BME103:W930 Group3 l2
From OpenWetWare
Current revision (13:17, 28 November 2012) (view source) (→Protocols) |
|||
| (6 intermediate revisions not shown.) | |||
| Line 38: | Line 38: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
| - | The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original design | + | The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original structural design wood was the main material of the Open PCR's lid. This redesign changes the material used on the sides of the lid from wood to plexi-glass. The use of plexi-glass allows for the user to see into the lid of the Open PCR machine.This change allows the user to view the height of the heat plate while adjusting it, therefore minimizing the the chance of the user crushing the DNA samples while lowering the heat plate. The other modification present in the redesign was that the magnetic clasp from the original design was replace by spring catch. The original magnetic clasp on the PCR required too much force to open. While this magnet prevented the lid to open mistakenly during an experiment, it made the machine vulnerable to breakage when the lid needed to be opened. The newly added catch provides the same amount of protection in terms of mistaken lid opening but it also increases ease of use and limits the chance of breakage while opening the lid. |
'''Instructions'''<br> | '''Instructions'''<br> | ||
| - | Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same | + | Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The first changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid. However, the instructions should hardly be changed at all becasue the new piece of plexi-glass will be made to the same measurements of the preexisting wood piece. This means that the only modification to the instructions should be an updated description of the piece to look for when installing this part. The second changes made to the building instructions will need to describe and depict the attachment of the new "spring clasp" to the lid. The new clasp will consist of two parts--a mortise type receiver, and a tenon. The tenon should be directed to be screwed onto the lid, facing down. The mortise type receiver should be screwed down and attached to the top of the PCR machine that the lid is also attached to. This piece should be corresponding to the tenon component to ensure both pieces fit together during the closing of the lid. |
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 53: | Line 53: | ||
'''Materials''' | '''Materials''' | ||
'''List of Required Materials for PCR & DNA measurements''' | '''List of Required Materials for PCR & DNA measurements''' | ||
| - | |||
{| {{table}} | {| {{table}} | ||
| Line 118: | Line 117: | ||
Contents of each DNA solution | Contents of each DNA solution | ||
| - | {| | + | {| {{table}} |
| + | |- style="background:#f0f0f0;" | ||
| + | | '''Reagent''' || '''Volume''' | ||
|- | |- | ||
| - | + | | Patient Template DNA || 0.2 μL | |
| - | + | ||
|- | |- | ||
| - | | | + | | 10 μM forward primer || 1.0 μL |
| - | | | + | |
|- | |- | ||
| - | | 10 μM | + | | 10 μM reverse primer || 1.0 μL |
| - | | 1.0 μL | + | |
|- | |- | ||
| - | | | + | | GoTaq® Colorless Master Mix || 50.0 μL |
| - | | | + | |
|- | |- | ||
| - | | | + | | dH<sub>2</sub>O || 47.8 μL |
| - | | | + | |
|- | |- | ||
| - | + | | '''Total Volume''' || 100.0 μL | |
| - | + | ||
| - | + | ||
| - | | '''Total Volume''' | + | |
| - | | 100.0 μL | + | |
|- | |- | ||
|}<br> | |}<br> | ||
| Line 146: | Line 138: | ||
Step 1) Download the Open PCR software. | Step 1) Download the Open PCR software. | ||
| + | |||
Step 2) Place the PCR machine on a flat surface, plug it into an electrical outlet by using the power adapter provided in the kit, and then turn on the machine. | Step 2) Place the PCR machine on a flat surface, plug it into an electrical outlet by using the power adapter provided in the kit, and then turn on the machine. | ||
| + | |||
Step 3) Connect the Open PCR machine to your computer with the USB 2.0 cable. | Step 3) Connect the Open PCR machine to your computer with the USB 2.0 cable. | ||
| + | |||
Step 4) Initialize the OpenPCR Sofware and create a new program on OpenPCR by clicking on “Add a new experiment.” | Step 4) Initialize the OpenPCR Sofware and create a new program on OpenPCR by clicking on “Add a new experiment.” | ||
| - | + | ||
| - | + | Substep A) Click on the “more options” button. | |
| - | + | ||
| - | + | Substep B) Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time. | |
| - | + | ||
| - | + | Substep C) In the box labeled ''Number of Cycles'', input 30. | |
| - | + | ||
| - | + | Substep D) Set the ''denaturing temperature'' and ''time'' to 95°C and 30 seconds. (''The two boxes in the first row'') | |
| + | |||
| + | Substep E) Set the ''annealing temperature'' and ''time'' to 57°C and 30 seconds. (''The two boxes in the second row'') | ||
| + | |||
| + | Substep F) Set the ''extending temperature'' and ''time'' to 72°C and 30 seconds. (''The two boxes in the third row'') | ||
| + | |||
| + | Substep G) Add a final step. Set the temperature and time to 72°C and 180 seconds. | ||
| + | |||
| + | Substep H) Set the final hold temperature to 4°C. | ||
| + | |||
Step 5) Use one pipette to transfer 0.2μL of an extracted DNA sample into a test tube. | Step 5) Use one pipette to transfer 0.2μL of an extracted DNA sample into a test tube. | ||
| + | |||
Step 6) Add the 10.0 μL of each of the forward and reverse primers to the test tube. '''Make sure to use different pipettes for each substance or CONTAMINATION WILL OCCUR.''' | Step 6) Add the 10.0 μL of each of the forward and reverse primers to the test tube. '''Make sure to use different pipettes for each substance or CONTAMINATION WILL OCCUR.''' | ||
| + | |||
Step 7) Use a different pipette to transfer 50.0 μL of GoTaq® Colorless Master Mix into the DNA/primer mixture. | Step 7) Use a different pipette to transfer 50.0 μL of GoTaq® Colorless Master Mix into the DNA/primer mixture. | ||
| + | |||
Step 8) Dilute the contents of the test tube by filling its remainder with 47.8μL of deionized water. '''Make sure to use different pipettes to transfer the water or CONTAMINATION WILL OCCUR | Step 8) Dilute the contents of the test tube by filling its remainder with 47.8μL of deionized water. '''Make sure to use different pipettes to transfer the water or CONTAMINATION WILL OCCUR | ||
| + | |||
Step 9) Repeat steps 5-8 until all six DNA samples and the positive and negative controls are prepared. '''Make sure to use different pipettes to transfer each substance or CONTAMINATION WILL OCCUR.''' | Step 9) Repeat steps 5-8 until all six DNA samples and the positive and negative controls are prepared. '''Make sure to use different pipettes to transfer each substance or CONTAMINATION WILL OCCUR.''' | ||
| + | |||
Step 10) Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid (making sure the catch snaps shut) and tighten the screw so that it barely touches the tops of the tubes. '''CAUTION: If the heating lid does not touch the top of the tubes the experiment will not be carried out successfully. If the heating lid is too far low and is crushing the tubes THE TEST TUBES WILL SHATTER. Make sure to align the lid properly.''' | Step 10) Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid (making sure the catch snaps shut) and tighten the screw so that it barely touches the tops of the tubes. '''CAUTION: If the heating lid does not touch the top of the tubes the experiment will not be carried out successfully. If the heating lid is too far low and is crushing the tubes THE TEST TUBES WILL SHATTER. Make sure to align the lid properly.''' | ||
| + | |||
Step 11) Label each of the test tubes: numbering the experimental DNA samples from 1 to 6, P for the positive and N for the negative controls accordingly. | Step 11) Label each of the test tubes: numbering the experimental DNA samples from 1 to 6, P for the positive and N for the negative controls accordingly. | ||
| + | |||
Step 12) Click on “Plug in Open PCR to start” to begin amplifying DNA samples. | Step 12) Click on “Plug in Open PCR to start” to begin amplifying DNA samples. | ||
| + | |||
Step 13) Be sure to observe the LED display screen on the lid of the Open PCR with the quantities that appear on the computer: if these quantities are close (<2.0°C/5 seconds), then continue running the program. '''If these quantities are not close (>2.0°C/5 seconds), then discontinue the program and inspect the machine for any faults. Begin Step 12 again.''' | Step 13) Be sure to observe the LED display screen on the lid of the Open PCR with the quantities that appear on the computer: if these quantities are close (<2.0°C/5 seconds), then continue running the program. '''If these quantities are not close (>2.0°C/5 seconds), then discontinue the program and inspect the machine for any faults. Begin Step 12 again.''' | ||
| - | DNA Measurement Protocol | + | |
| + | |||
| + | '''DNA Measurement Protocol''' | ||
| + | |||
Step 1) Open the lid of the PCR machine (by releasing the catch) and remove the 8 samples from the PCR machine. | Step 1) Open the lid of the PCR machine (by releasing the catch) and remove the 8 samples from the PCR machine. | ||
| + | |||
Step 2) Label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination. | Step 2) Label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination. | ||
| + | |||
Step 3) Measure 400mL of the Tris buffer into the 500.0mL graduated cylinder and pour it into an Eppendorf tube. Repeat 7 times for a total of 8 tubes. | Step 3) Measure 400mL of the Tris buffer into the 500.0mL graduated cylinder and pour it into an Eppendorf tube. Repeat 7 times for a total of 8 tubes. | ||
| + | |||
Step 4) Extract each sample with the accordingly labeled pipette into the accordingly labeled Eppendorf tube that contains 400.0mL of Tris buffer. '''Be sure to transfer all of the sample into the tube.''' | Step 4) Extract each sample with the accordingly labeled pipette into the accordingly labeled Eppendorf tube that contains 400.0mL of Tris buffer. '''Be sure to transfer all of the sample into the tube.''' | ||
| + | |||
Step 5) Set up the sample DNA calf thymus by transferring 100.0μL into a separately labeled Eppendorf tube containing 400.0mL of Tris buffer with a different pipette. | Step 5) Set up the sample DNA calf thymus by transferring 100.0μL into a separately labeled Eppendorf tube containing 400.0mL of Tris buffer with a different pipette. | ||
| + | |||
Step 6) Transfer 100.0μL of distilled water into the corresponding Eppendorf tube containing 400.0mL of Tris buffer. | Step 6) Transfer 100.0μL of distilled water into the corresponding Eppendorf tube containing 400.0mL of Tris buffer. | ||
| + | |||
Step 7) Place a hydrophobic glass slide onto the fluorimeter. | Step 7) Place a hydrophobic glass slide onto the fluorimeter. | ||
| + | |||
Step 8) Unbutton one side of the black box and lift the flap so that it is resting on top of the box. Flip the box upside down and position it so that the fluorimeter lies in the center of the box, obscuring most light while still leaving some space for you to take a picture. | Step 8) Unbutton one side of the black box and lift the flap so that it is resting on top of the box. Flip the box upside down and position it so that the fluorimeter lies in the center of the box, obscuring most light while still leaving some space for you to take a picture. | ||
| + | |||
Step 9) Flip a switch on the side of the fluorimeter (A blue light should come into view.) | Step 9) Flip a switch on the side of the fluorimeter (A blue light should come into view.) | ||
| + | |||
Step 10) From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding labeled pipette to place two drops adjacent to one another on a glass slide. (''The two drops should combine to form a single larger drop.'') | Step 10) From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding labeled pipette to place two drops adjacent to one another on a glass slide. (''The two drops should combine to form a single larger drop.'') | ||
| + | |||
Step 11) Turn off the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | Step 11) Turn off the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | ||
| + | |||
Step 12) Adjust the following settings on the smartphone | Step 12) Adjust the following settings on the smartphone | ||
| + | |||
Substep A) Disable camera flash. | Substep A) Disable camera flash. | ||
| + | |||
Substep B) Set the ISO to 800 or higher. | Substep B) Set the ISO to 800 or higher. | ||
| + | |||
Substep C) Set the white balance to auto. | Substep C) Set the white balance to auto. | ||
| + | |||
Substep D) Maximize the exposure setting. | Substep D) Maximize the exposure setting. | ||
| + | |||
Substep E) Maximize the saturation setting. | Substep E) Maximize the saturation setting. | ||
| + | |||
Substep F) Minimize the contrast setting. | Substep F) Minimize the contrast setting. | ||
| + | |||
'''Note that not all smartphone cameras will have these settings, just disable flash if not all these options are available.''' | '''Note that not all smartphone cameras will have these settings, just disable flash if not all these options are available.''' | ||
| + | |||
| + | |||
Step 13) Take a picture of the fluorimeter and the SYBR green dye drop, recording the image number and DNA sample. | Step 13) Take a picture of the fluorimeter and the SYBR green dye drop, recording the image number and DNA sample. | ||
| + | |||
Step 14) Repeat steps 7,10, and 13 for the 9 remaining DNA solutions using a different glass slide and pipette for each sample. | Step 14) Repeat steps 7,10, and 13 for the 9 remaining DNA solutions using a different glass slide and pipette for each sample. | ||
| + | |||
Step 15) Download all 8 images onto the computer. | Step 15) Download all 8 images onto the computer. | ||
| + | |||
Step 16) Right click on the file name of the picture and open it with Image J. (''Alternatively, open the Image J software, and select File > Open > examplepicturename01'') | Step 16) Right click on the file name of the picture and open it with Image J. (''Alternatively, open the Image J software, and select File > Open > examplepicturename01'') | ||
| + | |||
Step 17) In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value. | Step 17) In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value. | ||
| + | |||
Step 18) Select Image > Color > Split Channels. Three images will appear; choose the one named green. | Step 18) Select Image > Color > Split Channels. Three images will appear; choose the one named green. | ||
| + | |||
Step 19) Draw an oval around the drop. Select analyze and measure then record the measurements. | Step 19) Draw an oval around the drop. Select analyze and measure then record the measurements. | ||
| + | |||
Step 20) Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | Step 20) Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN. | ||
| + | |||
Step 21) Repeat steps 16-20 for each of the 8 pictures, making sure each sample lines up with the correct INTDEN measurements. | Step 21) Repeat steps 16-20 for each of the 8 pictures, making sure each sample lines up with the correct INTDEN measurements. | ||
| + | |||
Step 22) Subtract the INTDEN background measurement from the INTDEN drop measurement. | Step 22) Subtract the INTDEN background measurement from the INTDEN drop measurement. | ||
| + | |||
Step 23) Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL. | Step 23) Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL. | ||
| + | |||
Step 24) Use a graphing program (''Such as Excel'') to generate a plot of INTDEN (with background subtracted) versus concentration. Select the option to display the linear equation. | Step 24) Use a graphing program (''Such as Excel'') to generate a plot of INTDEN (with background subtracted) versus concentration. Select the option to display the linear equation. | ||
| + | |||
Step 25) Use the linear equation and the INTDEN values of the samples to determine their concentrations. | Step 25) Use the linear equation and the INTDEN values of the samples to determine their concentrations. | ||
| - | Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for | + | |
| + | Step 26) Once the DNA concentrations of the positive and negative are known, it can determined whether samples give a positive or negative result for Alzheimer's disease. | ||
==Research and Development== | ==Research and Development== | ||
| Line 255: | Line 303: | ||
Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br> | Reverse Primer: GT<font color="red">C</font>GAAGTGAAGTCTCTAGA<br> | ||
Forward Primer: TAGCCTATTTATTTTCTTCA<br> | Forward Primer: TAGCCTATTTATTTTCTTCA<br> | ||
| - | The diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation. | + | The target diseased allele will be replicated because the changed nucleotide is contained within the reverse primers. That means that the primer will not bind to a healthy gene but will bond to the gene with the mutation. |
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Our TeamLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials List of Required Materials for PCR & DNA measurements
Contents of each DNA solution
PCR Protocol Step 1) Download the Open PCR software.
Substep A) Click on the “more options” button. Substep B) Select the plus symbol next to initial step, and set 95°C and 180 seconds for temperature and time. Substep C) In the box labeled Number of Cycles, input 30. Substep D) Set the denaturing temperature and time to 95°C and 30 seconds. (The two boxes in the first row) Substep E) Set the annealing temperature and time to 57°C and 30 seconds. (The two boxes in the second row) Substep F) Set the extending temperature and time to 72°C and 30 seconds. (The two boxes in the third row) Substep G) Add a final step. Set the temperature and time to 72°C and 180 seconds. Substep H) Set the final hold temperature to 4°C.
DNA Measurement Protocol
Substep A) Disable camera flash. Substep B) Set the ISO to 800 or higher. Substep C) Set the white balance to auto. Substep D) Maximize the exposure setting. Substep E) Maximize the saturation setting. Substep F) Minimize the contrast setting. Note that not all smartphone cameras will have these settings, just disable flash if not all these options are available.
Step 13) Take a picture of the fluorimeter and the SYBR green dye drop, recording the image number and DNA sample.
Research and DevelopmentBackground on Disease Markers
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






