BME103:W930 Group3 l2 - Revision history

Phillip J. Mercado: /* Protocols */

2012-11-28T17:17:02Z

Protocols

←Older revision		Revision as of 17:17, 28 November 2012
Line 286:		Line 286:


-	Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for ~~cancer~~.	+	Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for Alzheimer's disease.

	==Research and Development==		==Research and Development==

Eliza A. Normen at 16:35, 28 November 2012

2012-11-28T16:35:58Z

←Older revision		Revision as of 16:35, 28 November 2012
Line 42:		Line 42:

	'''Instructions'''<br>		'''Instructions'''<br>
-	Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same ~~specs~~ of the preexisting wood piece. This means that the only modification to the instructions should be an updated description of the piece to look for when installing this part. The second changes made to the building instructions will need to describe and depict the attachment of the new "spring clasp" to the lid. The new clasp will consist of two parts--a mortise type receiver, and a tenon. The tenon should be directed to be screwed onto the lid, facing down. The mortise type receiver should be screwed down and attached to the top of the PCR machine that the lid is also attached to. This piece should be corresponding to the tenon component to ensure both pieces fit together during the closing of the lid.	+	Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same measurements of the preexisting wood piece. This means that the only modification to the instructions should be an updated description of the piece to look for when installing this part. The second changes made to the building instructions will need to describe and depict the attachment of the new "spring clasp" to the lid. The new clasp will consist of two parts--a mortise type receiver, and a tenon. The tenon should be directed to be screwed onto the lid, facing down. The mortise type receiver should be screwed down and attached to the top of the PCR machine that the lid is also attached to. This piece should be corresponding to the tenon component to ensure both pieces fit together during the closing of the lid.

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->

Eliza A. Normen at 16:31, 28 November 2012

2012-11-28T16:31:51Z

←Older revision		Revision as of 16:31, 28 November 2012
Line 38:		Line 38:

	'''Key Features'''<br>		'''Key Features'''<br>
-	The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original design ~~of this machine~~ wood was the main ~~structural~~ material of the Open PCR's lid~~; however,this~~ redesign changes the material used on the sides of the lid from wood to plexi-glass. The use of plexi-glass allows for the user to see into the lid of the Open PCR machine.~~In turn allowing~~ the user to view the height of the heat plate while adjusting it, ~~this then minimizes~~ the the chance of the user crushing the DNA samples while lowering the heat plate. The other modification present in the redesign was that the magnetic clasp from the original design was replace by spring catch. The original magnetic clasp on the PCR required too much force to open. While this magnet prevented the lid to open mistakenly during an experiment, it made the machine vulnerable to breakage when the lid needed to be opened. The newly added catch provides the same amount of protection in terms of mistaken lid opening but it also increases ease of use and limits the chance of breakage while opening the lid.	+	The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original structural design wood was the main material of the Open PCR's lid. This redesign changes the material used on the sides of the lid from wood to plexi-glass. The use of plexi-glass allows for the user to see into the lid of the Open PCR machine.This change allows the user to view the height of the heat plate while adjusting it, therefore minimizing the the chance of the user crushing the DNA samples while lowering the heat plate. The other modification present in the redesign was that the magnetic clasp from the original design was replace by spring catch. The original magnetic clasp on the PCR required too much force to open. While this magnet prevented the lid to open mistakenly during an experiment, it made the machine vulnerable to breakage when the lid needed to be opened. The newly added catch provides the same amount of protection in terms of mistaken lid opening but it also increases ease of use and limits the chance of breakage while opening the lid.

Eliza A. Normen at 16:28, 28 November 2012

2012-11-28T16:28:05Z

←Older revision		Revision as of 16:28, 28 November 2012
Line 303:		Line 303:
	Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br>		Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br>
	Forward Primer: TAGCCTATTTATTTTCTTCA<br>		Forward Primer: TAGCCTATTTATTTTCTTCA<br>
-	The diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation.	+	The target diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation.
	<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->		<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->

Phillip J. Mercado: /* Protocols */

2012-11-28T10:33:17Z

Protocols

Show changes

Phillip J. Mercado: /* Protocols */

2012-11-28T10:31:35Z

Protocols

Phillip J. Mercado: /* Protocols */

2012-11-28T10:30:27Z

Protocols

←Older revision		Revision as of 10:30, 28 November 2012
Line 53:		Line 53:
	'''Materials'''		'''Materials'''
	'''List of Required Materials for PCR & DNA measurements'''		'''List of Required Materials for PCR & DNA measurements'''
-

	{\| {{table}}		{\| {{table}}
Line 118:		Line 117:

	Contents of each DNA solution		Contents of each DNA solution
-	{\| ~~class~~="~~wikitable~~"	+	{\| {{table}}
-	\|-	+	\|- style="background:#f0f0f0;"
-	! '''Reagent'''	+	\| '''Reagent''' \|\| '''Volume'''
-	! '''Volume'''	+
	\|-		\|-
-	\| Patient Template DNA	+	\| Patient Template DNA \|\| 0.2 μL
-	\| 0.2 μL	+
	\|-		\|-
-	\| 10 μM forward primer	+	\| 10 μM forward primer \|\| 1.0 μL
-	\| 1.0 μL	+
	\|-		\|-
-	\| 10 μM reverse primer	+	\| 10 μM reverse primer \|\| 1.0 μL
-	\| 1.0 μL	+
	\|-		\|-
-	\| GoTaq® Colorless Master Mix	+	\| GoTaq® Colorless Master Mix \|\| 50.0 μL
-	\| 50.0 μL	+
	\|-		\|-
-	\| dH<sub>2</sub>O	+	\| dH<sub>2</sub>O \|\| 47.8 μL
-	\| 47.8 μL	+
	\|-		\|-
-	\| '''Total Volume'''	+	\| '''Total Volume''' \|\| 100.0 μL
-	\| 100.0 μL	+
	\|-		\|-
	\|}<br>		\|}<br>

Phillip J. Mercado at 10:28, 28 November 2012

2012-11-28T10:28:59Z

Show changes

Troy Kozlowski: /* Research and Development */

2012-11-28T07:16:16Z

Research and Development

←Older revision		Revision as of 07:16, 28 November 2012
Line 168:		Line 168:

	'''Illustration'''<br>		'''Illustration'''<br>
-	[[Image:~~BME103_Group3_PCRexample~~.~~gif‎~~\|600px\|An illustration of how the primers bind to the sample DNA and then how the selected segment of DNA is amplified.]]	+	[[Image:BME103_Group3_PCRexample1.gif\|600px\|An illustration of how the primers bind to the sample DNA and then how the selected segment of DNA is amplified.]]
	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->

Troy Kozlowski: /* Research and Development */

2012-11-28T07:11:52Z

Research and Development

←Older revision		Revision as of 07:11, 28 November 2012
Line 167:		Line 167:


-	'''Illustration'''	+	'''Illustration'''<br>
-		+	[[Image:BME103_Group3_PCRexample.gif‎\|600px\|An illustration of how the primers bind to the sample DNA and then how the selected segment of DNA is amplified.]]
	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->

←Older revision		Revision as of 10:31, 28 November 2012
Line 144:		Line 144:

	Step 4) Initialize the OpenPCR Sofware and create a new program on OpenPCR by clicking on “Add a new experiment.”		Step 4) Initialize the OpenPCR Sofware and create a new program on OpenPCR by clicking on “Add a new experiment.”
-	Substep A) Click on the “more options” button.	+	Substep A) Click on the “more options” button.
-	Substep B) Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time.	+	Substep B) Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time.
-	Substep C) In the box labeled ''Number of Cycles'', input 30.	+	Substep C) In the box labeled ''Number of Cycles'', input 30.
-	Substep D) Set the ''denaturing temperature'' and ''time'' to 95°C and 30 seconds. (''The two boxes in the first row'')	+	Substep D) Set the ''denaturing temperature'' and ''time'' to 95°C and 30 seconds. (''The two boxes in the first row'')
-	Substep E) Set the ''annealing temperature'' and ''time'' to 57°C and 30 seconds. (''The two boxes in the second row'')	+	Substep E) Set the ''annealing temperature'' and ''time'' to 57°C and 30 seconds. (''The two boxes in the second row'')
-	Substep F) Set the ''extending temperature'' and ''time'' to 72°C and 30 seconds. (''The two boxes in the third row'')	+	Substep F) Set the ''extending temperature'' and ''time'' to 72°C and 30 seconds. (''The two boxes in the third row'')
-	Substep G) Add a final step. Set the temperature and time to 72°C and 180 seconds.	+	Substep G) Add a final step. Set the temperature and time to 72°C and 180 seconds.
-	Substep H) Set the final hold temperature to 4°C.	+	Substep H) Set the final hold temperature to 4°C.

	Step 5) Use one pipette to transfer 0.2μL of an extracted DNA sample into a test tube.		Step 5) Use one pipette to transfer 0.2μL of an extracted DNA sample into a test tube.
Line 171:		Line 171:
	Step 13) Be sure to observe the LED display screen on the lid of the Open PCR with the quantities that appear on the computer: if these quantities are close (<2.0°C/5 seconds), then continue running the program. '''If these quantities are not close (>2.0°C/5 seconds), then discontinue the program and inspect the machine for any faults. Begin Step 12 again.'''		Step 13) Be sure to observe the LED display screen on the lid of the Open PCR with the quantities that appear on the computer: if these quantities are close (<2.0°C/5 seconds), then continue running the program. '''If these quantities are not close (>2.0°C/5 seconds), then discontinue the program and inspect the machine for any faults. Begin Step 12 again.'''

-	DNA Measurement Protocol	+
		+	'''DNA Measurement Protocol'''
		+

	Step 1) Open the lid of the PCR machine (by releasing the catch) and remove the 8 samples from the PCR machine.		Step 1) Open the lid of the PCR machine (by releasing the catch) and remove the 8 samples from the PCR machine.