol had an age-, sex-, and race-adjusted 38% reduction in mortality (p = 0.03) and a 34% reduction in mortality or hospitalization (p = 0.004) versus the placebo group. The patients without the mutation had no clinical response to bucindolol compared with the placebo group.
Forward Primer: 5'GAAACAATAAATGAGCAACA3' Reverse Primer: 3'AGTGTTCACGCAAAGACAGC5' The primers for rs1801253, or the cardiovascular disease mutation, would be: Forward Primer: 5'GAGCAGAAGGCGCTCAAGAC3' Reverse Primer: 3'CCGGAAGGTCGCTGACGAGA5'
| ||||||||


