BME103:W930 Group3 l2: Difference between revisions
Jake Swartz (talk | contribs) |
|||
Line 159: | Line 159: | ||
'''Primer Design'''<br> | '''Primer Design'''<br> | ||
Reverse Primer: GT<font color="red">C</font> | Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br> | ||
Forward Primer: TAGCCTATTTATTTTCTTCA | |||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Revision as of 23:54, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Our TeamLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials List of Required Materials for PCR & DNA measurements
PCR Protocol Step 1) Step 2) Step 3) Step 4) Step 5) Step 6) Step 7) DNA Measurement Protocol Step 1) Step 2) Step 3) Step 4) Step 5) Step 6) Step 7) Step 8) Research and DevelopmentBackground on Disease Markers
|